hs-samtools 0.7.0.0 → 0.8.0.0

raw patch · 26 files changed

+1266/−432 lines, 26 filesPVP ok

version bump matches the API change (PVP)

API changes (from Hackage documentation)

Files

• CHANGELOG.md +6/−0
• hs-samtools.cabal +8/−2
• src/Data/SAM/Version1_6/Alignment.hs +0/−8
• src/Data/SAM/Version1_6/Alignment/AOPT.hs +68/−0
• src/Data/SAM/Version1_6/Alignment/BOPT.hs +49/−54
• src/Data/SAM/Version1_6/Alignment/Base.hs +45/−47
• src/Data/SAM/Version1_6/Alignment/FOPT.hs +68/−0
• src/Data/SAM/Version1_6/Alignment/HOPT.hs +68/−0
• src/Data/SAM/Version1_6/Alignment/IOPT.hs +68/−0
• src/Data/SAM/Version1_6/Alignment/ZOPT.hs +68/−0
• src/Data/SAM/Version1_6/Base.hs +13/−18
• src/Data/SAM/Version1_6/Header.hs +0/−8
• src/Data/SAM/Version1_6/Header/CO.hs +3/−8
• src/Data/SAM/Version1_6/Header/HD.hs +21/−26
• src/Data/SAM/Version1_6/Header/PG.hs +31/−36
• src/Data/SAM/Version1_6/Header/RG.hs +73/−77
• src/Data/SAM/Version1_6/Header/SQ.hs +53/−58
• src/Data/SAM/Version1_6/Read/Base.hs +1/−1
• src/Data/SAM/Version1_6/Read/Error.hs +0/−6
• src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs +11/−9
• src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs +11/−8
• src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs +12/−12
• src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs +11/−8
• src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs +11/−9
• src/Data/SAM/Version1_6/Write/Base.hs +551/−0
• test/Main.hs +16/−37

@@ -82,3 +82,9 @@ * Fixed broken parsing of SAM_V1_6(..). * Strengthened parsing of SAM_V1_6(..) by accurately emulating the sam v1.6 specification through use of permutable parsers. * Added initial test suite.++## 0.8.0.0 -- 2023-10-30++* Adding functionality to write SAM_V1_6(..) to file.+* Made show instances of many newtypes/datatypes more verbose to match fields of said newtypes/datatypes.+* Added initial writeSAM_V1_6 test case.

@@ -20,7 +20,7 @@ -- PVP summary:     +-+------- breaking API changes --                  | | +----- non-breaking API additions --                  | | | +--- code changes with no API change-version:            0.7.0.0+version:            0.8.0.0  -- A short (one-line) description of the package. synopsis: Read and write SAM, BAM, and CRAM files.@@ -68,6 +68,11 @@     exposed-modules: Data.SAM.Version1_6.Base,                      Data.SAM.Version1_6.Alignment,                      Data.SAM.Version1_6.Alignment.Base,+                     Data.SAM.Version1_6.Alignment.AOPT,+                     Data.SAM.Version1_6.Alignment.FOPT,+                     Data.SAM.Version1_6.Alignment.HOPT,+                     Data.SAM.Version1_6.Alignment.IOPT,+                     Data.SAM.Version1_6.Alignment.ZOPT,                      Data.SAM.Version1_6.Alignment.BOPT,                      Data.SAM.Version1_6.Header,                       Data.SAM.Version1_6.Header.CO,@@ -122,7 +127,8 @@                      Data.SAM.Version1_6.Read.Parser.Header.PG.PP,                      Data.SAM.Version1_6.Read.Parser.Header.PG.DS,                      Data.SAM.Version1_6.Read.Parser.Header.PG.VN,-                     Data.SAM.Version1_6.Read.Parser.Header.CO.Base+                     Data.SAM.Version1_6.Read.Parser.Header.CO.Base,+                     Data.SAM.Version1_6.Write.Base      -- Modules included in this library but not exported.     -- other-modules:

@@ -1,15 +1,7 @@-{-# LANGUAGE DeriveDataTypeable    #-}-{-# LANGUAGE DeriveGeneric         #-} {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-}-{-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Alignment

@@ -0,0 +1,68 @@+{-# LANGUAGE DeriveDataTypeable    #-}+{-# LANGUAGE DeriveGeneric         #-}+{-# LANGUAGE FlexibleContexts      #-}+{-# LANGUAGE FlexibleInstances     #-}+{-# LANGUAGE MultiParamTypeClasses #-}+{-# LANGUAGE OverloadedStrings     #-}+{-# LANGUAGE TypeFamilies          #-}++-- |+-- Module      :  Data.SAM.Version1_6.Alignment.AOPT+-- Copyright   :  (c) Matthew Mosior 2023+-- License     :  BSD-style+-- Maintainer  :  mattm.github@gmail.com+-- Portability :  portable+--+-- = WARNING+--+-- This module is considered __internal__.+--+-- The Package Versioning Policy __does not apply__.+--+-- The contents of this module may change __in any way whatsoever__+-- and __without any warning__ between minor versions of this package.+--+-- Authors importing this library are expected to track development+-- closely.+--+-- All credit goes to the author(s)/maintainer(s) of the+-- [containers](https://hackage.haskell.org/package/containers) library+-- for the above warning text.+--+-- = Description+--+-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.++module Data.SAM.Version1_6.Alignment.AOPT ( -- * SAM version 1.6 alignment optional fields data type+                                            SAM_V1_6_Alignment_AOPT(..)+                                          ) where++import Data.ByteString (ByteString)+import Data.Data+import Generics.Deriving.Base+++-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_AOPT"@ data type.+--+-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.+data SAM_V1_6_Alignment_AOPT = SAM_V1_6_Alignment_AOPT { sam_v1_6_alignment_aopt_tag   :: ByteString +                                                       , sam_v1_6_alignment_aopt_value :: ByteString+                                                       }+  deriving (Generic,Typeable)++instance Eq SAM_V1_6_Alignment_AOPT where+  SAM_V1_6_Alignment_AOPT sam_v1_6_alignment_aopt_tag1+                          sam_v1_6_alignment_aopt_value1 == SAM_V1_6_Alignment_AOPT sam_v1_6_alignment_aopt_tag2+                                                                                    sam_v1_6_alignment_aopt_value2 = sam_v1_6_alignment_aopt_tag1   == sam_v1_6_alignment_aopt_tag2     &&+                                                                                                                     sam_v1_6_alignment_aopt_value1  == sam_v1_6_alignment_aopt_value2++instance Show SAM_V1_6_Alignment_AOPT where+  show (SAM_V1_6_Alignment_AOPT tag+                                value+       ) =+    "SAM_V1_6_Alignment_AOPT { "          +++    "sam_v1_6_alignment_aopt_tag = "      +++    (show tag)                            +++    " , sam_v1_6_alignment_aopt_value = " +++    (show value)                          +++    " }"

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-} {-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Alignment.BOPT@@ -133,13 +128,13 @@                                      bopttype                                      value        ) =-    "SAM_V1_6_Alignment_BOPT_Int8 { " ++-    "tag  = "                         ++-    (show tag)                        ++-    " , type = "                      ++-    (show bopttype)                   ++-    " , value = "                     ++-    (show value)                      +++    "SAM_V1_6_Alignment_BOPT_Int8 { "          +++    "sam_v1_6_alignment_bopt_int8_tag  = "     +++    (show tag)                                 +++    " , sam_v1_6_alignment_bopt_int8_type = "  +++    (show bopttype)                            +++    " , sam_v1_6_alignment_bopt_int8_value = " +++    (show value)                               ++     " }"  -- | c__C__sSiIf of the last optional field (type B).@@ -159,13 +154,13 @@                                       bopttype                                       value        ) =-    "SAM_V1_6_Alignment_BOPT_Word8 { " ++-    "tag  = "                          ++-    (show tag)                         ++-    " , type = "                       ++-    (show bopttype)                    ++-    " , value = "                      ++-    (show value)                       +++    "SAM_V1_6_Alignment_BOPT_Word8 { "          +++    "sam_v1_6_alignment_bopt_word8_tag  = "     +++    (show tag)                                  +++    " , sam_v1_6_alignment_bopt_word8_type = "  +++    (show bopttype)                             +++    " , sam_v1_6_alignment_bopt_word8_value = " +++    (show value)                                ++     " }"  -- | cC__s__SiIf of the last optional field (type B).@@ -185,13 +180,13 @@                                       bopttype                                       value        ) =-    "SAM_V1_6_Alignment_BOPT_Int16 { " ++-    "tag  = "                          ++-    (show tag)                         ++-    " , type = "                       ++-    (show bopttype)                    ++-    " , value = "                      ++-    (show value)                       +++    "SAM_V1_6_Alignment_BOPT_Int16 { "          +++    "sam_v1_6_alignment_bopt_int16_tag  = "     +++    (show tag)                                  +++    " , sam_v1_6_alignment_bopt_int16_type = "  +++    (show bopttype)                             +++    " , sam_v1_6_alignment_bopt_int16_value = " +++    (show value)                                ++     " }"  -- | cCs__S__iIf of the last optional field (type B).@@ -211,13 +206,13 @@                                        bopttype                                        value        ) =-    "SAM_V1_6_Alignment_BOPT_Word16 { " ++-    "tag  = "                           ++-    (show tag)                          ++-    " , type = "                        ++-    (show bopttype)                     ++-    " , value = "                       ++-    (show value)                        +++    "SAM_V1_6_Alignment_BOPT_Word16 { "          +++    "sam_v1_6_alignment_bopt_word16_tag  = "     +++    (show tag)                                   +++    " , sam_v1_6_alignment_bopt_word16_type = "  +++    (show bopttype)                              +++    " , sam_v1_6_alignment_bopt_word16_value = " +++    (show value)                                 ++     " }"  -- | cCsS__i__If of the last optional field (type B).@@ -237,13 +232,13 @@                                       bopttype                                       value        ) =-    "SAM_V1_6_Alignment_BOPT_Int32 { " ++-    "tag  = "                          ++-    (show tag)                         ++-    " , type = "                       ++-    (show bopttype)                    ++-    " , value = "                      ++-    (show value)                       +++    "SAM_V1_6_Alignment_BOPT_Int32 { "          +++    "sam_v1_6_alignment_bopt_int32_tag  = "     +++    (show tag)                                  +++    " , sam_v1_6_alignment_bopt_int32_type = "  +++    (show bopttype)                             +++    " , sam_v1_6_alignment_bopt_int32_value = " +++    (show value)                                ++     " }"  -- | cCsSi__I__f of the last optional field (type B).@@ -263,13 +258,13 @@                                        bopttype                                        value        ) =-    "SAM_V1_6_Alignment_BOPT_Word32 { " ++-    "tag  = "                           ++-    (show tag)                          ++-    " , type = "                        ++-    (show bopttype)                     ++-    " , value = "                       ++-    (show value)                        +++    "SAM_V1_6_Alignment_BOPT_Word32 { "          +++    "sam_v1_6_alignment_bopt_word32_tag  = "     +++    (show tag)                                   +++    " , sam_v1_6_alignment_bopt_word32_type = "  +++    (show bopttype)                              +++    " , sam_v1_6_alignment_bopt_word32_value = " +++    (show value)                                 ++     " }"  -- | cCsSiI__f__ of the last optional field (type B).@@ -289,11 +284,11 @@                                       bopttype                                       value        ) =-    "SAM_V1_6_Alignment_BOPT_Float { " ++-    "tag  = "                          ++-    (show tag)                         ++-    " , type = "                       ++-    (show bopttype)                    ++-    " , value = "                      ++-    (show value)                       +++    "SAM_V1_6_Alignment_BOPT_Float { "          +++    "sam_v1_6_alignment_bopt_float_tag  = "     +++    (show tag)                                  +++    " , sam_v1_6_alignment_bopt_float_type = "  +++    (show bopttype)                             +++    " , sam_v1_6_alignment_bopt_float_value = " +++    (show value)                                ++     " }"

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts            #-} {-# LANGUAGE FlexibleInstances           #-} {-# LANGUAGE MultiParamTypeClasses       #-}-{-# LANGUAGE OverloadedLists             #-} {-# LANGUAGE OverloadedStrings           #-}-{-# LANGUAGE PackageImports              #-}-{-# LANGUAGE RecordWildCards             #-}-{-# LANGUAGE TemplateHaskell             #-} {-# LANGUAGE TypeFamilies                #-}-{-# Language QuasiQuotes                 #-} {-# OPTIONS_GHC -fno-warn-name-shadowing #-}  -- |@@ -27,12 +22,15 @@                                             SAM_V1_6_Alignment(..)                                           ) where +import Data.SAM.Version1_6.Alignment.AOPT+import Data.SAM.Version1_6.Alignment.IOPT+import Data.SAM.Version1_6.Alignment.FOPT+import Data.SAM.Version1_6.Alignment.ZOPT+import Data.SAM.Version1_6.Alignment.HOPT import Data.SAM.Version1_6.Alignment.BOPT  import Data.ByteString import Data.Data-import Data.Sequence-import Data.Word import Generics.Deriving.Base  -- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment"@ data type.@@ -102,11 +100,11 @@                                                                                                          -- This field can be a ‘*’ when quality is not stored.                                                                                                          -- If not a ‘*’, SEQ must not be a ‘*’ and the length of the quality                                                                                                          -- string ought to equal the length of SEQ.-                                             , sam_v1_6_alignment_aopt  :: Maybe ByteString              -- ^ A - [!-~] - Printable characters.-                                             , sam_v1_6_alignment_iopt  :: Maybe Integer                 -- ^ i - [-+]?[0-9]+ - Signed integer.-                                             , sam_v1_6_alignment_fopt  :: Maybe Float                   -- ^ f - [-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? - Single-precision floating number.-                                             , sam_v1_6_alignment_zopt  :: Maybe ByteString              -- ^ Z - [ !-~]* - Printable string, including space.-                                             , sam_v1_6_alignment_hopt  :: Maybe (Seq Word8)             -- ^ H - ([0-9A-F][0-9A-F])* - Byte array in the Hex format.+                                             , sam_v1_6_alignment_aopt  :: Maybe SAM_V1_6_Alignment_AOPT -- ^ A - [!-~] - Printable characters.+                                             , sam_v1_6_alignment_iopt  :: Maybe SAM_V1_6_Alignment_IOPT -- ^ i - [-+]?[0-9]+ - Signed integer.+                                             , sam_v1_6_alignment_fopt  :: Maybe SAM_V1_6_Alignment_FOPT -- ^ f - [-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? - Single-precision floating number.+                                             , sam_v1_6_alignment_zopt  :: Maybe SAM_V1_6_Alignment_ZOPT -- ^ Z - [ !-~]* - Printable string, including space.+                                             , sam_v1_6_alignment_hopt  :: Maybe SAM_V1_6_Alignment_HOPT -- ^ H - ([0-9A-F][0-9A-F])* - Byte array in the Hex format.                                              , sam_v1_6_alignment_bopt  :: Maybe SAM_V1_6_Alignment_BOPT -- ^ B - [cCsSiIf]​(,[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)* - Integer or numeric array.                                              }   deriving (Generic,Typeable)@@ -164,39 +162,39 @@  instance Show SAM_V1_6_Alignment where   show (SAM_V1_6_Alignment qname flag rname pos mapq cigar rnext pnext tlen seq qual aopt iopt fopt zopt hopt bopt) =-    "SAM_V1_6_Alignment { " ++-    "qname = "              ++-    (show qname)            ++-    " , flag = "            ++-    (show flag)             ++-    " , rname = "           ++-    (show rname)            ++-    " , pos = "             ++-    (show pos)              ++-    " , mapq = "            ++-    (show mapq)             ++-    " , cigar = "           ++-    (show cigar)            ++-    " , rnext = "           ++-    (show rnext)            ++-    " , pnext = "           ++-    (show pnext)            ++-    " , tlen = "            ++-    (show tlen)             ++-    " , seq = "             ++-    (show seq)              ++-    " , qual = "            ++-    (show qual)             ++-    " , aopt = "            ++-    ( show aopt)            ++-    " , iopt = "            ++-    (show iopt)             ++-    " , fopt = "            ++-    (show fopt)             ++-    " , zopt = "            ++-    (show zopt)             ++-    " , hopt = "            ++-    (show hopt)             ++-    " , bopt = "            ++-    (show bopt)             +++    "SAM_V1_6_Alignment { "          +++    "sam_v1_6_alignment_qname = "    +++    (show qname)                     +++    " , sam_v1_6_alignment_flag = "  +++    (show flag)                      +++    " , sam_v1_6_alignment_rname = " +++    (show rname)                     +++    " , sam_v1_6_alignment_pos = "   +++    (show pos)                       +++    " , sam_v1_6_alignment_mapq = "  +++    (show mapq)                      +++    " , sam_v1_6_alignment_cigar = " +++    (show cigar)                     +++    " , sam_v1_6_alignment_rnext = " +++    (show rnext)                     +++    " , sam_v1_6_alignment_pnext = " +++    (show pnext)                     +++    " , sam_v1_6_alignment_tlen = "  +++    (show tlen)                      +++    " , sam_v1_6_alignment_seq = "   +++    (show seq)                       +++    " , sam_v1_6_alignment_qual = "  +++    (show qual)                      +++    " , sam_v1_6_alignment_aopt = "  +++    ( show aopt)                     +++    " , sam_v1_6_alignment_iopt = "  +++    (show iopt)                      +++    " , sam_v1_6_alignment_fopt = "  +++    (show fopt)                      +++    " , sam_v1_6_alignment_zopt = "  +++    (show zopt)                      +++    " , sam_v1_6_alignment_hopt = "  +++    (show hopt)                      +++    " , sam_v1_6_alignment_bopt = "  +++    (show bopt)                      ++     " }"

@@ -0,0 +1,68 @@+{-# LANGUAGE DeriveDataTypeable    #-}+{-# LANGUAGE DeriveGeneric         #-}+{-# LANGUAGE FlexibleContexts      #-}+{-# LANGUAGE FlexibleInstances     #-}+{-# LANGUAGE MultiParamTypeClasses #-}+{-# LANGUAGE OverloadedStrings     #-}+{-# LANGUAGE TypeFamilies          #-}++-- |+-- Module      :  Data.SAM.Version1_6.Alignment.FOPT+-- Copyright   :  (c) Matthew Mosior 2023+-- License     :  BSD-style+-- Maintainer  :  mattm.github@gmail.com+-- Portability :  portable+--+-- = WARNING+--+-- This module is considered __internal__.+--+-- The Package Versioning Policy __does not apply__.+--+-- The contents of this module may change __in any way whatsoever__+-- and __without any warning__ between minor versions of this package.+--+-- Authors importing this library are expected to track development+-- closely.+--+-- All credit goes to the author(s)/maintainer(s) of the+-- [containers](https://hackage.haskell.org/package/containers) library+-- for the above warning text.+--+-- = Description+--+-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.++module Data.SAM.Version1_6.Alignment.FOPT ( -- * SAM version 1.6 alignment optional fields data type+                                            SAM_V1_6_Alignment_FOPT(..)+                                          ) where++import Data.ByteString (ByteString)+import Data.Data+import Generics.Deriving.Base+++-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_FOPT"@ data type.+--+-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.+data SAM_V1_6_Alignment_FOPT = SAM_V1_6_Alignment_FOPT { sam_v1_6_alignment_fopt_tag   :: ByteString +                                                       , sam_v1_6_alignment_fopt_value :: Float+                                                       }+  deriving (Generic,Typeable)++instance Eq SAM_V1_6_Alignment_FOPT where+  SAM_V1_6_Alignment_FOPT sam_v1_6_alignment_fopt_tag1+                          sam_v1_6_alignment_fopt_value1 == SAM_V1_6_Alignment_FOPT sam_v1_6_alignment_fopt_tag2+                                                                                    sam_v1_6_alignment_fopt_value2 = sam_v1_6_alignment_fopt_tag1   == sam_v1_6_alignment_fopt_tag2     &&+                                                                                                                     sam_v1_6_alignment_fopt_value1  == sam_v1_6_alignment_fopt_value2++instance Show SAM_V1_6_Alignment_FOPT where+  show (SAM_V1_6_Alignment_FOPT tag+                                value+       ) =+    "SAM_V1_6_Alignment_FOPT { "          +++    "sam_v1_6_alignment_fopt_tag = "      +++    (show tag)                            +++    " , sam_v1_6_alignment_fopt_value = " +++    (show value)                          +++    " }"

@@ -0,0 +1,68 @@+{-# LANGUAGE DeriveDataTypeable    #-}+{-# LANGUAGE DeriveGeneric         #-}+{-# LANGUAGE FlexibleContexts      #-}+{-# LANGUAGE FlexibleInstances     #-}+{-# LANGUAGE MultiParamTypeClasses #-}+{-# LANGUAGE OverloadedStrings     #-}+{-# LANGUAGE TypeFamilies          #-}++-- |+-- Module      :  Data.SAM.Version1_6.Alignment.HOPT+-- Copyright   :  (c) Matthew Mosior 2023+-- License     :  BSD-style+-- Maintainer  :  mattm.github@gmail.com+-- Portability :  portable+--+-- = WARNING+--+-- This module is considered __internal__.+--+-- The Package Versioning Policy __does not apply__.+--+-- The contents of this module may change __in any way whatsoever__+-- and __without any warning__ between minor versions of this package.+--+-- Authors importing this library are expected to track development+-- closely.+--+-- All credit goes to the author(s)/maintainer(s) of the+-- [containers](https://hackage.haskell.org/package/containers) library+-- for the above warning text.+--+-- = Description+--+-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.++module Data.SAM.Version1_6.Alignment.HOPT ( -- * SAM version 1.6 alignment optional fields data type+                                            SAM_V1_6_Alignment_HOPT(..)+                                          ) where++import Data.ByteString (ByteString)+import Data.Data+import Generics.Deriving.Base+++-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_HOPT"@ data type.+--+-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.+data SAM_V1_6_Alignment_HOPT = SAM_V1_6_Alignment_HOPT { sam_v1_6_alignment_hopt_tag   :: ByteString +                                                       , sam_v1_6_alignment_hopt_value :: ByteString+                                                       }+  deriving (Generic,Typeable)++instance Eq SAM_V1_6_Alignment_HOPT where+  SAM_V1_6_Alignment_HOPT sam_v1_6_alignment_hopt_tag1+                          sam_v1_6_alignment_hopt_value1 == SAM_V1_6_Alignment_HOPT sam_v1_6_alignment_hopt_tag2+                                                                                    sam_v1_6_alignment_hopt_value2 = sam_v1_6_alignment_hopt_tag1   == sam_v1_6_alignment_hopt_tag2     &&+                                                                                                                     sam_v1_6_alignment_hopt_value1  == sam_v1_6_alignment_hopt_value2++instance Show SAM_V1_6_Alignment_HOPT where+  show (SAM_V1_6_Alignment_HOPT tag+                                value+       ) =+    "SAM_V1_6_Alignment_HOPT { "          +++    "sam_v1_6_alignment_hopt_tag = "      +++    (show tag)                            +++    " , sam_v1_6_alignment_hopt_value = " +++    (show value)                          +++    " }"

@@ -0,0 +1,68 @@+{-# LANGUAGE DeriveDataTypeable    #-}+{-# LANGUAGE DeriveGeneric         #-}+{-# LANGUAGE FlexibleContexts      #-}+{-# LANGUAGE FlexibleInstances     #-}+{-# LANGUAGE MultiParamTypeClasses #-}+{-# LANGUAGE OverloadedStrings     #-}+{-# LANGUAGE TypeFamilies          #-}++-- |+-- Module      :  Data.SAM.Version1_6.Alignment.IOPT+-- Copyright   :  (c) Matthew Mosior 2023+-- License     :  BSD-style+-- Maintainer  :  mattm.github@gmail.com+-- Portability :  portable+--+-- = WARNING+--+-- This module is considered __internal__.+--+-- The Package Versioning Policy __does not apply__.+--+-- The contents of this module may change __in any way whatsoever__+-- and __without any warning__ between minor versions of this package.+--+-- Authors importing this library are expected to track development+-- closely.+--+-- All credit goes to the author(s)/maintainer(s) of the+-- [containers](https://hackage.haskell.org/package/containers) library+-- for the above warning text.+--+-- = Description+--+-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.++module Data.SAM.Version1_6.Alignment.IOPT ( -- * SAM version 1.6 alignment optional fields data type+                                            SAM_V1_6_Alignment_IOPT(..)+                                          ) where++import Data.ByteString (ByteString)+import Data.Data+import Generics.Deriving.Base+++-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_IOPT"@ data type.+--+-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.+data SAM_V1_6_Alignment_IOPT = SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag   :: ByteString +                                                       , sam_v1_6_alignment_iopt_value :: Integer+                                                       }+  deriving (Generic,Typeable)++instance Eq SAM_V1_6_Alignment_IOPT where+  SAM_V1_6_Alignment_IOPT sam_v1_6_alignment_iopt_tag1+                          sam_v1_6_alignment_iopt_value1 == SAM_V1_6_Alignment_IOPT sam_v1_6_alignment_iopt_tag2+                                                                                    sam_v1_6_alignment_iopt_value2 = sam_v1_6_alignment_iopt_tag1   == sam_v1_6_alignment_iopt_tag2     &&+                                                                                                                     sam_v1_6_alignment_iopt_value1  == sam_v1_6_alignment_iopt_value2++instance Show SAM_V1_6_Alignment_IOPT where+  show (SAM_V1_6_Alignment_IOPT tag+                                value+       ) =+    "SAM_V1_6_Alignment_IOPT { "          +++    "sam_v1_6_alignment_iopt_tag = "      +++    (show tag)                            +++    " , sam_v1_6_alignment_iopt_value = " +++    (show value)                          +++    " }"

@@ -0,0 +1,68 @@+{-# LANGUAGE DeriveDataTypeable    #-}+{-# LANGUAGE DeriveGeneric         #-}+{-# LANGUAGE FlexibleContexts      #-}+{-# LANGUAGE FlexibleInstances     #-}+{-# LANGUAGE MultiParamTypeClasses #-}+{-# LANGUAGE OverloadedStrings     #-}+{-# LANGUAGE TypeFamilies          #-}++-- |+-- Module      :  Data.SAM.Version1_6.Alignment.ZOPT+-- Copyright   :  (c) Matthew Mosior 2023+-- License     :  BSD-style+-- Maintainer  :  mattm.github@gmail.com+-- Portability :  portable+--+-- = WARNING+--+-- This module is considered __internal__.+--+-- The Package Versioning Policy __does not apply__.+--+-- The contents of this module may change __in any way whatsoever__+-- and __without any warning__ between minor versions of this package.+--+-- Authors importing this library are expected to track development+-- closely.+--+-- All credit goes to the author(s)/maintainer(s) of the+-- [containers](https://hackage.haskell.org/package/containers) library+-- for the above warning text.+--+-- = Description+--+-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.++module Data.SAM.Version1_6.Alignment.ZOPT ( -- * SAM version 1.6 alignment optional fields data type+                                            SAM_V1_6_Alignment_ZOPT(..)+                                          ) where++import Data.ByteString (ByteString)+import Data.Data+import Generics.Deriving.Base+++-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_ZOPT"@ data type.+--+-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.+data SAM_V1_6_Alignment_ZOPT = SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag   :: ByteString +                                                       , sam_v1_6_alignment_zopt_value :: ByteString+                                                       }+  deriving (Generic,Typeable)++instance Eq SAM_V1_6_Alignment_ZOPT where+  SAM_V1_6_Alignment_ZOPT sam_v1_6_alignment_zopt_tag1+                          sam_v1_6_alignment_zopt_value1 == SAM_V1_6_Alignment_ZOPT sam_v1_6_alignment_zopt_tag2+                                                                                    sam_v1_6_alignment_zopt_value2 = sam_v1_6_alignment_zopt_tag1   == sam_v1_6_alignment_zopt_tag2     &&+                                                                                                                     sam_v1_6_alignment_zopt_value1  == sam_v1_6_alignment_zopt_value2++instance Show SAM_V1_6_Alignment_ZOPT where+  show (SAM_V1_6_Alignment_ZOPT tag+                                value+       ) =+    "SAM_V1_6_Alignment_ZOPT { "          +++    "sam_v1_6_alignment_zopt_tag = "      +++    (show tag)                            +++    " , sam_v1_6_alignment_zopt_value = " +++    (show value)                          +++    " }"

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-} {-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Base@@ -82,17 +77,17 @@                  one_line_comment                  alignment        ) =-    "SAM_V1_6 { "                         ++-    "file_level_metadata = "              ++-    (show file_level_metadata)            ++-    " , reference_sequence_dictionary = " ++-    (show reference_sequence_dictionary)  ++-    " , read_group = "                    ++-    (show read_group)                     ++-    " , program = "                       ++-    (show program)                        ++-    " , one_line_comment = "              ++-    (show one_line_comment)               ++-    " , alignment = "                     ++-    (show alignment)                      +++    "SAM_V1_6 { "                                  +++    "sam_v1_6_file_level_metadata = "              +++    (show file_level_metadata)                     +++    " , sam_v1_6_reference_sequence_dictionary = " +++    (show reference_sequence_dictionary)           +++    " , sam_v1_6_read_group = "                    +++    (show read_group)                              +++    " , sam_v1_6_program = "                       +++    (show program)                                 +++    " , sam_v1_6_one_line_comment = "              +++    (show one_line_comment)                        +++    " , sam_v1_6_alignment = "                     +++    (show alignment)                               ++     " }"

@@ -1,15 +1,7 @@-{-# LANGUAGE DeriveDataTypeable    #-}-{-# LANGUAGE DeriveGeneric         #-} {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-}-{-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Header

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-} {-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Header.CO@@ -41,7 +36,7 @@   SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value1 == SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value2 = sam_v1_6_one_line_comment_value1 == sam_v1_6_one_line_comment_value2  instance Show SAM_V1_6_One_Line_Comment where-  show (SAM_V1_6_One_Line_Comment value) = "SAM_V1_6_One_Line_Comment { " ++-                                           "value = "                     ++-                                           (show value)                   +++  show (SAM_V1_6_One_Line_Comment value) = "SAM_V1_6_One_Line_Comment { "       +++                                           "sam_v1_6_one_line_comment_value = " +++                                           (show value)                         ++                                            " }"

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-} {-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Header.HD@@ -59,15 +54,15 @@  instance Show SAM_V1_6_File_Level_Metadata where   show (SAM_V1_6_File_Level_Metadata version sorting_order alignment_grouping subsorting_order) =-    "SAM_V1_6_File_Level_Metadata { " ++-    "version = "                      ++-    (show version)                    ++-    " , sorting_order = "             ++-    (show sorting_order)              ++-    " , alignment_grouping = "        ++-    (show alignment_grouping)         ++-    " , subsorting_order = "          ++-    (show subsorting_order)           +++    "SAM_V1_6_File_Level_Metadata { "                       +++    "sam_v1_6_file_level_metadata_format_version = "        +++    (show version)                                          +++    " , sam_v1_6_file_level_metadata_sorting_order = "      +++    (show sorting_order)                                    +++    " , sam_v1_6_file_level_metadata_alignment_grouping = " +++    (show alignment_grouping)                               +++    " , sam_v1_6_file_level_metadata_subsorting_order = "   +++    (show subsorting_order)                                 ++     " }"   -- | VN tag for @"SAM_V1_6_File_Level_Metadata"@.@@ -80,9 +75,9 @@  instance Show SAM_V1_6_File_Level_Metadata_Format_Version where   show (SAM_V1_6_File_Level_Metadata_Format_Version value) =-    "SAM_V1_6_File_Level_Metadata_Format_Version { " ++-    "value = "                                       ++-    (show value)                                     +++    "SAM_V1_6_File_Level_Metadata_Format_Version { "       +++    "sam_v1_6_file_level_metadata_format_version_value = " +++    (show value)                                           ++     " }"  -- | SO tag for @"SAM_V1_6_File_Level_Metadata"@.@@ -95,9 +90,9 @@  instance Show SAM_V1_6_File_Level_Metadata_Sorting_Order where   show (SAM_V1_6_File_Level_Metadata_Sorting_Order value) =-    "SAM_V1_6_File_Level_Metadata_Sorting_Order { " ++-    "value = "                                      ++-    (show value)                                    +++    "SAM_V1_6_File_Level_Metadata_Sorting_Order { "       +++    "sam_v1_6_file_level_metadata_sorting_order_value = " +++    (show value)                                          ++     " }"  -- | GO tag for @"SAM_V1_6_File_Level_Metadata"@.@@ -110,9 +105,9 @@  instance Show SAM_V1_6_File_Level_Metadata_Alignment_Grouping where   show (SAM_V1_6_File_Level_Metadata_Alignment_Grouping value) =-    "SAM_V1_6_File_Level_Metadata_Alignment_Grouping { " ++-    "value = "                                           ++-    (show value)                                         +++    "SAM_V1_6_File_Level_Metadata_Alignment_Grouping { "       +++    "sam_v1_6_file_level_metadata_alignment_grouping_value = " +++    (show value)                                               ++     " }"  -- | SS tag for @"SAM_V1_6_File_Level_Metadata"@.@@ -125,7 +120,7 @@  instance Show SAM_V1_6_File_Level_Metadata_SubSorting_Order where   show (SAM_V1_6_File_Level_Metadata_SubSorting_Order value) =-    "SAM_V1_6_File_Level_Metadata_SubSorting_Order { " ++-    "value = "                                         ++-    (show value)                                       +++    "SAM_V1_6_File_Level_Metadata_SubSorting_Order { "       +++    "sam_v1_6_file_level_metadata_subsorting_order_value = " +++    (show value)                                             ++     " }"

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-} {-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Header.PG@@ -69,19 +64,19 @@  instance Show SAM_V1_6_Program where   show (SAM_V1_6_Program record_identifier name command_line previous_pg_id description version) =-    "SAM_V1_6_Program { "    ++-    "record_identifier = "   ++-    (show record_identifier) ++-    " , name = "             ++-    (show name)              ++-    " , command_line = "     ++-    (show command_line)      ++-    " , previous_pg_id = "   ++-    (show previous_pg_id)    ++-    " , description = "      ++-    (show description)       ++-    " , version = "          ++-    (show version)           +++    "SAM_V1_6_Program { "                    +++    "rsam_v1_6_program_record_identifier = " +++    (show record_identifier)                 +++    " , sam_v1_6_program_name = "            +++    (show name)                              +++    " , sam_v1_6_program_command_line = "    +++    (show command_line)                      +++    " , sam_v1_6_program_previous_pg_id = "  +++    (show previous_pg_id)                    +++    " , sam_v1_6_program_description = "     +++    (show description)                       +++    " , sam_v1_6_program_version = "         +++    (show version)                           ++     " }"  -- | ID tag for @"SAM_V1_6_Program"@.@@ -94,9 +89,9 @@  instance Show SAM_V1_6_Program_Record_Identifier where   show (SAM_V1_6_Program_Record_Identifier value) =-    "SAM_V1_6_Program_Record_Identifier { " ++-    "value = "                              ++-    (show value)                            +++    "SAM_V1_6_Program_Record_Identifier { "       +++    "sam_v1_6_program_record_identifier_value = " +++    (show value)                                  ++     " }"  -- | PN tag for @"SAM_V1_6_Program"@.@@ -109,9 +104,9 @@  instance Show SAM_V1_6_Program_Name where   show (SAM_V1_6_Program_Name value) =-    "SAM_V1_6_Program_Name { " ++-    "value = "                 ++-    (show value)               +++    "SAM_V1_6_Program_Name { "       +++    "sam_v1_6_program_name_value = " +++    (show value)                     ++     " }"  -- | CL tag for @"SAM_V1_6_Program"@.@@ -124,9 +119,9 @@  instance Show SAM_V1_6_Program_Command_Line where   show (SAM_V1_6_Program_Command_Line value) =-    "SAM_V1_6_Program_Command_Line { " ++-    "value = "                         ++-    (show value)                       +++    "SAM_V1_6_Program_Command_Line { "       +++    "sam_v1_6_program_command_line_value = " +++    (show value)                             ++     " }"  -- | PP tag for @"SAM_V1_6_Program"@.@@ -139,9 +134,9 @@  instance Show SAM_V1_6_Program_Previous_PG_ID where   show (SAM_V1_6_Program_Previous_PG_ID value) =-    "SAM_V1_6_Program_Previous_PG_ID { " ++-    "value = "                           ++-    (show value)                         +++    "SAM_V1_6_Program_Previous_PG_ID { "       +++    "sam_v1_6_program_previous_pg_id_value = " +++    (show value)                               ++     " }"  -- | DS tag for @"SAM_V1_6_Program"@.@@ -154,9 +149,9 @@  instance Show SAM_V1_6_Program_Description where   show (SAM_V1_6_Program_Description value) =-    "SAM_V1_6_Program_Description { " ++-    "value = "                        ++-    (show value)                      +++    "SAM_V1_6_Program_Description { "       +++    "sam_v1_6_program_description_value = " +++    (show value)                            ++     " }"  -- | VN tag for @"SAM_V1_6_Program"@.@@ -169,7 +164,7 @@  instance Show SAM_V1_6_Program_Version where   show (SAM_V1_6_Program_Version value) =-    "SAM_V1_6_Program_Version { " ++-    "value = "                    ++-    (show value)                  +++    "SAM_V1_6_Program_Version { "       +++    "sam_v1_6_program_version_value = " +++    (show value)                        ++     " }"

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-} {-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Header.RG@@ -48,7 +43,7 @@ -- | Custom SAM (version 1.6) @"SAM_V1_6_Read_Group"@ data type. -- -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-data SAM_V1_6_Read_Group = SAM_V1_6_Read_Group { sam_v1_6_read_group_identifer                    :: SAM_V1_6_Read_Group_Identifier+data SAM_V1_6_Read_Group = SAM_V1_6_Read_Group { sam_v1_6_read_group_identifier                   :: SAM_V1_6_Read_Group_Identifier                                                , sam_v1_6_read_group_barcode_sequence             :: Maybe SAM_V1_6_Read_Group_Barcode_Sequence                                                , sam_v1_6_read_group_sequencing_center            :: Maybe SAM_V1_6_Read_Group_Sequencing_Center                                                , sam_v1_6_read_group_description                  :: Maybe SAM_V1_6_Read_Group_Description@@ -63,6 +58,7 @@                                                , sam_v1_6_read_group_platform_unit                :: Maybe SAM_V1_6_Read_Group_Platform_Unit                                                , sam_v1_6_read_group_sample                       :: Maybe SAM_V1_6_Read_Group_Sample                                                }+  deriving (Generic,Typeable)  instance Eq SAM_V1_6_Read_Group where   SAM_V1_6_Read_Group sam_v1_6_read_group_identifier1@@ -122,35 +118,35 @@                             platform_unit                             sample        ) =-    "SAM_V1_6_Read_Group { "                  ++-    "read_group_identifier = "                ++-    (show group_identifier)                   ++-    " , barcode_sequence = "                  ++-    (show barcode_sequence)                   ++-    " , sequencing_center = "                 ++-    (show sequencing_center)                  ++-    " , description = "                       ++-    (show description)                        ++-    " , run_date = "                          ++-    (show run_date)                           ++-    " , flow_order = "                        ++-    (show flow_order)                         ++-    " , key_sequence = "                      ++-    (show key_sequence)                       ++-    " , library = "                           ++-    (show library)                            ++-    " , programs = "                          ++-    (show programs)                           ++-    " , show_predicted_median_insert_size = " ++-    (show predicted_median_insert_size)       ++-    " , platform = "                          ++-    (show platform)                           ++-    " , platform_model = "                    ++-    (show platform_model)                     ++-    " , platform_unit = "                     ++-    (show platform_unit)                      ++-    " , sample = "                            ++-    (show sample)                             +++    "SAM_V1_6_Read_Group { "                                      +++    "sam_v1_6_read_group_identifier = "                           +++    (show group_identifier)                                       +++    " , sam_v1_6_read_group_barcode_sequence = "                  +++    (show barcode_sequence)                                       +++    " , sam_v1_6_read_group_sequencing_center = "                 +++    (show sequencing_center)                                      +++    " , sam_v1_6_read_group_description = "                       +++    (show description)                                            +++    " , sam_v1_6_read_group_run_date = "                          +++    (show run_date)                                               +++    " , sam_v1_6_read_group_flow_order = "                        +++    (show flow_order)                                             +++    " , sam_v1_6_read_group_key_sequence = "                      +++    (show key_sequence)                                           +++    " , sam_v1_6_read_group_library = "                           +++    (show library)                                                +++    " , sam_v1_6_read_group_programs = "                          +++    (show programs)                                               +++    " , sam_v1_6_read_group_show_predicted_median_insert_size = " +++    (show predicted_median_insert_size)                           +++    " , sam_v1_6_read_group_platform = "                          +++    (show platform)                                               +++    " , sam_v1_6_read_group_platform_model = "                    +++    (show platform_model)                                         +++    " , sam_v1_6_read_group_platform_unit = "                     +++    (show platform_unit)                                          +++    " , sam_v1_6_read_group_sample = "                            +++    (show sample)                                                 ++     " }"  -- | ID tag for @"SAM_V1_6_Read_Group"@.@@ -163,9 +159,9 @@  instance Show SAM_V1_6_Read_Group_Identifier where   show (SAM_V1_6_Read_Group_Identifier value) =-    "SAM_V1_6_Read_Group_Identifier { " ++-    "value = "                          ++-    (show value)                        +++    "SAM_V1_6_Read_Group_Identifier { "       +++    "sam_v1_6_read_group_identifier_value = " +++    (show value)                              ++     " }"  -- | BC tag for @"SAM_V1_6_Read_Group"@.@@ -178,9 +174,9 @@  instance Show SAM_V1_6_Read_Group_Barcode_Sequence where   show (SAM_V1_6_Read_Group_Barcode_Sequence value) =-    "SAM_V1_6_Read_Group_Barcode_Sequence { " ++-    "value = "                                ++-    (show value)                              +++    "SAM_V1_6_Read_Group_Barcode_Sequence { "       +++    "sam_v1_6_read_group_barcode_sequence_value = " +++    (show value)                                    ++     " }"  -- | CN tag for @"SAM_V1_6_Read_Group"@.@@ -193,9 +189,9 @@  instance Show SAM_V1_6_Read_Group_Sequencing_Center where   show (SAM_V1_6_Read_Group_Sequencing_Center value) =-    "SAM_V1_6_Read_Group_Sequencing_Center { " ++-    "value = "                                 ++-    (show value)                               +++    "SAM_V1_6_Read_Group_Sequencing_Center { "       +++    "sam_v1_6_read_group_sequencing_center_value = " +++    (show value)                                     ++     " }"  -- | DS tag for @"SAM_V1_6_Read_Group"@.@@ -208,9 +204,9 @@  instance Show SAM_V1_6_Read_Group_Description where   show (SAM_V1_6_Read_Group_Description value) =-    "SAM_V1_6_Read_Group_Description { " ++-    "value = "                           ++-    (show value)                         +++    "SAM_V1_6_Read_Group_Description { "       +++    "sam_v1_6_read_group_description_value = " +++    (show value)                               ++     " }"  -- | DT tag for @"SAM_V1_6_Read_Group"@.@@ -223,9 +219,9 @@  instance Show SAM_V1_6_Read_Group_Run_Date where   show (SAM_V1_6_Read_Group_Run_Date value) =-    "SAM_V1_6_Read_Group_Run_Date { " ++-    "value = "                        ++-    (show value)                      +++    "SAM_V1_6_Read_Group_Run_Date { "       +++    "sam_v1_6_read_group_run_date_value = " +++    (show value)                            ++     " }"  -- | FO tag for @"SAM_V1_6_Read_Group"@.@@ -238,9 +234,9 @@  instance Show SAM_V1_6_Read_Group_Flow_Order where   show (SAM_V1_6_Read_Group_Flow_Order value) =-    "SAM_V1_6_Read_Group_Flow_Order { " ++-    "value = "                          ++-    (show value)                        +++    "SAM_V1_6_Read_Group_Flow_Order { "       +++    "sam_v1_6_read_group_flow_order_value = " +++    (show value)                              ++     " }"  -- | KS tag for @"SAM_V1_6_Read_Group"@.@@ -253,9 +249,9 @@  instance Show SAM_V1_6_Read_Group_Key_Sequence where   show (SAM_V1_6_Read_Group_Key_Sequence value) =-    "SAM_V1_6_Read_Group_Key_Sequence { " ++-    "value = "                            ++-    (show value)                          +++    "SAM_V1_6_Read_Group_Key_Sequence { "       +++    "sam_v1_6_read_group_key_sequence_value = " +++    (show value)                                ++     " }"  -- | LB tag for @"SAM_V1_6_Read_Group"@.@@ -268,9 +264,9 @@  instance Show SAM_V1_6_Read_Group_Library where   show (SAM_V1_6_Read_Group_Library value) =-    "SAM_V1_6_Read_Group_Library { " ++-    "value = "                       ++-    (show value)                     +++    "SAM_V1_6_Read_Group_Library { "       +++    "sam_v1_6_read_group_library_value = " +++    (show value)                           ++     " }"  -- | PG tag for @"SAM_V1_6_Read_Group"@.@@ -283,9 +279,9 @@  instance Show SAM_V1_6_Read_Group_Programs where   show (SAM_V1_6_Read_Group_Programs value) =-    "SAM_V1_6_Read_Group_Programs { " ++-    "value = "                        ++-    (show value)                      +++    "SAM_V1_6_Read_Group_Programs { "       +++    "sam_v1_6_read_group_programs_value = " +++    (show value)                            ++     " }"  -- | PI tag for @"SAM_V1_6_Read_Group"@.@@ -298,9 +294,9 @@  instance Show SAM_V1_6_Read_Group_Predicted_Median_Insert_Size where   show (SAM_V1_6_Read_Group_Predicted_Median_Insert_Size value) =-    "SAM_V1_6_Read_Group_Predicted_Median_Insert_Size { " ++-    "value = "                                            ++-    (show value)                                          +++    "SAM_V1_6_Read_Group_Predicted_Median_Insert_Size { "       +++    "sam_v1_6_read_group_predicted_median_insert_size_value = " +++    (show value)                                                ++     " }"  -- | PL tag for @"SAM_V1_6_Read_Group"@.@@ -313,9 +309,9 @@  instance Show SAM_V1_6_Read_Group_Platform where   show (SAM_V1_6_Read_Group_Platform value) =-    "SAM_V1_6_Read_Group_Platform { " ++-    "value = "                        ++-    (show value)                      +++    "SAM_V1_6_Read_Group_Platform { "       +++    "sam_v1_6_read_group_platform_value = " +++    (show value)                            ++     " }"  -- | PM tag for @"SAM_V1_6_Read_Group"@.@@ -328,9 +324,9 @@  instance Show SAM_V1_6_Read_Group_Platform_Model where   show (SAM_V1_6_Read_Group_Platform_Model value) =-    "SAM_V1_6_Read_Group_Platform_Model { " ++-    "value = "                              ++-    (show value)                            +++    "SAM_V1_6_Read_Group_Platform_Model { "       +++    "sam_v1_6_read_group_platform_model_value = " +++    (show value)                                  ++     " }"  -- | PU tag for @"SAM_V1_6_Read_Group"@.@@ -343,9 +339,9 @@  instance Show SAM_V1_6_Read_Group_Platform_Unit where   show (SAM_V1_6_Read_Group_Platform_Unit value) =-    "SAM_V1_6_Read_Group_Platform_Unit { " ++-    "value = "                             ++-    (show value)                           +++    "SAM_V1_6_Read_Group_Platform_Unit { "       +++    "sam_v1_6_read_group_platform_unit_value = " +++    (show value)                                 ++     " }"  -- | SM tag for @"SAM_V1_6_Read_Group"@.@@ -358,7 +354,7 @@  instance Show SAM_V1_6_Read_Group_Sample where   show (SAM_V1_6_Read_Group_Sample value) =-    "SAM_V1_6_Read_Group_Sample { " ++-    "value = "                      ++-    (show value)                    +++    "SAM_V1_6_Read_Group_Sample { "       +++    "sam_v1_6_read_group_sample_value = " +++    (show value)                          ++     " }"

@@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-} {-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Header.SQ@@ -46,8 +41,8 @@ -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. data SAM_V1_6_Reference_Sequence_Dictionary = SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name                        :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name                                                                                      , sam_v1_6_reference_sequence_dictionary_reference_sequence_length                      :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length-                                                                                     , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus                    :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus-                                                                                     , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names+                                                                                     , sam_v1_6_reference_sequence_dictionary_alternative_locus                              :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus+                                                                                     , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names           :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names                                                                                      , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier                     :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier                                                                                      , sam_v1_6_reference_sequence_dictionary_description                                    :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Description                                                                                      , sam_v1_6_reference_sequence_dictionary_md5_checksum                                   :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum@@ -99,27 +94,27 @@                                                molecule_topology                                                uri        ) =-    "SAM_V1_6_Reference_Sequence_Dictionary { "  ++-    "reference_sequence_name = "                 ++-    (show reference_sequence_name)               ++-    " , reference_sequence_length = "            ++-    (show reference_sequence_length)             ++-    " , reference_alternative_locus = "          ++-    (show reference_alternative_locus)           ++-    " , reference_alternative_sequence_names = " ++-    (show reference_alternative_sequence_names)  ++-    " , genome_assembly_identifier = "           ++-    (show genome_assembly_identifier)            ++-    " , description = "                          ++-    (show description)                           ++-    " , md5_checksum = "                         ++-    (show md5_checksum)                          ++-    " , species = "                              ++-    (show species)                               ++-    " , molecule_topology = "                    ++-    (show molecule_topology)                     ++-    " , uri = "                                  ++-    (show uri)                                   +++    "SAM_V1_6_Reference_Sequence_Dictionary { "                                         +++    "sam_v1_6_reference_sequence_dictionary_reference_sequence_name = "                 +++    (show reference_sequence_name)                                                      +++    " , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = "            +++    (show reference_sequence_length)                                                    +++    " , sam_v1_6_reference_sequence_dictionary_alternative_locus = "                    +++    (show reference_alternative_locus)                                                  +++    " , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = " +++    (show reference_alternative_sequence_names)                                         +++    " , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = "           +++    (show genome_assembly_identifier)                                                   +++    " , sam_v1_6_reference_sequence_dictionary_description = "                          +++    (show description)                                                                  +++    " , sam_v1_6_reference_sequence_dictionary_md5_checksum = "                         +++    (show md5_checksum)                                                                 +++    " , sam_v1_6_reference_sequence_dictionary_species = "                              +++    (show species)                                                                      +++    " , sam_v1_6_reference_sequence_dictionary_molecule_topology = "                    +++    (show molecule_topology)                                                            +++    " , sam_v1_6_reference_sequence_dictionary_uri = "                                  +++    (show uri)                                                                          ++     " }"  -- | SN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -132,9 +127,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name where   show (SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { " ++-    "value = "                                                          ++-    (show value)                                                        +++    "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { "       +++    "sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = " +++    (show value)                                                              ++     " }"  -- | LN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -147,9 +142,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length where   show (SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { " ++-    "value = "                                                            ++-    (show value)                                                          +++    "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { "       +++    "sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = " +++    (show value)                                                                ++     " }"  -- | AH tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -162,9 +157,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus where   show (SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { " ++-    "value = "                                                    ++-    (show value)                                                  +++    "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { "       +++    "sam_v1_6_reference_sequence_dictionary_alternative_locus_value = " +++    (show value)                                                        ++     " }"  -- | AN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -177,9 +172,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names where   show (SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { " ++-    "value = "                                                                       ++-    (show value)                                                                     +++    "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { "       +++    "sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value = " +++    (show value)                                                                           ++     " }"  -- | AS tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -192,9 +187,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier where   show (SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { " ++-    "value = "                                                             ++-    (show value)                                                           +++    "SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { "       +++    "sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value = " +++    (show value)                                                                 ++     " }"  -- | DS tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -207,9 +202,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Description where   show (SAM_V1_6_Reference_Sequence_Dictionary_Description value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Description { " ++-    "value = "                                              ++-    (show value)                                            +++    "SAM_V1_6_Reference_Sequence_Dictionary_Description { "       +++    "sam_v1_6_reference_sequence_dictionary_description_value = " +++    (show value)                                                  ++     " }"  -- | M5 tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -222,9 +217,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum where   show (SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { " ++-    "value = "                                               ++-    (show value)                                             +++    "SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { "       +++    "sam_v1_6_reference_sequence_dictionary_md5_checksum_value = " +++    (show value)                                                   ++     " }"  -- | SP tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -237,9 +232,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Species where   show (SAM_V1_6_Reference_Sequence_Dictionary_Species value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Species { " ++-    "value = "                                          ++-    (show value)                                        +++    "SAM_V1_6_Reference_Sequence_Dictionary_Species { "       +++    "sam_v1_6_reference_sequence_dictionary_species_value = " +++    (show value)                                              ++     " }"  -- | TP tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -252,9 +247,9 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology where   show (SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { " ++-    "value = "                                                    ++-    (show value)                                                  +++    "SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { "       +++    "sam_v1_6_reference_sequence_dictionary_molecule_topology_value = " +++    (show value)                                                        ++     " }"  -- | UR tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@.@@ -267,7 +262,7 @@  instance Show SAM_V1_6_Reference_Sequence_Dictionary_URI where   show (SAM_V1_6_Reference_Sequence_Dictionary_URI value) =-    "SAM_V1_6_Reference_Sequence_Dictionary_URI { " ++-    "value = "                                      ++-    (show value)                                    +++    "SAM_V1_6_Reference_Sequence_Dictionary_URI { "       +++    "sam_v1_6_reference_sequence_dictionary_uri_value = " +++    (show value)                                          ++     " }"

@@ -113,7 +113,7 @@ -- The file is checked for errors as it is parsed. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-readSAM_V1_6 :: FilePath -- ^ Path to SAM file.+readSAM_V1_6 :: FilePath -- ^ Input path to SAM file.              -> IO SAM_V1_6 readSAM_V1_6 fp = do   let lazysamfile = S.unfold StreamlyInternalFile.chunkReader fp

@@ -3,13 +3,7 @@ {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-}-{-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Read.Error

@@ -43,24 +43,24 @@                                                         parse_SAM_V1_6_Alignment_AOPT                                                       ) where +import Data.SAM.Version1_6.Alignment.AOPT import Data.SAM.Version1_6.Read.Error  import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL-import qualified Data.ByteString                   as DB import           Text.Regex.PCRE.Heavy  -- | Defines a parser for the optional aopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_Alignment_AOPT :: Parser DB.ByteString+parse_SAM_V1_6_Alignment_AOPT :: Parser SAM_V1_6_Alignment_AOPT parse_SAM_V1_6_Alignment_AOPT = do-  _ <- do alignmentaoptfieldtagp <- DABL.takeTill (== 58)-          -- Parse AOPT tag of the alignment section.-          case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of-            False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Tag_Incorrect_Format-            True  -> -- AOPT tag is in the accepted format. -                     return ()+  alignmentaoptfieldtag <- do alignmentaoptfieldtagp <- DABL.takeTill (== 58)+                              -- Parse AOPT tag of the alignment section.+                              case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of+                                False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Tag_Incorrect_Format+                                True  -> -- AOPT tag is in the accepted format. +                                         return alignmentaoptfieldtagp   _ <- word8 58   _ <- do alignmentaoptfieldtypep <- DABL.takeTill (== 58)           -- Parse AOPT type of the alignment section.@@ -75,4 +75,6 @@                                   False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Value_Incorrect_Format                                   True  -> -- AOPT value is in the accepted format.                                            return alignmentaoptfieldvaluep-  return alignmentaoptfieldvalue+  return SAM_V1_6_Alignment_AOPT { sam_v1_6_alignment_aopt_tag   = alignmentaoptfieldtag+                                 , sam_v1_6_alignment_aopt_value = alignmentaoptfieldvalue+                                 }

@@ -43,6 +43,7 @@                                                         parse_SAM_V1_6_Alignment_FOPT                                                       ) where +import Data.SAM.Version1_6.Alignment.FOPT import Data.SAM.Version1_6.Read.Error  import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine)@@ -53,14 +54,14 @@ -- | Defines a parser for the optional fopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_Alignment_FOPT :: Parser Float+parse_SAM_V1_6_Alignment_FOPT :: Parser SAM_V1_6_Alignment_FOPT parse_SAM_V1_6_Alignment_FOPT = do-  _ <- do alignmentfoptfieldtagp <- DABL.takeTill (== 58)-          -- Parse FOPT tag of the alignment section.-          case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of-            False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Tag_Incorrect_Format-            True  -> -- FOPT tag is in the accepted format. -                     return ()+  alignmentfoptfieldtag <- do alignmentfoptfieldtagp <- DABL.takeTill (== 58)+                              -- Parse FOPT tag of the alignment section.+                              case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of+                                False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Tag_Incorrect_Format+                                True  -> -- FOPT tag is in the accepted format. +                                         return alignmentfoptfieldtagp   _ <- word8 58   _ <- do alignmentfoptfieldtypep <- DABL.takeTill (== 58)           -- Parse FOPT type of the alignment section.@@ -77,4 +78,6 @@                                            case (DBC8.readInteger alignmentfoptfieldvaluep) of                                              Nothing                                 -> return (-1)                                              Just (alignmentfoptfieldvalueinteger,_) -> return $ (fromInteger alignmentfoptfieldvalueinteger :: Float)-  return alignmentfoptfieldvalue+  return SAM_V1_6_Alignment_FOPT { sam_v1_6_alignment_fopt_tag   = alignmentfoptfieldtag+                                 , sam_v1_6_alignment_fopt_value = alignmentfoptfieldvalue+                                 } 

@@ -43,26 +43,24 @@                                                         parse_SAM_V1_6_Alignment_HOPT                                                       ) where +import Data.SAM.Version1_6.Alignment.HOPT import Data.SAM.Version1_6.Read.Error  import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL-import qualified Data.ByteString                   as DB-import           Data.Sequence                     as DSeq-import           Data.Word import           Text.Regex.PCRE.Heavy  -- | Defines a parser for the optional hopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_Alignment_HOPT :: Parser (Seq Word8)+parse_SAM_V1_6_Alignment_HOPT :: Parser SAM_V1_6_Alignment_HOPT parse_SAM_V1_6_Alignment_HOPT = do-  _ <- do alignmenthoptfieldtagp <- DABL.takeTill (== 58)-          -- Parse HOPT tag of the alignment section.-          case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of-            False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Tag_Incorrect_Format-            True  -> -- HOPT tag is in the accepted format. -                     return ()+  alignmenthoptfieldtag <- do alignmenthoptfieldtagp <- DABL.takeTill (== 58)+                              -- Parse HOPT tag of the alignment section.+                              case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of+                                False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Tag_Incorrect_Format+                                True  -> -- HOPT tag is in the accepted format. +                                         return alignmenthoptfieldtagp   _ <- word8 58   _ <- do alignmenthoptfieldtypep <- DABL.takeTill (== 58)           -- Parse HOPT type of the alignment section.@@ -76,5 +74,7 @@                                 case (alignmenthoptfieldvaluep =~ [re|([0-9A-F][0-9A-F])*|]) of                                   False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Value_Incorrect_Format                                   True  -> -- HOPT value is in the accepted format.-                                           return $ DSeq.fromList $ DB.unpack alignmenthoptfieldvaluep-  return alignmenthoptfieldvalue+                                           return alignmenthoptfieldvaluep+  return SAM_V1_6_Alignment_HOPT { sam_v1_6_alignment_hopt_tag   = alignmenthoptfieldtag+                                 , sam_v1_6_alignment_hopt_value = alignmenthoptfieldvalue+                                 }

@@ -43,6 +43,7 @@                                                         parse_SAM_V1_6_Alignment_IOPT                                                       ) where +import Data.SAM.Version1_6.Alignment.IOPT import Data.SAM.Version1_6.Read.Error  import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine)@@ -53,14 +54,14 @@ -- | Defines a parser for the optional iopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_Alignment_IOPT :: Parser Integer+parse_SAM_V1_6_Alignment_IOPT :: Parser SAM_V1_6_Alignment_IOPT parse_SAM_V1_6_Alignment_IOPT = do-  _ <- do alignmentioptfieldtagp <- DABL.takeTill (== 58)-          -- Parse IOPT tag of the alignment section.-          case (alignmentioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of-            False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Tag_Incorrect_Format-            True  -> -- IOPT tag is in the accepted format. -                     return ()+  alignmentioptfieldtag <- do alignmentioptfieldtagp <- DABL.takeTill (== 58)+                              -- Parse IOPT tag of the alignment section.+                              case (alignmentioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of+                                False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Tag_Incorrect_Format+                                True  -> -- IOPT tag is in the accepted format. +                                         return alignmentioptfieldtagp   _ <- word8 58   _ <- do alignmentioptfieldtypep <- DABL.takeTill (== 58)           -- Parse IOPT type of the alignment section.@@ -77,4 +78,6 @@                                            case (DBC8.readInteger alignmentioptfieldvaluep) of                                              Nothing                                 -> return (-1)                                              Just (alignmentioptfieldvalueinteger,_) -> return alignmentioptfieldvalueinteger-  return alignmentioptfieldvalue+  return SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag   = alignmentioptfieldtag+                                 , sam_v1_6_alignment_iopt_value = alignmentioptfieldvalue+                                 }

@@ -43,24 +43,24 @@                                                         parse_SAM_V1_6_Alignment_ZOPT                                                       ) where +import Data.SAM.Version1_6.Alignment.ZOPT import Data.SAM.Version1_6.Read.Error  import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL-import qualified Data.ByteString                   as DB import           Text.Regex.PCRE.Heavy  -- | Defines a parser for the optional zopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_Alignment_ZOPT :: Parser DB.ByteString+parse_SAM_V1_6_Alignment_ZOPT :: Parser SAM_V1_6_Alignment_ZOPT parse_SAM_V1_6_Alignment_ZOPT = do-  _ <- do alignmentzoptfieldtagp <- DABL.takeTill (== 58)-          -- Parse ZOPT tag of the alignment section.-          case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of-            False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Tag_Incorrect_Format-            True  -> -- ZOPT tag is in the accepted format. -                     return ()+  alignmentzoptfieldtag <- do alignmentzoptfieldtagp <- DABL.takeTill (== 58)+                              -- Parse ZOPT tag of the alignment section.+                              case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of+                                False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Tag_Incorrect_Format+                                True  -> -- ZOPT tag is in the accepted format. +                                         return alignmentzoptfieldtagp   _ <- word8 58   _ <- do alignmentzoptfieldtypep <- DABL.takeTill (== 58)           -- Parse ZOPT type of the alignment section.@@ -75,4 +75,6 @@                                   False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Value_Incorrect_Format                                   True  -> -- ZOPT value is in the accepted format.                                            return alignmentzoptfieldvaluep-  return alignmentzoptfieldvalue+  return SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag   = alignmentzoptfieldtag+                                 , sam_v1_6_alignment_zopt_value = alignmentzoptfieldvalue+                                 }

@@ -0,0 +1,551 @@+{-# LANGUAGE FlexibleContexts      #-}+{-# LANGUAGE FlexibleInstances     #-}+{-# LANGUAGE MultiParamTypeClasses #-}+{-# LANGUAGE TypeFamilies          #-}++-- |+-- Module      :  Data.SAM.Version1_6.Write.Base+-- Copyright   :  (c) Matthew Mosior 2023+-- License     :  BSD-style+-- Maintainer  :  mattm.github@gmail.com+-- Portability :  portable+--+-- = Description+--+-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.++module Data.SAM.Version1_6.Write.Base ( -- * Writing+                                       writeSAM_V1_6+                                      ) where++import Data.SAM.Version1_6.Base+import Data.SAM.Version1_6.Header.HD+import Data.SAM.Version1_6.Header.SQ+import Data.SAM.Version1_6.Header.RG+import Data.SAM.Version1_6.Header.PG+import Data.SAM.Version1_6.Header.CO+import Data.SAM.Version1_6.Alignment.Base+import Data.SAM.Version1_6.Alignment.AOPT+import Data.SAM.Version1_6.Alignment.IOPT+import Data.SAM.Version1_6.Alignment.FOPT+import Data.SAM.Version1_6.Alignment.ZOPT+import Data.SAM.Version1_6.Alignment.HOPT+import Data.SAM.Version1_6.Alignment.BOPT++import Data.ByteString            as DB    (pack,singleton)+import Data.ByteString.Lazy.Char8 as DBLC8 (fromStrict,unpack)+import Data.Foldable                       (toList)+import Data.Int                            (Int8,Int16,Int32)+import Data.List                           (intercalate)+import Data.Word+import Data.ByteString.Builder             (toLazyByteString,word16LE,word32LE)+import System.IO                           (hFlush,hClose,hPutStr,IOMode(..),openFile, Handle)+++-- | Deconstruct a @"SAM_V1_6"@ to a `String`.+deconstructSAM_V1_6 :: SAM_V1_6+                    -> String+deconstructSAM_V1_6 samv16 =+  ( intercalate "\n" $+      filter (not . null) [ sam_v1_6_file_level_metadata_tos+                          , sam_v1_6_reference_sequence_dictionary_tos+                          , sam_v1_6_read_group_tos+                          , sam_v1_6_program_tos+                          , sam_v1_6_one_line_comment_tos+                          , sam_v1_6_alignment_tos+                          ]+  )+  ++ "\n"+  where+    sam_v1_6_file_level_metadata_format_version_tos x = "VN:" +++                                                        ( unpack     $+                                                          fromStrict $+                                                          sam_v1_6_file_level_metadata_format_version_value $+                                                          sam_v1_6_file_level_metadata_format_version x+                                                        )+    sam_v1_6_file_level_metadata_sorting_order_tos x = case (sam_v1_6_file_level_metadata_sorting_order x) of+                                                         Nothing  -> ""+                                                         Just rgf -> "SO:" +++                                                                     ( unpack     $+                                                                       fromStrict $+                                                                       sam_v1_6_file_level_metadata_sorting_order_value rgf+                                                                     )+    sam_v1_6_file_level_metadata_alignment_grouping_tos x = case (sam_v1_6_file_level_metadata_alignment_grouping x) of+                                                              Nothing  -> ""+                                                              Just rgf -> "GO:" +++                                                                          ( unpack     $+                                                                            fromStrict $+                                                                            sam_v1_6_file_level_metadata_alignment_grouping_value rgf+                                                                          )+    sam_v1_6_file_level_metadata_subsorting_order_tos x = case (sam_v1_6_file_level_metadata_subsorting_order x) of+                                                            Nothing  -> ""+                                                            Just rgf -> "SS:" +++                                                                        ( unpack     $+                                                                          fromStrict $+                                                                          sam_v1_6_file_level_metadata_subsorting_order_value rgf+                                                                        )+    sam_v1_6_file_level_metadata_tos = case (sam_v1_6_file_level_metadata samv16) of+                                         Nothing  -> ""+                                         Just hdf -> intercalate "\t" $+                                                       filter (not . null) $+                                                         [ "@HD"+                                                         , sam_v1_6_file_level_metadata_format_version_tos hdf+                                                         , sam_v1_6_file_level_metadata_sorting_order_tos hdf+                                                         , sam_v1_6_file_level_metadata_alignment_grouping_tos hdf+                                                         , sam_v1_6_file_level_metadata_subsorting_order_tos hdf +                                                         ]+    sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x = "SN:" +++                                                                           ( unpack                                                               $+                                                                             fromStrict                                                           $+                                                                             sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value $+                                                                             sam_v1_6_reference_sequence_dictionary_reference_sequence_name x+                                                                           )+    sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x = "LN:" +++                                                                             ( unpack                                                                 $+                                                                               fromStrict                                                             $+                                                                               sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value $+                                                                               sam_v1_6_reference_sequence_dictionary_reference_sequence_length x+                                                                             )+    sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_locus x) of+                                                                       Nothing  -> ""+                                                                       Just sqf -> "AH:" +++                                                                                   ( unpack     $+                                                                                     fromStrict $+                                                                                     sam_v1_6_reference_sequence_dictionary_alternative_locus_value sqf+                                                                                   )+    sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names x) of+                                                                                          Nothing  -> "" +                                                                                          Just sqf -> "AN:" +++                                                                                                      ( unpack     $+                                                                                                        fromStrict $+                                                                                                        sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value sqf+                                                                                                      )+    sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x = case (sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier x) of+                                                                                Nothing  -> ""+                                                                                Just sqf -> "AS:" +++                                                                                            ( unpack     $+                                                                                              fromStrict $+                                                                                              sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value sqf+                                                                                            )+    sam_v1_6_reference_sequence_dictionary_description_tos x = case (sam_v1_6_reference_sequence_dictionary_description x) of+                                                                 Nothing  -> ""+                                                                 Just sqf -> "DS:" +++                                                                             ( unpack     $+                                                                               fromStrict $+                                                                               sam_v1_6_reference_sequence_dictionary_description_value sqf+                                                                             )+    sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x = case (sam_v1_6_reference_sequence_dictionary_md5_checksum x) of+                                                                  Nothing  -> ""+                                                                  Just sqf -> "M5:" +++                                                                              ( unpack     $+                                                                                fromStrict $+                                                                                sam_v1_6_reference_sequence_dictionary_md5_checksum_value sqf+                                                                              )+    sam_v1_6_reference_sequence_dictionary_species_tos x = case (sam_v1_6_reference_sequence_dictionary_species x) of+                                                             Nothing  -> ""+                                                             Just sqf -> "SP:" +++                                                                         ( unpack     $+                                                                           fromStrict $+                                                                           sam_v1_6_reference_sequence_dictionary_species_value sqf+                                                                         )+    sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x = case (sam_v1_6_reference_sequence_dictionary_molecule_topology x) of+                                                                       Nothing  -> ""+                                                                       Just sqf -> "TP:" +++                                                                                   ( unpack     $+                                                                                     fromStrict $+                                                                                     sam_v1_6_reference_sequence_dictionary_molecule_topology_value sqf+                                                                                   )+    sam_v1_6_reference_sequence_dictionary_uri_tos x = case (sam_v1_6_reference_sequence_dictionary_uri x) of+                                                         Nothing  -> ""+                                                         Just sqf -> "UR:" +++                                                                     ( unpack     $+                                                                       fromStrict $+                                                                       sam_v1_6_reference_sequence_dictionary_uri_value sqf+                                                                     )+    sam_v1_6_reference_sequence_dictionary_tos = case (sam_v1_6_reference_sequence_dictionary samv16) of+                                                   Nothing  -> ""+                                                   Just sqf -> intercalate "\n" $+                                                                   map (\x -> intercalate "\t" $+                                                                                filter (not .null) $+                                                                                            [ "@SQ"+                                                                                            , sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_description_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_species_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x+                                                                                            , sam_v1_6_reference_sequence_dictionary_uri_tos x+                                                                                            ]+                                                                       ) (toList sqf)+    sam_v1_6_read_group_identifer_tos x = "ID:" +++                                          ( unpack                               $+                                            fromStrict                           $+                                            sam_v1_6_read_group_identifier_value $+                                            sam_v1_6_read_group_identifier x+                                          )+    sam_v1_6_read_group_barcode_sequence_tos x = case (sam_v1_6_read_group_barcode_sequence x) of+                                                   Nothing  -> ""+                                                   Just rgf -> "BC:" +++                                                               ( unpack     $+                                                                 fromStrict $+                                                                 sam_v1_6_read_group_barcode_sequence_value rgf+                                                               )+    sam_v1_6_read_group_sequencing_center_tos x = case (sam_v1_6_read_group_sequencing_center x) of+                                                    Nothing  -> ""+                                                    Just rgf -> "CN:" +++                                                                ( unpack     $+                                                                  fromStrict $+                                                                  sam_v1_6_read_group_sequencing_center_value rgf+                                                                )+    sam_v1_6_read_group_description_tos x = case (sam_v1_6_read_group_description x) of+                                              Nothing  -> ""+                                              Just rgf -> "DS:" +++                                                          ( unpack     $+                                                            fromStrict $+                                                            sam_v1_6_read_group_description_value rgf+                                                          )+    sam_v1_6_read_group_run_date_tos x = case (sam_v1_6_read_group_run_date x) of+                                           Nothing  -> ""+                                           Just rgf -> "DT:" +++                                                       ( unpack     $+                                                         fromStrict $+                                                         sam_v1_6_read_group_run_date_value rgf+                                                       )+    sam_v1_6_read_group_flow_order_tos x = case (sam_v1_6_read_group_flow_order x) of+                                             Nothing  -> ""+                                             Just rgf -> "FO:" +++                                                         ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_read_group_flow_order_value rgf+                                                         )+    sam_v1_6_read_group_key_sequence_tos x = case (sam_v1_6_read_group_key_sequence x) of+                                               Nothing  -> ""+                                               Just rgf -> "KS:" +++                                                           ( unpack     $+                                                             fromStrict $+                                                             sam_v1_6_read_group_key_sequence_value rgf+                                                           )+    sam_v1_6_read_group_library_tos x = case (sam_v1_6_read_group_library x) of+                                          Nothing  -> ""+                                          Just rgf -> "LB:" +++                                                      ( unpack     $+                                                        fromStrict $+                                                        sam_v1_6_read_group_library_value rgf+                                                      )+    sam_v1_6_read_group_programs_tos x = case (sam_v1_6_read_group_programs x) of+                                           Nothing  -> ""+                                           Just rgf -> "PG:" +++                                                       ( unpack     $+                                                         fromStrict $+                                                         sam_v1_6_read_group_programs_value rgf+                                                       )+    sam_v1_6_read_group_predicted_median_insert_size_tos x = case (sam_v1_6_read_group_predicted_median_insert_size x) of+                                                               Nothing  -> ""+                                                               Just rgf -> "PI:" +++                                                                           ( unpack     $+                                                                             fromStrict $+                                                                             sam_v1_6_read_group_predicted_median_insert_size_value rgf+                                                                           )+    sam_v1_6_read_group_platform_tos x = case (sam_v1_6_read_group_platform x) of+                                           Nothing  -> ""+                                           Just rgf -> "PL:" +++                                                       ( unpack     $+                                                         fromStrict $+                                                         sam_v1_6_read_group_platform_value rgf+                                                       )+    sam_v1_6_read_group_platform_model_tos x = case (sam_v1_6_read_group_platform_model x) of+                                                 Nothing  -> ""+                                                 Just rgf -> "PM:" +++                                                             ( unpack     $+                                                               fromStrict $+                                                               sam_v1_6_read_group_platform_model_value rgf+                                                             )+    sam_v1_6_read_group_platform_unit_tos x = case (sam_v1_6_read_group_platform_unit x) of+                                                Nothing  -> ""+                                                Just rgf -> "PU:" +++                                                            ( unpack     $+                                                              fromStrict $+                                                              sam_v1_6_read_group_platform_unit_value rgf+                                                            )+    sam_v1_6_read_group_sample_tos x = case (sam_v1_6_read_group_sample x) of+                                         Nothing  -> ""+                                         Just rgf -> "SM:" +++                                                     ( unpack     $+                                                       fromStrict $+                                                       sam_v1_6_read_group_sample_value rgf+                                                     )+    sam_v1_6_read_group_tos = case (sam_v1_6_read_group samv16) of+                                Nothing  -> ""+                                Just rgf -> intercalate "\n" $+                                              map (\x -> intercalate "\t" $+                                                           filter (not . null) $+                                                                       [ "@RG"+                                                                       , sam_v1_6_read_group_identifer_tos x+                                                                       , sam_v1_6_read_group_barcode_sequence_tos x+                                                                       , sam_v1_6_read_group_sequencing_center_tos x+                                                                       , sam_v1_6_read_group_description_tos x+                                                                       , sam_v1_6_read_group_run_date_tos x+                                                                       , sam_v1_6_read_group_flow_order_tos x+                                                                       , sam_v1_6_read_group_key_sequence_tos x+                                                                       , sam_v1_6_read_group_library_tos x+                                                                       , sam_v1_6_read_group_programs_tos x+                                                                       , sam_v1_6_read_group_predicted_median_insert_size_tos x+                                                                       , sam_v1_6_read_group_platform_tos x+                                                                       , sam_v1_6_read_group_platform_model_tos x+                                                                       , sam_v1_6_read_group_platform_unit_tos x+                                                                       , sam_v1_6_read_group_sample_tos x+                                                                       ]+                                                  ) (toList rgf)+    sam_v1_6_program_record_identifier_tos x = "ID:" +++                                               ( unpack                                   $+                                                 fromStrict                               $+                                                 sam_v1_6_program_record_identifier_value $+                                                 sam_v1_6_program_record_identifier x+                                               )+    sam_v1_6_program_name_tos x = case (sam_v1_6_program_name x) of+                                    Nothing  -> ""+                                    Just rgf -> "PN:" +++                                                ( unpack     $+                                                  fromStrict $+                                                  sam_v1_6_program_name_value rgf+                                                )+    sam_v1_6_program_command_line_tos x = case (sam_v1_6_program_command_line x) of+                                            Nothing  -> ""+                                            Just rgf -> "CL:" +++                                                        ( unpack     $+                                                          fromStrict $+                                                          sam_v1_6_program_command_line_value rgf+                                                        )+    sam_v1_6_program_previous_pg_id_tos x = case (sam_v1_6_program_previous_pg_id x) of+                                              Nothing  -> ""+                                              Just rgf -> "PP:" +++                                                          ( unpack     $+                                                            fromStrict $+                                                            sam_v1_6_program_previous_pg_id_value rgf+                                                          )+    sam_v1_6_program_description_tos x = case (sam_v1_6_program_description x) of+                                           Nothing  -> ""+                                           Just rgf -> "DS:" +++                                                       ( unpack     $+                                                         fromStrict $+                                                         sam_v1_6_program_description_value rgf+                                                       )+    sam_v1_6_program_version_tos x = case (sam_v1_6_program_version x) of+                                       Nothing  -> ""+                                       Just rgf -> "VN:" +++                                                   ( unpack     $+                                                     fromStrict $+                                                     sam_v1_6_program_version_value rgf+                                                   )+    sam_v1_6_program_tos = case (sam_v1_6_program samv16) of+                             Nothing  -> ""+                             Just pgf -> intercalate "\t" $+                                           filter (not . null) $+                                                       [ "@PG"+                                                       , sam_v1_6_program_record_identifier_tos pgf+                                                       , sam_v1_6_program_name_tos pgf+                                                       , sam_v1_6_program_command_line_tos pgf+                                                       , sam_v1_6_program_previous_pg_id_tos pgf+                                                       , sam_v1_6_program_description_tos pgf+                                                       , sam_v1_6_program_version_tos pgf+                                                       ]+    sam_v1_6_one_line_comment_tos = case (sam_v1_6_one_line_comment samv16) of+                                      Nothing  -> ""+                                      Just cof -> intercalate "\n" $+                                                    map (\x -> intercalate "\t" $+                                                                 filter (not . null) +                                                                             [ "@CO"+                                                                             , unpack     $+                                                                               fromStrict $+                                                                               sam_v1_6_one_line_comment_value x+                                                                             ]+                                                        ) (toList cof)+    sam_v1_6_alignment_tos            = intercalate "\n" $+                                          map (\x -> case (null $ sam_v1_6_alignment_opts x) of+                                                       True  -> sam_v1_6_alignment_mand x +                                                       False -> intercalate "\t"+                                                                            [ sam_v1_6_alignment_mand x+                                                                            , sam_v1_6_alignment_opts x+                                                                            ] ) (toList $ sam_v1_6_alignment samv16)+    sam_v1_6_alignment_mand x           = intercalate "\t" $+                                            filter (not . null)+                                                        [ unpack $ fromStrict $ sam_v1_6_alignment_qname x +                                                        , show $ sam_v1_6_alignment_flag x +                                                        , unpack $ fromStrict $ sam_v1_6_alignment_rname x +                                                        , show $ sam_v1_6_alignment_pos x +                                                        , show $ sam_v1_6_alignment_mapq x +                                                        , unpack $ fromStrict $ sam_v1_6_alignment_cigar x +                                                        , unpack $ fromStrict $ sam_v1_6_alignment_rnext x +                                                        , show $ sam_v1_6_alignment_pnext x +                                                        , show $ sam_v1_6_alignment_tlen x +                                                        , unpack $ fromStrict $ sam_v1_6_alignment_seq x +                                                        , unpack $ fromStrict $ sam_v1_6_alignment_qual x+                                                        ]+    sam_v1_6_alignment_opts x           = intercalate "\t" $+                                            filter (not . null)+                                                        [ sam_v1_6_alignment_aopt_d x +                                                        , sam_v1_6_alignment_iopt_d x +                                                        , sam_v1_6_alignment_fopt_d x +                                                        , sam_v1_6_alignment_zopt_d x+                                                        , sam_v1_6_alignment_hopt_d x +                                                        , sam_v1_6_alignment_bopt_d x+                                                        ]+    sam_v1_6_alignment_aopt_d x         = case (sam_v1_6_alignment_aopt x) of+                                            Nothing   -> ""+                                            Just aopt -> ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_aopt_tag aopt+                                                         )+                                                         +++                                                         ":A:"+                                                         +++                                                         ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_aopt_value aopt+                                                         )+    sam_v1_6_alignment_iopt_d x         = case (sam_v1_6_alignment_iopt x) of+                                            Nothing   -> ""+                                            Just iopt -> ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_iopt_tag iopt+                                                         )+                                                         +++                                                         ":i:"+                                                         +++                                                         ( show $+                                                           sam_v1_6_alignment_iopt_value iopt+                                                         )+    sam_v1_6_alignment_fopt_d x         = case (sam_v1_6_alignment_fopt x) of+                                            Nothing   -> ""+                                            Just fopt -> ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_fopt_tag fopt+                                                         )+                                                         +++                                                         ":f:"+                                                         +++                                                         ( show $+                                                           sam_v1_6_alignment_fopt_value fopt+                                                         )+    sam_v1_6_alignment_zopt_d x         = case (sam_v1_6_alignment_zopt x) of+                                            Nothing   -> ""+                                            Just zopt -> ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_zopt_tag zopt+                                                         )+                                                         +++                                                         ":Z:"+                                                         +++                                                         ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_zopt_value zopt+                                                         )+    sam_v1_6_alignment_hopt_d x         = case (sam_v1_6_alignment_hopt x) of+                                            Nothing   -> ""+                                            Just hopt -> ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_hopt_tag hopt+                                                         )+                                                         +++                                                         ":H:"+                                                         +++                                                         ( unpack     $+                                                           fromStrict $+                                                           sam_v1_6_alignment_hopt_value hopt+                                                         )+    sam_v1_6_alignment_bopt_d x         = case (sam_v1_6_alignment_bopt x) of+                                            Nothing   -> ""+                                            Just bopt -> concat $+                                                           filter (not . null)+                                                                       [ sam_v1_6_alignment_bopt_int8_d bopt+                                                                       , sam_v1_6_alignment_bopt_word8_d bopt+                                                                       , sam_v1_6_alignment_bopt_int16_d bopt+                                                                       , sam_v1_6_alignment_bopt_word16_d bopt+                                                                       , sam_v1_6_alignment_bopt_int32_d bopt+                                                                       , sam_v1_6_alignment_bopt_word32_d bopt+                                                                       , sam_v1_6_alignment_bopt_float_d bopt+                                                                       ]+    sam_v1_6_alignment_bopt_int8_d x = case (sam_v1_6_alignment_bopt_int8 x) of+                                         Nothing        -> ""+                                         Just bopt_int8 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int8_tag bopt_int8) +++                                                           ":"                                                                                +++                                                           (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_int8_type bopt_int8)    +++                                                           ":"                                                                                +++                                                           (concat $ map encodeInt8 $ toList $ sam_v1_6_alignment_bopt_int8_value bopt_int8)+    sam_v1_6_alignment_bopt_word8_d x = case (sam_v1_6_alignment_bopt_word8 x) of +                                          Nothing         -> ""+                                          Just bopt_word8 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word8_tag bopt_word8) +++                                                             ":"                                                                                  +++                                                             (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_word8_type bopt_word8)    +++                                                             ":"                                                                                  +++                                                             (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word8_value bopt_word8)+    sam_v1_6_alignment_bopt_int16_d x = case (sam_v1_6_alignment_bopt_int16 x) of +                                          Nothing         -> ""+                                          Just bopt_int16 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int16_tag bopt_int16) +++                                                             ":"                                                                                  +++                                                             (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_int16_type bopt_int16)    +++                                                             ":"                                                                                  +++                                                             (concat $ map encodeInt16 $ toList $ sam_v1_6_alignment_bopt_int16_value bopt_int16)+    sam_v1_6_alignment_bopt_word16_d x = case (sam_v1_6_alignment_bopt_word16 x) of+                                           Nothing          -> ""+                                           Just bopt_word16 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word16_tag bopt_word16) +++                                                               ":"                                                                                    +++                                                               (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_word16_type bopt_word16)    +++                                                               ":"                                                                                    +++                                                               (concat $ map encodeWord16 $ toList $ sam_v1_6_alignment_bopt_word16_value bopt_word16)+    sam_v1_6_alignment_bopt_int32_d x = case (sam_v1_6_alignment_bopt_int32 x) of+                                          Nothing         -> ""+                                          Just bopt_int32 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int32_tag bopt_int32) +++                                                             ":"                                                                                  +++                                                             (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_int32_type bopt_int32)    +++                                                             ":"                                                                                  +++                                                             (concat $ map encodeInt32 $ toList $ sam_v1_6_alignment_bopt_int32_value bopt_int32)+    sam_v1_6_alignment_bopt_word32_d x = case (sam_v1_6_alignment_bopt_word32 x) of +                                           Nothing          -> ""+                                           Just bopt_word32 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word32_tag bopt_word32) +++                                                               ":"                                                                                    +++                                                               (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_word32_type bopt_word32)    +++                                                               ":"                                                                                    +++                                                               (concat $ map encodeWord32 $ toList $ sam_v1_6_alignment_bopt_word32_value bopt_word32)+    sam_v1_6_alignment_bopt_float_d x = case (sam_v1_6_alignment_bopt_float x) of +                                          Nothing         -> ""+                                          Just bopt_float -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_float_tag bopt_float) +++                                                             ":"                                                                                  +++                                                             (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_float_type bopt_float)    +++                                                             ":"                                                                                  +++                                                             (concat $ map show $ toList $ sam_v1_6_alignment_bopt_float_value bopt_float)+    encodeInt8 :: Int8 -> [Char]+    encodeInt8 = show+    encodeInt16 :: Int16 -> [Char]+    encodeInt16 = show+    encodeWord16 :: Word16 -> [Char]+    encodeWord16 = unpack . toLazyByteString . word16LE+    encodeInt32 :: Int32 -> [Char]+    encodeInt32 = show+    encodeWord32 :: Word32 -> [Char]+    encodeWord32 = unpack . toLazyByteString . word32LE++-- | Write @"SAM_V1_6"@ to a file.+-- Calls deconstructSAM_V1_6.+hPutSAM_V1_6 :: Handle+             -> SAM_V1_6+             -> IO ()+hPutSAM_V1_6 h samv16 = System.IO.hPutStr h+                                          (deconstructSAM_V1_6 samv16)++-- | Write a @"SAM_V1_6"@ to a file.+--+-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.+writeSAM_V1_6 :: FilePath -- ^ Output path to SAM file.+              -> SAM_V1_6+              -> IO ()+writeSAM_V1_6 fp samv16 = do+  h <- openFile fp+                WriteMode+  hPutSAM_V1_6 h+               samv16+  hFlush h+  hClose h

@@ -2,13 +2,16 @@  import Data.SAM.Version1_6.Base import Data.SAM.Version1_6.Alignment+import Data.SAM.Version1_6.Alignment.IOPT+import Data.SAM.Version1_6.Alignment.ZOPT import Data.SAM.Version1_6.Alignment.BOPT import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Base  import Data.Sequence (fromList)-import Data.String (fromString)+import Data.String   (fromString) import Test.Hspec+import Data.SAM.Version1_6.Write.Base   main :: IO () main = hspec $ do@@ -26,40 +29,16 @@       describe "toy1.sam" $ do         it "Ensures that readSAM_V1_6 can read and parse a SAM file with multiple reference sequence dictionary (@SQ) optional header fields." $ do           readSAM_V1_6 "test/examples/toy1.sam" `shouldReturn` toy1sam+  describe "Data.SAM.Version1_6.Write.Base" $ do+    describe "writeSAM_V1_6" $ do+      describe "toy2.sam" $ do+        it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do+          toy2 <- readSAM_V1_6 "test/examples/toy2.sam"+          writeSAM_V1_6 "test/examples/toy2f.sam" toy2+          toy2f <- readSAM_V1_6 "test/examples/toy2f.sam"+          toy2 `shouldBe` toy2f     where-    toy1sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing-                       , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing },SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref2" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "40" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }])-                       , sam_v1_6_read_group = Nothing-                       , sam_v1_6_program = Nothing-                       , sam_v1_6_one_line_comment = Nothing-                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag  = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing-                                                                            }-                                                       ]-                       }-    toy2sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Just SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version = SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value = fromString "1.6" } , sam_v1_6_file_level_metadata_sorting_order = Just SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value = fromString "coordinate" } , sam_v1_6_file_level_metadata_alignment_grouping = Nothing , sam_v1_6_file_level_metadata_subsorting_order = Nothing }-                       , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }])-                       , sam_v1_6_read_group = Nothing-                       , sam_v1_6_program = Nothing-                       , sam_v1_6_one_line_comment = Nothing-                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 99 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M2I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "3S6M1P1I4M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGATA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5S6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "GCCTAAGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just (fromString "ref,29,-,6H5M,17,0;") , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 2064 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 17 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just (fromString "ref,9,+,5S6M,30,1;") , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 147 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGGCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Just 1 , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing-                                                                            }-                                                       ]-                       }-    toy4sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing-                       , sam_v1_6_reference_sequence_dictionary = Nothing-                       , sam_v1_6_read_group = Nothing-                       , sam_v1_6_program = Nothing-                       , sam_v1_6_one_line_comment = Nothing-                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag  = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing-                                                                            }-                                                       ]-                       }-    toy5sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing-                       , sam_v1_6_reference_sequence_dictionary = Nothing-                       , sam_v1_6_read_group = Nothing-                       , sam_v1_6_program = Nothing-                       , sam_v1_6_one_line_comment = Nothing-                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing-                                                                            }-                                                       ]-                       }+    toy1sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString  "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString  "45" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing },SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString  "ref2" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString  "40" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString  "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag  = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "5H6M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "AGCTAA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "6H5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "TAGGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "9M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString  "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "20M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString  "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "21M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString  "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "9M4I13M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString  "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "25M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString  "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "24M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString  "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "23M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString  "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] }+    toy2sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Just SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version = SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value = fromString  "1.6" } , sam_v1_6_file_level_metadata_sorting_order = Just SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value = fromString  "coordinate" } , sam_v1_6_file_level_metadata_alignment_grouping = Nothing , sam_v1_6_file_level_metadata_subsorting_order = Nothing } , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString  "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString  "45" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 99 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "8M2I4M1D3M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString  "TTAGATAAAGGATACTG" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "3S6M1P1I4M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "AAAAGATAAGGATA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "5S6M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "GCCTAAGCTAA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = fromString  "SA" , sam_v1_6_alignment_zopt_value = fromString  "ref,29,-,6H5M,17,0;" } , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "6M14N5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ATAGCTTCAGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 2064 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 17 , sam_v1_6_alignment_cigar = fromString  "6H5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "TAGGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = fromString  "SA" , sam_v1_6_alignment_zopt_value = fromString  "ref,9,+,5S6M,30,1;" } , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 147 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "9M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString  "CAGCGGCAT" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Just SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag = fromString  "NM" , sam_v1_6_alignment_iopt_value = 1 } , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } +    toy4sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Nothing , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString  "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag  = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "5H6M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "AGCTAA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "6H5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "TAGGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "9M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString  "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "20M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString  "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "21M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString  "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "9M4I13M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString  "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "25M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString  "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "24M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString  "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "23M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString  "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } +    toy5sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Nothing , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString  "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "5H6M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "AGCTAA" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "6H5M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "TAGGC" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString  "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "9M" , sam_v1_6_alignment_rnext = fromString  "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString  "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString  "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "20M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString  "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "21M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString  "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "9M4I13M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString  "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "25M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString  "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "24M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString  "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString  "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString  "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString  "23M" , sam_v1_6_alignment_rnext = fromString  "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString  "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString  "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] }