diff --git a/CHANGELOG.md b/CHANGELOG.md --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -82,3 +82,9 @@ * Fixed broken parsing of SAM_V1_6(..). * Strengthened parsing of SAM_V1_6(..) by accurately emulating the sam v1.6 specification through use of permutable parsers. * Added initial test suite. + +## 0.8.0.0 -- 2023-10-30 + +* Adding functionality to write SAM_V1_6(..) to file. +* Made show instances of many newtypes/datatypes more verbose to match fields of said newtypes/datatypes. +* Added initial writeSAM_V1_6 test case. diff --git a/hs-samtools.cabal b/hs-samtools.cabal --- a/hs-samtools.cabal +++ b/hs-samtools.cabal @@ -20,7 +20,7 @@ -- PVP summary: +-+------- breaking API changes -- | | +----- non-breaking API additions -- | | | +--- code changes with no API change -version: 0.7.0.0 +version: 0.8.0.0 -- A short (one-line) description of the package. synopsis: Read and write SAM, BAM, and CRAM files. @@ -68,6 +68,11 @@ exposed-modules: Data.SAM.Version1_6.Base, Data.SAM.Version1_6.Alignment, Data.SAM.Version1_6.Alignment.Base, + Data.SAM.Version1_6.Alignment.AOPT, + Data.SAM.Version1_6.Alignment.FOPT, + Data.SAM.Version1_6.Alignment.HOPT, + Data.SAM.Version1_6.Alignment.IOPT, + Data.SAM.Version1_6.Alignment.ZOPT, Data.SAM.Version1_6.Alignment.BOPT, Data.SAM.Version1_6.Header, Data.SAM.Version1_6.Header.CO, @@ -122,7 +127,8 @@ Data.SAM.Version1_6.Read.Parser.Header.PG.PP, Data.SAM.Version1_6.Read.Parser.Header.PG.DS, Data.SAM.Version1_6.Read.Parser.Header.PG.VN, - Data.SAM.Version1_6.Read.Parser.Header.CO.Base + Data.SAM.Version1_6.Read.Parser.Header.CO.Base, + Data.SAM.Version1_6.Write.Base -- Modules included in this library but not exported. -- other-modules: diff --git a/src/Data/SAM/Version1_6/Alignment.hs b/src/Data/SAM/Version1_6/Alignment.hs --- a/src/Data/SAM/Version1_6/Alignment.hs +++ b/src/Data/SAM/Version1_6/Alignment.hs @@ -1,15 +1,7 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Alignment diff --git a/src/Data/SAM/Version1_6/Alignment/AOPT.hs b/src/Data/SAM/Version1_6/Alignment/AOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/AOPT.hs @@ -0,0 +1,68 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.AOPT +-- Copyright : (c) Matthew Mosior 2023 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.AOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_AOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_AOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_AOPT = SAM_V1_6_Alignment_AOPT { sam_v1_6_alignment_aopt_tag :: ByteString + , sam_v1_6_alignment_aopt_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_AOPT where + SAM_V1_6_Alignment_AOPT sam_v1_6_alignment_aopt_tag1 + sam_v1_6_alignment_aopt_value1 == SAM_V1_6_Alignment_AOPT sam_v1_6_alignment_aopt_tag2 + sam_v1_6_alignment_aopt_value2 = sam_v1_6_alignment_aopt_tag1 == sam_v1_6_alignment_aopt_tag2 && + sam_v1_6_alignment_aopt_value1 == sam_v1_6_alignment_aopt_value2 + +instance Show SAM_V1_6_Alignment_AOPT where + show (SAM_V1_6_Alignment_AOPT tag + value + ) = + "SAM_V1_6_Alignment_AOPT { " ++ + "sam_v1_6_alignment_aopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_aopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/BOPT.hs b/src/Data/SAM/Version1_6/Alignment/BOPT.hs --- a/src/Data/SAM/Version1_6/Alignment/BOPT.hs +++ b/src/Data/SAM/Version1_6/Alignment/BOPT.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Alignment.BOPT @@ -133,13 +128,13 @@ bopttype value ) = - "SAM_V1_6_Alignment_BOPT_Int8 { " ++ - "tag = " ++ - (show tag) ++ - " , type = " ++ - (show bopttype) ++ - " , value = " ++ - (show value) ++ + "SAM_V1_6_Alignment_BOPT_Int8 { " ++ + "sam_v1_6_alignment_bopt_int8_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_bopt_int8_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_bopt_int8_value = " ++ + (show value) ++ " }" -- | c__C__sSiIf of the last optional field (type B). @@ -159,13 +154,13 @@ bopttype value ) = - "SAM_V1_6_Alignment_BOPT_Word8 { " ++ - "tag = " ++ - (show tag) ++ - " , type = " ++ - (show bopttype) ++ - " , value = " ++ - (show value) ++ + "SAM_V1_6_Alignment_BOPT_Word8 { " ++ + "sam_v1_6_alignment_bopt_word8_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_bopt_word8_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_bopt_word8_value = " ++ + (show value) ++ " }" -- | cC__s__SiIf of the last optional field (type B). @@ -185,13 +180,13 @@ bopttype value ) = - "SAM_V1_6_Alignment_BOPT_Int16 { " ++ - "tag = " ++ - (show tag) ++ - " , type = " ++ - (show bopttype) ++ - " , value = " ++ - (show value) ++ + "SAM_V1_6_Alignment_BOPT_Int16 { " ++ + "sam_v1_6_alignment_bopt_int16_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_bopt_int16_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_bopt_int16_value = " ++ + (show value) ++ " }" -- | cCs__S__iIf of the last optional field (type B). @@ -211,13 +206,13 @@ bopttype value ) = - "SAM_V1_6_Alignment_BOPT_Word16 { " ++ - "tag = " ++ - (show tag) ++ - " , type = " ++ - (show bopttype) ++ - " , value = " ++ - (show value) ++ + "SAM_V1_6_Alignment_BOPT_Word16 { " ++ + "sam_v1_6_alignment_bopt_word16_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_bopt_word16_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_bopt_word16_value = " ++ + (show value) ++ " }" -- | cCsS__i__If of the last optional field (type B). @@ -237,13 +232,13 @@ bopttype value ) = - "SAM_V1_6_Alignment_BOPT_Int32 { " ++ - "tag = " ++ - (show tag) ++ - " , type = " ++ - (show bopttype) ++ - " , value = " ++ - (show value) ++ + "SAM_V1_6_Alignment_BOPT_Int32 { " ++ + "sam_v1_6_alignment_bopt_int32_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_bopt_int32_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_bopt_int32_value = " ++ + (show value) ++ " }" -- | cCsSi__I__f of the last optional field (type B). @@ -263,13 +258,13 @@ bopttype value ) = - "SAM_V1_6_Alignment_BOPT_Word32 { " ++ - "tag = " ++ - (show tag) ++ - " , type = " ++ - (show bopttype) ++ - " , value = " ++ - (show value) ++ + "SAM_V1_6_Alignment_BOPT_Word32 { " ++ + "sam_v1_6_alignment_bopt_word32_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_bopt_word32_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_bopt_word32_value = " ++ + (show value) ++ " }" -- | cCsSiI__f__ of the last optional field (type B). @@ -289,11 +284,11 @@ bopttype value ) = - "SAM_V1_6_Alignment_BOPT_Float { " ++ - "tag = " ++ - (show tag) ++ - " , type = " ++ - (show bopttype) ++ - " , value = " ++ - (show value) ++ + "SAM_V1_6_Alignment_BOPT_Float { " ++ + "sam_v1_6_alignment_bopt_float_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_bopt_float_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_bopt_float_value = " ++ + (show value) ++ " }" diff --git a/src/Data/SAM/Version1_6/Alignment/Base.hs b/src/Data/SAM/Version1_6/Alignment/Base.hs --- a/src/Data/SAM/Version1_6/Alignment/Base.hs +++ b/src/Data/SAM/Version1_6/Alignment/Base.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} {-# OPTIONS_GHC -fno-warn-name-shadowing #-} -- | @@ -27,12 +22,15 @@ SAM_V1_6_Alignment(..) ) where +import Data.SAM.Version1_6.Alignment.AOPT +import Data.SAM.Version1_6.Alignment.IOPT +import Data.SAM.Version1_6.Alignment.FOPT +import Data.SAM.Version1_6.Alignment.ZOPT +import Data.SAM.Version1_6.Alignment.HOPT import Data.SAM.Version1_6.Alignment.BOPT import Data.ByteString import Data.Data -import Data.Sequence -import Data.Word import Generics.Deriving.Base -- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment"@ data type. @@ -102,11 +100,11 @@ -- This field can be a ‘*’ when quality is not stored. -- If not a ‘*’, SEQ must not be a ‘*’ and the length of the quality -- string ought to equal the length of SEQ. - , sam_v1_6_alignment_aopt :: Maybe ByteString -- ^ A - [!-~] - Printable characters. - , sam_v1_6_alignment_iopt :: Maybe Integer -- ^ i - [-+]?[0-9]+ - Signed integer. - , sam_v1_6_alignment_fopt :: Maybe Float -- ^ f - [-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? - Single-precision floating number. - , sam_v1_6_alignment_zopt :: Maybe ByteString -- ^ Z - [ !-~]* - Printable string, including space. - , sam_v1_6_alignment_hopt :: Maybe (Seq Word8) -- ^ H - ([0-9A-F][0-9A-F])* - Byte array in the Hex format. + , sam_v1_6_alignment_aopt :: Maybe SAM_V1_6_Alignment_AOPT -- ^ A - [!-~] - Printable characters. + , sam_v1_6_alignment_iopt :: Maybe SAM_V1_6_Alignment_IOPT -- ^ i - [-+]?[0-9]+ - Signed integer. + , sam_v1_6_alignment_fopt :: Maybe SAM_V1_6_Alignment_FOPT -- ^ f - [-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? - Single-precision floating number. + , sam_v1_6_alignment_zopt :: Maybe SAM_V1_6_Alignment_ZOPT -- ^ Z - [ !-~]* - Printable string, including space. + , sam_v1_6_alignment_hopt :: Maybe SAM_V1_6_Alignment_HOPT -- ^ H - ([0-9A-F][0-9A-F])* - Byte array in the Hex format. , sam_v1_6_alignment_bopt :: Maybe SAM_V1_6_Alignment_BOPT -- ^ B - [cCsSiIf]​(,[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)* - Integer or numeric array. } deriving (Generic,Typeable) @@ -164,39 +162,39 @@ instance Show SAM_V1_6_Alignment where show (SAM_V1_6_Alignment qname flag rname pos mapq cigar rnext pnext tlen seq qual aopt iopt fopt zopt hopt bopt) = - "SAM_V1_6_Alignment { " ++ - "qname = " ++ - (show qname) ++ - " , flag = " ++ - (show flag) ++ - " , rname = " ++ - (show rname) ++ - " , pos = " ++ - (show pos) ++ - " , mapq = " ++ - (show mapq) ++ - " , cigar = " ++ - (show cigar) ++ - " , rnext = " ++ - (show rnext) ++ - " , pnext = " ++ - (show pnext) ++ - " , tlen = " ++ - (show tlen) ++ - " , seq = " ++ - (show seq) ++ - " , qual = " ++ - (show qual) ++ - " , aopt = " ++ - ( show aopt) ++ - " , iopt = " ++ - (show iopt) ++ - " , fopt = " ++ - (show fopt) ++ - " , zopt = " ++ - (show zopt) ++ - " , hopt = " ++ - (show hopt) ++ - " , bopt = " ++ - (show bopt) ++ + "SAM_V1_6_Alignment { " ++ + "sam_v1_6_alignment_qname = " ++ + (show qname) ++ + " , sam_v1_6_alignment_flag = " ++ + (show flag) ++ + " , sam_v1_6_alignment_rname = " ++ + (show rname) ++ + " , sam_v1_6_alignment_pos = " ++ + (show pos) ++ + " , sam_v1_6_alignment_mapq = " ++ + (show mapq) ++ + " , sam_v1_6_alignment_cigar = " ++ + (show cigar) ++ + " , sam_v1_6_alignment_rnext = " ++ + (show rnext) ++ + " , sam_v1_6_alignment_pnext = " ++ + (show pnext) ++ + " , sam_v1_6_alignment_tlen = " ++ + (show tlen) ++ + " , sam_v1_6_alignment_seq = " ++ + (show seq) ++ + " , sam_v1_6_alignment_qual = " ++ + (show qual) ++ + " , sam_v1_6_alignment_aopt = " ++ + ( show aopt) ++ + " , sam_v1_6_alignment_iopt = " ++ + (show iopt) ++ + " , sam_v1_6_alignment_fopt = " ++ + (show fopt) ++ + " , sam_v1_6_alignment_zopt = " ++ + (show zopt) ++ + " , sam_v1_6_alignment_hopt = " ++ + (show hopt) ++ + " , sam_v1_6_alignment_bopt = " ++ + (show bopt) ++ " }" diff --git a/src/Data/SAM/Version1_6/Alignment/FOPT.hs b/src/Data/SAM/Version1_6/Alignment/FOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/FOPT.hs @@ -0,0 +1,68 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.FOPT +-- Copyright : (c) Matthew Mosior 2023 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.FOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_FOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_FOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_FOPT = SAM_V1_6_Alignment_FOPT { sam_v1_6_alignment_fopt_tag :: ByteString + , sam_v1_6_alignment_fopt_value :: Float + } + deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_FOPT where + SAM_V1_6_Alignment_FOPT sam_v1_6_alignment_fopt_tag1 + sam_v1_6_alignment_fopt_value1 == SAM_V1_6_Alignment_FOPT sam_v1_6_alignment_fopt_tag2 + sam_v1_6_alignment_fopt_value2 = sam_v1_6_alignment_fopt_tag1 == sam_v1_6_alignment_fopt_tag2 && + sam_v1_6_alignment_fopt_value1 == sam_v1_6_alignment_fopt_value2 + +instance Show SAM_V1_6_Alignment_FOPT where + show (SAM_V1_6_Alignment_FOPT tag + value + ) = + "SAM_V1_6_Alignment_FOPT { " ++ + "sam_v1_6_alignment_fopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_fopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/HOPT.hs b/src/Data/SAM/Version1_6/Alignment/HOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/HOPT.hs @@ -0,0 +1,68 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.HOPT +-- Copyright : (c) Matthew Mosior 2023 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.HOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_HOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_HOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_HOPT = SAM_V1_6_Alignment_HOPT { sam_v1_6_alignment_hopt_tag :: ByteString + , sam_v1_6_alignment_hopt_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_HOPT where + SAM_V1_6_Alignment_HOPT sam_v1_6_alignment_hopt_tag1 + sam_v1_6_alignment_hopt_value1 == SAM_V1_6_Alignment_HOPT sam_v1_6_alignment_hopt_tag2 + sam_v1_6_alignment_hopt_value2 = sam_v1_6_alignment_hopt_tag1 == sam_v1_6_alignment_hopt_tag2 && + sam_v1_6_alignment_hopt_value1 == sam_v1_6_alignment_hopt_value2 + +instance Show SAM_V1_6_Alignment_HOPT where + show (SAM_V1_6_Alignment_HOPT tag + value + ) = + "SAM_V1_6_Alignment_HOPT { " ++ + "sam_v1_6_alignment_hopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_hopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/IOPT.hs b/src/Data/SAM/Version1_6/Alignment/IOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/IOPT.hs @@ -0,0 +1,68 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.IOPT +-- Copyright : (c) Matthew Mosior 2023 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.IOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_IOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_IOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_IOPT = SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag :: ByteString + , sam_v1_6_alignment_iopt_value :: Integer + } + deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_IOPT where + SAM_V1_6_Alignment_IOPT sam_v1_6_alignment_iopt_tag1 + sam_v1_6_alignment_iopt_value1 == SAM_V1_6_Alignment_IOPT sam_v1_6_alignment_iopt_tag2 + sam_v1_6_alignment_iopt_value2 = sam_v1_6_alignment_iopt_tag1 == sam_v1_6_alignment_iopt_tag2 && + sam_v1_6_alignment_iopt_value1 == sam_v1_6_alignment_iopt_value2 + +instance Show SAM_V1_6_Alignment_IOPT where + show (SAM_V1_6_Alignment_IOPT tag + value + ) = + "SAM_V1_6_Alignment_IOPT { " ++ + "sam_v1_6_alignment_iopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_iopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/ZOPT.hs b/src/Data/SAM/Version1_6/Alignment/ZOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/ZOPT.hs @@ -0,0 +1,68 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.ZOPT +-- Copyright : (c) Matthew Mosior 2023 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.ZOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_ZOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_ZOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_ZOPT = SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag :: ByteString + , sam_v1_6_alignment_zopt_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_ZOPT where + SAM_V1_6_Alignment_ZOPT sam_v1_6_alignment_zopt_tag1 + sam_v1_6_alignment_zopt_value1 == SAM_V1_6_Alignment_ZOPT sam_v1_6_alignment_zopt_tag2 + sam_v1_6_alignment_zopt_value2 = sam_v1_6_alignment_zopt_tag1 == sam_v1_6_alignment_zopt_tag2 && + sam_v1_6_alignment_zopt_value1 == sam_v1_6_alignment_zopt_value2 + +instance Show SAM_V1_6_Alignment_ZOPT where + show (SAM_V1_6_Alignment_ZOPT tag + value + ) = + "SAM_V1_6_Alignment_ZOPT { " ++ + "sam_v1_6_alignment_zopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_zopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Base.hs b/src/Data/SAM/Version1_6/Base.hs --- a/src/Data/SAM/Version1_6/Base.hs +++ b/src/Data/SAM/Version1_6/Base.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Base @@ -82,17 +77,17 @@ one_line_comment alignment ) = - "SAM_V1_6 { " ++ - "file_level_metadata = " ++ - (show file_level_metadata) ++ - " , reference_sequence_dictionary = " ++ - (show reference_sequence_dictionary) ++ - " , read_group = " ++ - (show read_group) ++ - " , program = " ++ - (show program) ++ - " , one_line_comment = " ++ - (show one_line_comment) ++ - " , alignment = " ++ - (show alignment) ++ + "SAM_V1_6 { " ++ + "sam_v1_6_file_level_metadata = " ++ + (show file_level_metadata) ++ + " , sam_v1_6_reference_sequence_dictionary = " ++ + (show reference_sequence_dictionary) ++ + " , sam_v1_6_read_group = " ++ + (show read_group) ++ + " , sam_v1_6_program = " ++ + (show program) ++ + " , sam_v1_6_one_line_comment = " ++ + (show one_line_comment) ++ + " , sam_v1_6_alignment = " ++ + (show alignment) ++ " }" diff --git a/src/Data/SAM/Version1_6/Header.hs b/src/Data/SAM/Version1_6/Header.hs --- a/src/Data/SAM/Version1_6/Header.hs +++ b/src/Data/SAM/Version1_6/Header.hs @@ -1,15 +1,7 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Header diff --git a/src/Data/SAM/Version1_6/Header/CO.hs b/src/Data/SAM/Version1_6/Header/CO.hs --- a/src/Data/SAM/Version1_6/Header/CO.hs +++ b/src/Data/SAM/Version1_6/Header/CO.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Header.CO @@ -41,7 +36,7 @@ SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value1 == SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value2 = sam_v1_6_one_line_comment_value1 == sam_v1_6_one_line_comment_value2 instance Show SAM_V1_6_One_Line_Comment where - show (SAM_V1_6_One_Line_Comment value) = "SAM_V1_6_One_Line_Comment { " ++ - "value = " ++ - (show value) ++ + show (SAM_V1_6_One_Line_Comment value) = "SAM_V1_6_One_Line_Comment { " ++ + "sam_v1_6_one_line_comment_value = " ++ + (show value) ++ " }" diff --git a/src/Data/SAM/Version1_6/Header/HD.hs b/src/Data/SAM/Version1_6/Header/HD.hs --- a/src/Data/SAM/Version1_6/Header/HD.hs +++ b/src/Data/SAM/Version1_6/Header/HD.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Header.HD @@ -59,15 +54,15 @@ instance Show SAM_V1_6_File_Level_Metadata where show (SAM_V1_6_File_Level_Metadata version sorting_order alignment_grouping subsorting_order) = - "SAM_V1_6_File_Level_Metadata { " ++ - "version = " ++ - (show version) ++ - " , sorting_order = " ++ - (show sorting_order) ++ - " , alignment_grouping = " ++ - (show alignment_grouping) ++ - " , subsorting_order = " ++ - (show subsorting_order) ++ + "SAM_V1_6_File_Level_Metadata { " ++ + "sam_v1_6_file_level_metadata_format_version = " ++ + (show version) ++ + " , sam_v1_6_file_level_metadata_sorting_order = " ++ + (show sorting_order) ++ + " , sam_v1_6_file_level_metadata_alignment_grouping = " ++ + (show alignment_grouping) ++ + " , sam_v1_6_file_level_metadata_subsorting_order = " ++ + (show subsorting_order) ++ " }" -- | VN tag for @"SAM_V1_6_File_Level_Metadata"@. @@ -80,9 +75,9 @@ instance Show SAM_V1_6_File_Level_Metadata_Format_Version where show (SAM_V1_6_File_Level_Metadata_Format_Version value) = - "SAM_V1_6_File_Level_Metadata_Format_Version { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_File_Level_Metadata_Format_Version { " ++ + "sam_v1_6_file_level_metadata_format_version_value = " ++ + (show value) ++ " }" -- | SO tag for @"SAM_V1_6_File_Level_Metadata"@. @@ -95,9 +90,9 @@ instance Show SAM_V1_6_File_Level_Metadata_Sorting_Order where show (SAM_V1_6_File_Level_Metadata_Sorting_Order value) = - "SAM_V1_6_File_Level_Metadata_Sorting_Order { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_File_Level_Metadata_Sorting_Order { " ++ + "sam_v1_6_file_level_metadata_sorting_order_value = " ++ + (show value) ++ " }" -- | GO tag for @"SAM_V1_6_File_Level_Metadata"@. @@ -110,9 +105,9 @@ instance Show SAM_V1_6_File_Level_Metadata_Alignment_Grouping where show (SAM_V1_6_File_Level_Metadata_Alignment_Grouping value) = - "SAM_V1_6_File_Level_Metadata_Alignment_Grouping { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_File_Level_Metadata_Alignment_Grouping { " ++ + "sam_v1_6_file_level_metadata_alignment_grouping_value = " ++ + (show value) ++ " }" -- | SS tag for @"SAM_V1_6_File_Level_Metadata"@. @@ -125,7 +120,7 @@ instance Show SAM_V1_6_File_Level_Metadata_SubSorting_Order where show (SAM_V1_6_File_Level_Metadata_SubSorting_Order value) = - "SAM_V1_6_File_Level_Metadata_SubSorting_Order { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_File_Level_Metadata_SubSorting_Order { " ++ + "sam_v1_6_file_level_metadata_subsorting_order_value = " ++ + (show value) ++ " }" diff --git a/src/Data/SAM/Version1_6/Header/PG.hs b/src/Data/SAM/Version1_6/Header/PG.hs --- a/src/Data/SAM/Version1_6/Header/PG.hs +++ b/src/Data/SAM/Version1_6/Header/PG.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Header.PG @@ -69,19 +64,19 @@ instance Show SAM_V1_6_Program where show (SAM_V1_6_Program record_identifier name command_line previous_pg_id description version) = - "SAM_V1_6_Program { " ++ - "record_identifier = " ++ - (show record_identifier) ++ - " , name = " ++ - (show name) ++ - " , command_line = " ++ - (show command_line) ++ - " , previous_pg_id = " ++ - (show previous_pg_id) ++ - " , description = " ++ - (show description) ++ - " , version = " ++ - (show version) ++ + "SAM_V1_6_Program { " ++ + "rsam_v1_6_program_record_identifier = " ++ + (show record_identifier) ++ + " , sam_v1_6_program_name = " ++ + (show name) ++ + " , sam_v1_6_program_command_line = " ++ + (show command_line) ++ + " , sam_v1_6_program_previous_pg_id = " ++ + (show previous_pg_id) ++ + " , sam_v1_6_program_description = " ++ + (show description) ++ + " , sam_v1_6_program_version = " ++ + (show version) ++ " }" -- | ID tag for @"SAM_V1_6_Program"@. @@ -94,9 +89,9 @@ instance Show SAM_V1_6_Program_Record_Identifier where show (SAM_V1_6_Program_Record_Identifier value) = - "SAM_V1_6_Program_Record_Identifier { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Program_Record_Identifier { " ++ + "sam_v1_6_program_record_identifier_value = " ++ + (show value) ++ " }" -- | PN tag for @"SAM_V1_6_Program"@. @@ -109,9 +104,9 @@ instance Show SAM_V1_6_Program_Name where show (SAM_V1_6_Program_Name value) = - "SAM_V1_6_Program_Name { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Program_Name { " ++ + "sam_v1_6_program_name_value = " ++ + (show value) ++ " }" -- | CL tag for @"SAM_V1_6_Program"@. @@ -124,9 +119,9 @@ instance Show SAM_V1_6_Program_Command_Line where show (SAM_V1_6_Program_Command_Line value) = - "SAM_V1_6_Program_Command_Line { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Program_Command_Line { " ++ + "sam_v1_6_program_command_line_value = " ++ + (show value) ++ " }" -- | PP tag for @"SAM_V1_6_Program"@. @@ -139,9 +134,9 @@ instance Show SAM_V1_6_Program_Previous_PG_ID where show (SAM_V1_6_Program_Previous_PG_ID value) = - "SAM_V1_6_Program_Previous_PG_ID { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Program_Previous_PG_ID { " ++ + "sam_v1_6_program_previous_pg_id_value = " ++ + (show value) ++ " }" -- | DS tag for @"SAM_V1_6_Program"@. @@ -154,9 +149,9 @@ instance Show SAM_V1_6_Program_Description where show (SAM_V1_6_Program_Description value) = - "SAM_V1_6_Program_Description { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Program_Description { " ++ + "sam_v1_6_program_description_value = " ++ + (show value) ++ " }" -- | VN tag for @"SAM_V1_6_Program"@. @@ -169,7 +164,7 @@ instance Show SAM_V1_6_Program_Version where show (SAM_V1_6_Program_Version value) = - "SAM_V1_6_Program_Version { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Program_Version { " ++ + "sam_v1_6_program_version_value = " ++ + (show value) ++ " }" diff --git a/src/Data/SAM/Version1_6/Header/RG.hs b/src/Data/SAM/Version1_6/Header/RG.hs --- a/src/Data/SAM/Version1_6/Header/RG.hs +++ b/src/Data/SAM/Version1_6/Header/RG.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Header.RG @@ -48,7 +43,7 @@ -- | Custom SAM (version 1.6) @"SAM_V1_6_Read_Group"@ data type. -- -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Read_Group = SAM_V1_6_Read_Group { sam_v1_6_read_group_identifer :: SAM_V1_6_Read_Group_Identifier +data SAM_V1_6_Read_Group = SAM_V1_6_Read_Group { sam_v1_6_read_group_identifier :: SAM_V1_6_Read_Group_Identifier , sam_v1_6_read_group_barcode_sequence :: Maybe SAM_V1_6_Read_Group_Barcode_Sequence , sam_v1_6_read_group_sequencing_center :: Maybe SAM_V1_6_Read_Group_Sequencing_Center , sam_v1_6_read_group_description :: Maybe SAM_V1_6_Read_Group_Description @@ -63,6 +58,7 @@ , sam_v1_6_read_group_platform_unit :: Maybe SAM_V1_6_Read_Group_Platform_Unit , sam_v1_6_read_group_sample :: Maybe SAM_V1_6_Read_Group_Sample } + deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group where SAM_V1_6_Read_Group sam_v1_6_read_group_identifier1 @@ -122,35 +118,35 @@ platform_unit sample ) = - "SAM_V1_6_Read_Group { " ++ - "read_group_identifier = " ++ - (show group_identifier) ++ - " , barcode_sequence = " ++ - (show barcode_sequence) ++ - " , sequencing_center = " ++ - (show sequencing_center) ++ - " , description = " ++ - (show description) ++ - " , run_date = " ++ - (show run_date) ++ - " , flow_order = " ++ - (show flow_order) ++ - " , key_sequence = " ++ - (show key_sequence) ++ - " , library = " ++ - (show library) ++ - " , programs = " ++ - (show programs) ++ - " , show_predicted_median_insert_size = " ++ - (show predicted_median_insert_size) ++ - " , platform = " ++ - (show platform) ++ - " , platform_model = " ++ - (show platform_model) ++ - " , platform_unit = " ++ - (show platform_unit) ++ - " , sample = " ++ - (show sample) ++ + "SAM_V1_6_Read_Group { " ++ + "sam_v1_6_read_group_identifier = " ++ + (show group_identifier) ++ + " , sam_v1_6_read_group_barcode_sequence = " ++ + (show barcode_sequence) ++ + " , sam_v1_6_read_group_sequencing_center = " ++ + (show sequencing_center) ++ + " , sam_v1_6_read_group_description = " ++ + (show description) ++ + " , sam_v1_6_read_group_run_date = " ++ + (show run_date) ++ + " , sam_v1_6_read_group_flow_order = " ++ + (show flow_order) ++ + " , sam_v1_6_read_group_key_sequence = " ++ + (show key_sequence) ++ + " , sam_v1_6_read_group_library = " ++ + (show library) ++ + " , sam_v1_6_read_group_programs = " ++ + (show programs) ++ + " , sam_v1_6_read_group_show_predicted_median_insert_size = " ++ + (show predicted_median_insert_size) ++ + " , sam_v1_6_read_group_platform = " ++ + (show platform) ++ + " , sam_v1_6_read_group_platform_model = " ++ + (show platform_model) ++ + " , sam_v1_6_read_group_platform_unit = " ++ + (show platform_unit) ++ + " , sam_v1_6_read_group_sample = " ++ + (show sample) ++ " }" -- | ID tag for @"SAM_V1_6_Read_Group"@. @@ -163,9 +159,9 @@ instance Show SAM_V1_6_Read_Group_Identifier where show (SAM_V1_6_Read_Group_Identifier value) = - "SAM_V1_6_Read_Group_Identifier { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Identifier { " ++ + "sam_v1_6_read_group_identifier_value = " ++ + (show value) ++ " }" -- | BC tag for @"SAM_V1_6_Read_Group"@. @@ -178,9 +174,9 @@ instance Show SAM_V1_6_Read_Group_Barcode_Sequence where show (SAM_V1_6_Read_Group_Barcode_Sequence value) = - "SAM_V1_6_Read_Group_Barcode_Sequence { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Barcode_Sequence { " ++ + "sam_v1_6_read_group_barcode_sequence_value = " ++ + (show value) ++ " }" -- | CN tag for @"SAM_V1_6_Read_Group"@. @@ -193,9 +189,9 @@ instance Show SAM_V1_6_Read_Group_Sequencing_Center where show (SAM_V1_6_Read_Group_Sequencing_Center value) = - "SAM_V1_6_Read_Group_Sequencing_Center { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Sequencing_Center { " ++ + "sam_v1_6_read_group_sequencing_center_value = " ++ + (show value) ++ " }" -- | DS tag for @"SAM_V1_6_Read_Group"@. @@ -208,9 +204,9 @@ instance Show SAM_V1_6_Read_Group_Description where show (SAM_V1_6_Read_Group_Description value) = - "SAM_V1_6_Read_Group_Description { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Description { " ++ + "sam_v1_6_read_group_description_value = " ++ + (show value) ++ " }" -- | DT tag for @"SAM_V1_6_Read_Group"@. @@ -223,9 +219,9 @@ instance Show SAM_V1_6_Read_Group_Run_Date where show (SAM_V1_6_Read_Group_Run_Date value) = - "SAM_V1_6_Read_Group_Run_Date { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Run_Date { " ++ + "sam_v1_6_read_group_run_date_value = " ++ + (show value) ++ " }" -- | FO tag for @"SAM_V1_6_Read_Group"@. @@ -238,9 +234,9 @@ instance Show SAM_V1_6_Read_Group_Flow_Order where show (SAM_V1_6_Read_Group_Flow_Order value) = - "SAM_V1_6_Read_Group_Flow_Order { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Flow_Order { " ++ + "sam_v1_6_read_group_flow_order_value = " ++ + (show value) ++ " }" -- | KS tag for @"SAM_V1_6_Read_Group"@. @@ -253,9 +249,9 @@ instance Show SAM_V1_6_Read_Group_Key_Sequence where show (SAM_V1_6_Read_Group_Key_Sequence value) = - "SAM_V1_6_Read_Group_Key_Sequence { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Key_Sequence { " ++ + "sam_v1_6_read_group_key_sequence_value = " ++ + (show value) ++ " }" -- | LB tag for @"SAM_V1_6_Read_Group"@. @@ -268,9 +264,9 @@ instance Show SAM_V1_6_Read_Group_Library where show (SAM_V1_6_Read_Group_Library value) = - "SAM_V1_6_Read_Group_Library { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Library { " ++ + "sam_v1_6_read_group_library_value = " ++ + (show value) ++ " }" -- | PG tag for @"SAM_V1_6_Read_Group"@. @@ -283,9 +279,9 @@ instance Show SAM_V1_6_Read_Group_Programs where show (SAM_V1_6_Read_Group_Programs value) = - "SAM_V1_6_Read_Group_Programs { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Programs { " ++ + "sam_v1_6_read_group_programs_value = " ++ + (show value) ++ " }" -- | PI tag for @"SAM_V1_6_Read_Group"@. @@ -298,9 +294,9 @@ instance Show SAM_V1_6_Read_Group_Predicted_Median_Insert_Size where show (SAM_V1_6_Read_Group_Predicted_Median_Insert_Size value) = - "SAM_V1_6_Read_Group_Predicted_Median_Insert_Size { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Predicted_Median_Insert_Size { " ++ + "sam_v1_6_read_group_predicted_median_insert_size_value = " ++ + (show value) ++ " }" -- | PL tag for @"SAM_V1_6_Read_Group"@. @@ -313,9 +309,9 @@ instance Show SAM_V1_6_Read_Group_Platform where show (SAM_V1_6_Read_Group_Platform value) = - "SAM_V1_6_Read_Group_Platform { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Platform { " ++ + "sam_v1_6_read_group_platform_value = " ++ + (show value) ++ " }" -- | PM tag for @"SAM_V1_6_Read_Group"@. @@ -328,9 +324,9 @@ instance Show SAM_V1_6_Read_Group_Platform_Model where show (SAM_V1_6_Read_Group_Platform_Model value) = - "SAM_V1_6_Read_Group_Platform_Model { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Platform_Model { " ++ + "sam_v1_6_read_group_platform_model_value = " ++ + (show value) ++ " }" -- | PU tag for @"SAM_V1_6_Read_Group"@. @@ -343,9 +339,9 @@ instance Show SAM_V1_6_Read_Group_Platform_Unit where show (SAM_V1_6_Read_Group_Platform_Unit value) = - "SAM_V1_6_Read_Group_Platform_Unit { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Platform_Unit { " ++ + "sam_v1_6_read_group_platform_unit_value = " ++ + (show value) ++ " }" -- | SM tag for @"SAM_V1_6_Read_Group"@. @@ -358,7 +354,7 @@ instance Show SAM_V1_6_Read_Group_Sample where show (SAM_V1_6_Read_Group_Sample value) = - "SAM_V1_6_Read_Group_Sample { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Read_Group_Sample { " ++ + "sam_v1_6_read_group_sample_value = " ++ + (show value) ++ " }" diff --git a/src/Data/SAM/Version1_6/Header/SQ.hs b/src/Data/SAM/Version1_6/Header/SQ.hs --- a/src/Data/SAM/Version1_6/Header/SQ.hs +++ b/src/Data/SAM/Version1_6/Header/SQ.hs @@ -3,13 +3,8 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Header.SQ @@ -46,8 +41,8 @@ -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. data SAM_V1_6_Reference_Sequence_Dictionary = SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name , sam_v1_6_reference_sequence_dictionary_reference_sequence_length :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length - , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus - , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names + , sam_v1_6_reference_sequence_dictionary_alternative_locus :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus + , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier , sam_v1_6_reference_sequence_dictionary_description :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Description , sam_v1_6_reference_sequence_dictionary_md5_checksum :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum @@ -99,27 +94,27 @@ molecule_topology uri ) = - "SAM_V1_6_Reference_Sequence_Dictionary { " ++ - "reference_sequence_name = " ++ - (show reference_sequence_name) ++ - " , reference_sequence_length = " ++ - (show reference_sequence_length) ++ - " , reference_alternative_locus = " ++ - (show reference_alternative_locus) ++ - " , reference_alternative_sequence_names = " ++ - (show reference_alternative_sequence_names) ++ - " , genome_assembly_identifier = " ++ - (show genome_assembly_identifier) ++ - " , description = " ++ - (show description) ++ - " , md5_checksum = " ++ - (show md5_checksum) ++ - " , species = " ++ - (show species) ++ - " , molecule_topology = " ++ - (show molecule_topology) ++ - " , uri = " ++ - (show uri) ++ + "SAM_V1_6_Reference_Sequence_Dictionary { " ++ + "sam_v1_6_reference_sequence_dictionary_reference_sequence_name = " ++ + (show reference_sequence_name) ++ + " , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = " ++ + (show reference_sequence_length) ++ + " , sam_v1_6_reference_sequence_dictionary_alternative_locus = " ++ + (show reference_alternative_locus) ++ + " , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = " ++ + (show reference_alternative_sequence_names) ++ + " , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = " ++ + (show genome_assembly_identifier) ++ + " , sam_v1_6_reference_sequence_dictionary_description = " ++ + (show description) ++ + " , sam_v1_6_reference_sequence_dictionary_md5_checksum = " ++ + (show md5_checksum) ++ + " , sam_v1_6_reference_sequence_dictionary_species = " ++ + (show species) ++ + " , sam_v1_6_reference_sequence_dictionary_molecule_topology = " ++ + (show molecule_topology) ++ + " , sam_v1_6_reference_sequence_dictionary_uri = " ++ + (show uri) ++ " }" -- | SN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -132,9 +127,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name where show (SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { " ++ + "sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = " ++ + (show value) ++ " }" -- | LN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -147,9 +142,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length where show (SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { " ++ + "sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = " ++ + (show value) ++ " }" -- | AH tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -162,9 +157,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus where show (SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { " ++ + "sam_v1_6_reference_sequence_dictionary_alternative_locus_value = " ++ + (show value) ++ " }" -- | AN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -177,9 +172,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names where show (SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { " ++ + "sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value = " ++ + (show value) ++ " }" -- | AS tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -192,9 +187,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier where show (SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { " ++ + "sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value = " ++ + (show value) ++ " }" -- | DS tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -207,9 +202,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Description where show (SAM_V1_6_Reference_Sequence_Dictionary_Description value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Description { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Description { " ++ + "sam_v1_6_reference_sequence_dictionary_description_value = " ++ + (show value) ++ " }" -- | M5 tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -222,9 +217,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum where show (SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum value) = - "SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { " ++ + "sam_v1_6_reference_sequence_dictionary_md5_checksum_value = " ++ + (show value) ++ " }" -- | SP tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -237,9 +232,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Species where show (SAM_V1_6_Reference_Sequence_Dictionary_Species value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Species { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Species { " ++ + "sam_v1_6_reference_sequence_dictionary_species_value = " ++ + (show value) ++ " }" -- | TP tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -252,9 +247,9 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology where show (SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology value) = - "SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { " ++ + "sam_v1_6_reference_sequence_dictionary_molecule_topology_value = " ++ + (show value) ++ " }" -- | UR tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. @@ -267,7 +262,7 @@ instance Show SAM_V1_6_Reference_Sequence_Dictionary_URI where show (SAM_V1_6_Reference_Sequence_Dictionary_URI value) = - "SAM_V1_6_Reference_Sequence_Dictionary_URI { " ++ - "value = " ++ - (show value) ++ + "SAM_V1_6_Reference_Sequence_Dictionary_URI { " ++ + "sam_v1_6_reference_sequence_dictionary_uri_value = " ++ + (show value) ++ " }" diff --git a/src/Data/SAM/Version1_6/Read/Base.hs b/src/Data/SAM/Version1_6/Read/Base.hs --- a/src/Data/SAM/Version1_6/Read/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Base.hs @@ -113,7 +113,7 @@ -- The file is checked for errors as it is parsed. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -readSAM_V1_6 :: FilePath -- ^ Path to SAM file. +readSAM_V1_6 :: FilePath -- ^ Input path to SAM file. -> IO SAM_V1_6 readSAM_V1_6 fp = do let lazysamfile = S.unfold StreamlyInternalFile.chunkReader fp diff --git a/src/Data/SAM/Version1_6/Read/Error.hs b/src/Data/SAM/Version1_6/Read/Error.hs --- a/src/Data/SAM/Version1_6/Read/Error.hs +++ b/src/Data/SAM/Version1_6/Read/Error.hs @@ -3,13 +3,7 @@ {-# LANGUAGE FlexibleContexts #-} {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE TemplateHaskell #-} {-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} -- | -- Module : Data.SAM.Version1_6.Read.Error diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs @@ -43,24 +43,24 @@ parse_SAM_V1_6_Alignment_AOPT ) where +import Data.SAM.Version1_6.Alignment.AOPT import Data.SAM.Version1_6.Read.Error import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) import Data.Attoparsec.ByteString.Lazy as DABL -import qualified Data.ByteString as DB import Text.Regex.PCRE.Heavy -- | Defines a parser for the optional aopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_AOPT :: Parser DB.ByteString +parse_SAM_V1_6_Alignment_AOPT :: Parser SAM_V1_6_Alignment_AOPT parse_SAM_V1_6_Alignment_AOPT = do - _ <- do alignmentaoptfieldtagp <- DABL.takeTill (== 58) - -- Parse AOPT tag of the alignment section. - case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Tag_Incorrect_Format - True -> -- AOPT tag is in the accepted format. - return () + alignmentaoptfieldtag <- do alignmentaoptfieldtagp <- DABL.takeTill (== 58) + -- Parse AOPT tag of the alignment section. + case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Tag_Incorrect_Format + True -> -- AOPT tag is in the accepted format. + return alignmentaoptfieldtagp _ <- word8 58 _ <- do alignmentaoptfieldtypep <- DABL.takeTill (== 58) -- Parse AOPT type of the alignment section. @@ -75,4 +75,6 @@ False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Value_Incorrect_Format True -> -- AOPT value is in the accepted format. return alignmentaoptfieldvaluep - return alignmentaoptfieldvalue + return SAM_V1_6_Alignment_AOPT { sam_v1_6_alignment_aopt_tag = alignmentaoptfieldtag + , sam_v1_6_alignment_aopt_value = alignmentaoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs @@ -43,6 +43,7 @@ parse_SAM_V1_6_Alignment_FOPT ) where +import Data.SAM.Version1_6.Alignment.FOPT import Data.SAM.Version1_6.Read.Error import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) @@ -53,14 +54,14 @@ -- | Defines a parser for the optional fopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_FOPT :: Parser Float +parse_SAM_V1_6_Alignment_FOPT :: Parser SAM_V1_6_Alignment_FOPT parse_SAM_V1_6_Alignment_FOPT = do - _ <- do alignmentfoptfieldtagp <- DABL.takeTill (== 58) - -- Parse FOPT tag of the alignment section. - case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Tag_Incorrect_Format - True -> -- FOPT tag is in the accepted format. - return () + alignmentfoptfieldtag <- do alignmentfoptfieldtagp <- DABL.takeTill (== 58) + -- Parse FOPT tag of the alignment section. + case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Tag_Incorrect_Format + True -> -- FOPT tag is in the accepted format. + return alignmentfoptfieldtagp _ <- word8 58 _ <- do alignmentfoptfieldtypep <- DABL.takeTill (== 58) -- Parse FOPT type of the alignment section. @@ -77,4 +78,6 @@ case (DBC8.readInteger alignmentfoptfieldvaluep) of Nothing -> return (-1) Just (alignmentfoptfieldvalueinteger,_) -> return $ (fromInteger alignmentfoptfieldvalueinteger :: Float) - return alignmentfoptfieldvalue + return SAM_V1_6_Alignment_FOPT { sam_v1_6_alignment_fopt_tag = alignmentfoptfieldtag + , sam_v1_6_alignment_fopt_value = alignmentfoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs @@ -43,26 +43,24 @@ parse_SAM_V1_6_Alignment_HOPT ) where +import Data.SAM.Version1_6.Alignment.HOPT import Data.SAM.Version1_6.Read.Error import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) import Data.Attoparsec.ByteString.Lazy as DABL -import qualified Data.ByteString as DB -import Data.Sequence as DSeq -import Data.Word import Text.Regex.PCRE.Heavy -- | Defines a parser for the optional hopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_HOPT :: Parser (Seq Word8) +parse_SAM_V1_6_Alignment_HOPT :: Parser SAM_V1_6_Alignment_HOPT parse_SAM_V1_6_Alignment_HOPT = do - _ <- do alignmenthoptfieldtagp <- DABL.takeTill (== 58) - -- Parse HOPT tag of the alignment section. - case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Tag_Incorrect_Format - True -> -- HOPT tag is in the accepted format. - return () + alignmenthoptfieldtag <- do alignmenthoptfieldtagp <- DABL.takeTill (== 58) + -- Parse HOPT tag of the alignment section. + case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Tag_Incorrect_Format + True -> -- HOPT tag is in the accepted format. + return alignmenthoptfieldtagp _ <- word8 58 _ <- do alignmenthoptfieldtypep <- DABL.takeTill (== 58) -- Parse HOPT type of the alignment section. @@ -76,5 +74,7 @@ case (alignmenthoptfieldvaluep =~ [re|([0-9A-F][0-9A-F])*|]) of False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Value_Incorrect_Format True -> -- HOPT value is in the accepted format. - return $ DSeq.fromList $ DB.unpack alignmenthoptfieldvaluep - return alignmenthoptfieldvalue + return alignmenthoptfieldvaluep + return SAM_V1_6_Alignment_HOPT { sam_v1_6_alignment_hopt_tag = alignmenthoptfieldtag + , sam_v1_6_alignment_hopt_value = alignmenthoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs @@ -43,6 +43,7 @@ parse_SAM_V1_6_Alignment_IOPT ) where +import Data.SAM.Version1_6.Alignment.IOPT import Data.SAM.Version1_6.Read.Error import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) @@ -53,14 +54,14 @@ -- | Defines a parser for the optional iopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_IOPT :: Parser Integer +parse_SAM_V1_6_Alignment_IOPT :: Parser SAM_V1_6_Alignment_IOPT parse_SAM_V1_6_Alignment_IOPT = do - _ <- do alignmentioptfieldtagp <- DABL.takeTill (== 58) - -- Parse IOPT tag of the alignment section. - case (alignmentioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Tag_Incorrect_Format - True -> -- IOPT tag is in the accepted format. - return () + alignmentioptfieldtag <- do alignmentioptfieldtagp <- DABL.takeTill (== 58) + -- Parse IOPT tag of the alignment section. + case (alignmentioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Tag_Incorrect_Format + True -> -- IOPT tag is in the accepted format. + return alignmentioptfieldtagp _ <- word8 58 _ <- do alignmentioptfieldtypep <- DABL.takeTill (== 58) -- Parse IOPT type of the alignment section. @@ -77,4 +78,6 @@ case (DBC8.readInteger alignmentioptfieldvaluep) of Nothing -> return (-1) Just (alignmentioptfieldvalueinteger,_) -> return alignmentioptfieldvalueinteger - return alignmentioptfieldvalue + return SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag = alignmentioptfieldtag + , sam_v1_6_alignment_iopt_value = alignmentioptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs @@ -43,24 +43,24 @@ parse_SAM_V1_6_Alignment_ZOPT ) where +import Data.SAM.Version1_6.Alignment.ZOPT import Data.SAM.Version1_6.Read.Error import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) import Data.Attoparsec.ByteString.Lazy as DABL -import qualified Data.ByteString as DB import Text.Regex.PCRE.Heavy -- | Defines a parser for the optional zopt field of alignment section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_ZOPT :: Parser DB.ByteString +parse_SAM_V1_6_Alignment_ZOPT :: Parser SAM_V1_6_Alignment_ZOPT parse_SAM_V1_6_Alignment_ZOPT = do - _ <- do alignmentzoptfieldtagp <- DABL.takeTill (== 58) - -- Parse ZOPT tag of the alignment section. - case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Tag_Incorrect_Format - True -> -- ZOPT tag is in the accepted format. - return () + alignmentzoptfieldtag <- do alignmentzoptfieldtagp <- DABL.takeTill (== 58) + -- Parse ZOPT tag of the alignment section. + case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Tag_Incorrect_Format + True -> -- ZOPT tag is in the accepted format. + return alignmentzoptfieldtagp _ <- word8 58 _ <- do alignmentzoptfieldtypep <- DABL.takeTill (== 58) -- Parse ZOPT type of the alignment section. @@ -75,4 +75,6 @@ False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Value_Incorrect_Format True -> -- ZOPT value is in the accepted format. return alignmentzoptfieldvaluep - return alignmentzoptfieldvalue + return SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = alignmentzoptfieldtag + , sam_v1_6_alignment_zopt_value = alignmentzoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Write/Base.hs b/src/Data/SAM/Version1_6/Write/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Write/Base.hs @@ -0,0 +1,551 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Write.Base +-- Copyright : (c) Matthew Mosior 2023 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Write.Base ( -- * Writing + writeSAM_V1_6 + ) where + +import Data.SAM.Version1_6.Base +import Data.SAM.Version1_6.Header.HD +import Data.SAM.Version1_6.Header.SQ +import Data.SAM.Version1_6.Header.RG +import Data.SAM.Version1_6.Header.PG +import Data.SAM.Version1_6.Header.CO +import Data.SAM.Version1_6.Alignment.Base +import Data.SAM.Version1_6.Alignment.AOPT +import Data.SAM.Version1_6.Alignment.IOPT +import Data.SAM.Version1_6.Alignment.FOPT +import Data.SAM.Version1_6.Alignment.ZOPT +import Data.SAM.Version1_6.Alignment.HOPT +import Data.SAM.Version1_6.Alignment.BOPT + +import Data.ByteString as DB (pack,singleton) +import Data.ByteString.Lazy.Char8 as DBLC8 (fromStrict,unpack) +import Data.Foldable (toList) +import Data.Int (Int8,Int16,Int32) +import Data.List (intercalate) +import Data.Word +import Data.ByteString.Builder (toLazyByteString,word16LE,word32LE) +import System.IO (hFlush,hClose,hPutStr,IOMode(..),openFile, Handle) + + +-- | Deconstruct a @"SAM_V1_6"@ to a `String`. +deconstructSAM_V1_6 :: SAM_V1_6 + -> String +deconstructSAM_V1_6 samv16 = + ( intercalate "\n" $ + filter (not . null) [ sam_v1_6_file_level_metadata_tos + , sam_v1_6_reference_sequence_dictionary_tos + , sam_v1_6_read_group_tos + , sam_v1_6_program_tos + , sam_v1_6_one_line_comment_tos + , sam_v1_6_alignment_tos + ] + ) + ++ "\n" + where + sam_v1_6_file_level_metadata_format_version_tos x = "VN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_format_version_value $ + sam_v1_6_file_level_metadata_format_version x + ) + sam_v1_6_file_level_metadata_sorting_order_tos x = case (sam_v1_6_file_level_metadata_sorting_order x) of + Nothing -> "" + Just rgf -> "SO:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_sorting_order_value rgf + ) + sam_v1_6_file_level_metadata_alignment_grouping_tos x = case (sam_v1_6_file_level_metadata_alignment_grouping x) of + Nothing -> "" + Just rgf -> "GO:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_alignment_grouping_value rgf + ) + sam_v1_6_file_level_metadata_subsorting_order_tos x = case (sam_v1_6_file_level_metadata_subsorting_order x) of + Nothing -> "" + Just rgf -> "SS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_subsorting_order_value rgf + ) + sam_v1_6_file_level_metadata_tos = case (sam_v1_6_file_level_metadata samv16) of + Nothing -> "" + Just hdf -> intercalate "\t" $ + filter (not . null) $ + [ "@HD" + , sam_v1_6_file_level_metadata_format_version_tos hdf + , sam_v1_6_file_level_metadata_sorting_order_tos hdf + , sam_v1_6_file_level_metadata_alignment_grouping_tos hdf + , sam_v1_6_file_level_metadata_subsorting_order_tos hdf + ] + sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x = "SN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_name x + ) + sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x = "LN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_length x + ) + sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_locus x) of + Nothing -> "" + Just sqf -> "AH:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_alternative_locus_value sqf + ) + sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names x) of + Nothing -> "" + Just sqf -> "AN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value sqf + ) + sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x = case (sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier x) of + Nothing -> "" + Just sqf -> "AS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value sqf + ) + sam_v1_6_reference_sequence_dictionary_description_tos x = case (sam_v1_6_reference_sequence_dictionary_description x) of + Nothing -> "" + Just sqf -> "DS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_description_value sqf + ) + sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x = case (sam_v1_6_reference_sequence_dictionary_md5_checksum x) of + Nothing -> "" + Just sqf -> "M5:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_md5_checksum_value sqf + ) + sam_v1_6_reference_sequence_dictionary_species_tos x = case (sam_v1_6_reference_sequence_dictionary_species x) of + Nothing -> "" + Just sqf -> "SP:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_species_value sqf + ) + sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x = case (sam_v1_6_reference_sequence_dictionary_molecule_topology x) of + Nothing -> "" + Just sqf -> "TP:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_molecule_topology_value sqf + ) + sam_v1_6_reference_sequence_dictionary_uri_tos x = case (sam_v1_6_reference_sequence_dictionary_uri x) of + Nothing -> "" + Just sqf -> "UR:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_uri_value sqf + ) + sam_v1_6_reference_sequence_dictionary_tos = case (sam_v1_6_reference_sequence_dictionary samv16) of + Nothing -> "" + Just sqf -> intercalate "\n" $ + map (\x -> intercalate "\t" $ + filter (not .null) $ + [ "@SQ" + , sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x + , sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x + , sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x + , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x + , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x + , sam_v1_6_reference_sequence_dictionary_description_tos x + , sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x + , sam_v1_6_reference_sequence_dictionary_species_tos x + , sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x + , sam_v1_6_reference_sequence_dictionary_uri_tos x + ] + ) (toList sqf) + sam_v1_6_read_group_identifer_tos x = "ID:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_identifier_value $ + sam_v1_6_read_group_identifier x + ) + sam_v1_6_read_group_barcode_sequence_tos x = case (sam_v1_6_read_group_barcode_sequence x) of + Nothing -> "" + Just rgf -> "BC:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_barcode_sequence_value rgf + ) + sam_v1_6_read_group_sequencing_center_tos x = case (sam_v1_6_read_group_sequencing_center x) of + Nothing -> "" + Just rgf -> "CN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_sequencing_center_value rgf + ) + sam_v1_6_read_group_description_tos x = case (sam_v1_6_read_group_description x) of + Nothing -> "" + Just rgf -> "DS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_description_value rgf + ) + sam_v1_6_read_group_run_date_tos x = case (sam_v1_6_read_group_run_date x) of + Nothing -> "" + Just rgf -> "DT:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_run_date_value rgf + ) + sam_v1_6_read_group_flow_order_tos x = case (sam_v1_6_read_group_flow_order x) of + Nothing -> "" + Just rgf -> "FO:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_flow_order_value rgf + ) + sam_v1_6_read_group_key_sequence_tos x = case (sam_v1_6_read_group_key_sequence x) of + Nothing -> "" + Just rgf -> "KS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_key_sequence_value rgf + ) + sam_v1_6_read_group_library_tos x = case (sam_v1_6_read_group_library x) of + Nothing -> "" + Just rgf -> "LB:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_library_value rgf + ) + sam_v1_6_read_group_programs_tos x = case (sam_v1_6_read_group_programs x) of + Nothing -> "" + Just rgf -> "PG:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_programs_value rgf + ) + sam_v1_6_read_group_predicted_median_insert_size_tos x = case (sam_v1_6_read_group_predicted_median_insert_size x) of + Nothing -> "" + Just rgf -> "PI:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_predicted_median_insert_size_value rgf + ) + sam_v1_6_read_group_platform_tos x = case (sam_v1_6_read_group_platform x) of + Nothing -> "" + Just rgf -> "PL:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_platform_value rgf + ) + sam_v1_6_read_group_platform_model_tos x = case (sam_v1_6_read_group_platform_model x) of + Nothing -> "" + Just rgf -> "PM:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_platform_model_value rgf + ) + sam_v1_6_read_group_platform_unit_tos x = case (sam_v1_6_read_group_platform_unit x) of + Nothing -> "" + Just rgf -> "PU:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_platform_unit_value rgf + ) + sam_v1_6_read_group_sample_tos x = case (sam_v1_6_read_group_sample x) of + Nothing -> "" + Just rgf -> "SM:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_sample_value rgf + ) + sam_v1_6_read_group_tos = case (sam_v1_6_read_group samv16) of + Nothing -> "" + Just rgf -> intercalate "\n" $ + map (\x -> intercalate "\t" $ + filter (not . null) $ + [ "@RG" + , sam_v1_6_read_group_identifer_tos x + , sam_v1_6_read_group_barcode_sequence_tos x + , sam_v1_6_read_group_sequencing_center_tos x + , sam_v1_6_read_group_description_tos x + , sam_v1_6_read_group_run_date_tos x + , sam_v1_6_read_group_flow_order_tos x + , sam_v1_6_read_group_key_sequence_tos x + , sam_v1_6_read_group_library_tos x + , sam_v1_6_read_group_programs_tos x + , sam_v1_6_read_group_predicted_median_insert_size_tos x + , sam_v1_6_read_group_platform_tos x + , sam_v1_6_read_group_platform_model_tos x + , sam_v1_6_read_group_platform_unit_tos x + , sam_v1_6_read_group_sample_tos x + ] + ) (toList rgf) + sam_v1_6_program_record_identifier_tos x = "ID:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_record_identifier_value $ + sam_v1_6_program_record_identifier x + ) + sam_v1_6_program_name_tos x = case (sam_v1_6_program_name x) of + Nothing -> "" + Just rgf -> "PN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_name_value rgf + ) + sam_v1_6_program_command_line_tos x = case (sam_v1_6_program_command_line x) of + Nothing -> "" + Just rgf -> "CL:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_command_line_value rgf + ) + sam_v1_6_program_previous_pg_id_tos x = case (sam_v1_6_program_previous_pg_id x) of + Nothing -> "" + Just rgf -> "PP:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_previous_pg_id_value rgf + ) + sam_v1_6_program_description_tos x = case (sam_v1_6_program_description x) of + Nothing -> "" + Just rgf -> "DS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_description_value rgf + ) + sam_v1_6_program_version_tos x = case (sam_v1_6_program_version x) of + Nothing -> "" + Just rgf -> "VN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_version_value rgf + ) + sam_v1_6_program_tos = case (sam_v1_6_program samv16) of + Nothing -> "" + Just pgf -> intercalate "\t" $ + filter (not . null) $ + [ "@PG" + , sam_v1_6_program_record_identifier_tos pgf + , sam_v1_6_program_name_tos pgf + , sam_v1_6_program_command_line_tos pgf + , sam_v1_6_program_previous_pg_id_tos pgf + , sam_v1_6_program_description_tos pgf + , sam_v1_6_program_version_tos pgf + ] + sam_v1_6_one_line_comment_tos = case (sam_v1_6_one_line_comment samv16) of + Nothing -> "" + Just cof -> intercalate "\n" $ + map (\x -> intercalate "\t" $ + filter (not . null) + [ "@CO" + , unpack $ + fromStrict $ + sam_v1_6_one_line_comment_value x + ] + ) (toList cof) + sam_v1_6_alignment_tos = intercalate "\n" $ + map (\x -> case (null $ sam_v1_6_alignment_opts x) of + True -> sam_v1_6_alignment_mand x + False -> intercalate "\t" + [ sam_v1_6_alignment_mand x + , sam_v1_6_alignment_opts x + ] ) (toList $ sam_v1_6_alignment samv16) + sam_v1_6_alignment_mand x = intercalate "\t" $ + filter (not . null) + [ unpack $ fromStrict $ sam_v1_6_alignment_qname x + , show $ sam_v1_6_alignment_flag x + , unpack $ fromStrict $ sam_v1_6_alignment_rname x + , show $ sam_v1_6_alignment_pos x + , show $ sam_v1_6_alignment_mapq x + , unpack $ fromStrict $ sam_v1_6_alignment_cigar x + , unpack $ fromStrict $ sam_v1_6_alignment_rnext x + , show $ sam_v1_6_alignment_pnext x + , show $ sam_v1_6_alignment_tlen x + , unpack $ fromStrict $ sam_v1_6_alignment_seq x + , unpack $ fromStrict $ sam_v1_6_alignment_qual x + ] + sam_v1_6_alignment_opts x = intercalate "\t" $ + filter (not . null) + [ sam_v1_6_alignment_aopt_d x + , sam_v1_6_alignment_iopt_d x + , sam_v1_6_alignment_fopt_d x + , sam_v1_6_alignment_zopt_d x + , sam_v1_6_alignment_hopt_d x + , sam_v1_6_alignment_bopt_d x + ] + sam_v1_6_alignment_aopt_d x = case (sam_v1_6_alignment_aopt x) of + Nothing -> "" + Just aopt -> ( unpack $ + fromStrict $ + sam_v1_6_alignment_aopt_tag aopt + ) + ++ + ":A:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_aopt_value aopt + ) + sam_v1_6_alignment_iopt_d x = case (sam_v1_6_alignment_iopt x) of + Nothing -> "" + Just iopt -> ( unpack $ + fromStrict $ + sam_v1_6_alignment_iopt_tag iopt + ) + ++ + ":i:" + ++ + ( show $ + sam_v1_6_alignment_iopt_value iopt + ) + sam_v1_6_alignment_fopt_d x = case (sam_v1_6_alignment_fopt x) of + Nothing -> "" + Just fopt -> ( unpack $ + fromStrict $ + sam_v1_6_alignment_fopt_tag fopt + ) + ++ + ":f:" + ++ + ( show $ + sam_v1_6_alignment_fopt_value fopt + ) + sam_v1_6_alignment_zopt_d x = case (sam_v1_6_alignment_zopt x) of + Nothing -> "" + Just zopt -> ( unpack $ + fromStrict $ + sam_v1_6_alignment_zopt_tag zopt + ) + ++ + ":Z:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_zopt_value zopt + ) + sam_v1_6_alignment_hopt_d x = case (sam_v1_6_alignment_hopt x) of + Nothing -> "" + Just hopt -> ( unpack $ + fromStrict $ + sam_v1_6_alignment_hopt_tag hopt + ) + ++ + ":H:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_hopt_value hopt + ) + sam_v1_6_alignment_bopt_d x = case (sam_v1_6_alignment_bopt x) of + Nothing -> "" + Just bopt -> concat $ + filter (not . null) + [ sam_v1_6_alignment_bopt_int8_d bopt + , sam_v1_6_alignment_bopt_word8_d bopt + , sam_v1_6_alignment_bopt_int16_d bopt + , sam_v1_6_alignment_bopt_word16_d bopt + , sam_v1_6_alignment_bopt_int32_d bopt + , sam_v1_6_alignment_bopt_word32_d bopt + , sam_v1_6_alignment_bopt_float_d bopt + ] + sam_v1_6_alignment_bopt_int8_d x = case (sam_v1_6_alignment_bopt_int8 x) of + Nothing -> "" + Just bopt_int8 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int8_tag bopt_int8) ++ + ":" ++ + (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_int8_type bopt_int8) ++ + ":" ++ + (concat $ map encodeInt8 $ toList $ sam_v1_6_alignment_bopt_int8_value bopt_int8) + sam_v1_6_alignment_bopt_word8_d x = case (sam_v1_6_alignment_bopt_word8 x) of + Nothing -> "" + Just bopt_word8 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word8_tag bopt_word8) ++ + ":" ++ + (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_word8_type bopt_word8) ++ + ":" ++ + (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word8_value bopt_word8) + sam_v1_6_alignment_bopt_int16_d x = case (sam_v1_6_alignment_bopt_int16 x) of + Nothing -> "" + Just bopt_int16 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int16_tag bopt_int16) ++ + ":" ++ + (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_int16_type bopt_int16) ++ + ":" ++ + (concat $ map encodeInt16 $ toList $ sam_v1_6_alignment_bopt_int16_value bopt_int16) + sam_v1_6_alignment_bopt_word16_d x = case (sam_v1_6_alignment_bopt_word16 x) of + Nothing -> "" + Just bopt_word16 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word16_tag bopt_word16) ++ + ":" ++ + (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_word16_type bopt_word16) ++ + ":" ++ + (concat $ map encodeWord16 $ toList $ sam_v1_6_alignment_bopt_word16_value bopt_word16) + sam_v1_6_alignment_bopt_int32_d x = case (sam_v1_6_alignment_bopt_int32 x) of + Nothing -> "" + Just bopt_int32 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int32_tag bopt_int32) ++ + ":" ++ + (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_int32_type bopt_int32) ++ + ":" ++ + (concat $ map encodeInt32 $ toList $ sam_v1_6_alignment_bopt_int32_value bopt_int32) + sam_v1_6_alignment_bopt_word32_d x = case (sam_v1_6_alignment_bopt_word32 x) of + Nothing -> "" + Just bopt_word32 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word32_tag bopt_word32) ++ + ":" ++ + (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_word32_type bopt_word32) ++ + ":" ++ + (concat $ map encodeWord32 $ toList $ sam_v1_6_alignment_bopt_word32_value bopt_word32) + sam_v1_6_alignment_bopt_float_d x = case (sam_v1_6_alignment_bopt_float x) of + Nothing -> "" + Just bopt_float -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_float_tag bopt_float) ++ + ":" ++ + (unpack $ fromStrict $ singleton $ sam_v1_6_alignment_bopt_float_type bopt_float) ++ + ":" ++ + (concat $ map show $ toList $ sam_v1_6_alignment_bopt_float_value bopt_float) + encodeInt8 :: Int8 -> [Char] + encodeInt8 = show + encodeInt16 :: Int16 -> [Char] + encodeInt16 = show + encodeWord16 :: Word16 -> [Char] + encodeWord16 = unpack . toLazyByteString . word16LE + encodeInt32 :: Int32 -> [Char] + encodeInt32 = show + encodeWord32 :: Word32 -> [Char] + encodeWord32 = unpack . toLazyByteString . word32LE + +-- | Write @"SAM_V1_6"@ to a file. +-- Calls deconstructSAM_V1_6. +hPutSAM_V1_6 :: Handle + -> SAM_V1_6 + -> IO () +hPutSAM_V1_6 h samv16 = System.IO.hPutStr h + (deconstructSAM_V1_6 samv16) + +-- | Write a @"SAM_V1_6"@ to a file. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +writeSAM_V1_6 :: FilePath -- ^ Output path to SAM file. + -> SAM_V1_6 + -> IO () +writeSAM_V1_6 fp samv16 = do + h <- openFile fp + WriteMode + hPutSAM_V1_6 h + samv16 + hFlush h + hClose h diff --git a/test/Main.hs b/test/Main.hs --- a/test/Main.hs +++ b/test/Main.hs @@ -2,13 +2,16 @@ import Data.SAM.Version1_6.Base import Data.SAM.Version1_6.Alignment +import Data.SAM.Version1_6.Alignment.IOPT +import Data.SAM.Version1_6.Alignment.ZOPT import Data.SAM.Version1_6.Alignment.BOPT import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Base import Data.Sequence (fromList) -import Data.String (fromString) +import Data.String (fromString) import Test.Hspec +import Data.SAM.Version1_6.Write.Base main :: IO () main = hspec $ do @@ -26,40 +29,16 @@ describe "toy1.sam" $ do it "Ensures that readSAM_V1_6 can read and parse a SAM file with multiple reference sequence dictionary (@SQ) optional header fields." $ do readSAM_V1_6 "test/examples/toy1.sam" `shouldReturn` toy1sam + describe "Data.SAM.Version1_6.Write.Base" $ do + describe "writeSAM_V1_6" $ do + describe "toy2.sam" $ do + it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do + toy2 <- readSAM_V1_6 "test/examples/toy2.sam" + writeSAM_V1_6 "test/examples/toy2f.sam" toy2 + toy2f <- readSAM_V1_6 "test/examples/toy2f.sam" + toy2 `shouldBe` toy2f where - toy1sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing - , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing },SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref2" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "40" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) - , sam_v1_6_read_group = Nothing - , sam_v1_6_program = Nothing - , sam_v1_6_one_line_comment = Nothing - , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing - } - ] - } - toy2sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Just SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version = SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value = fromString "1.6" } , sam_v1_6_file_level_metadata_sorting_order = Just SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value = fromString "coordinate" } , sam_v1_6_file_level_metadata_alignment_grouping = Nothing , sam_v1_6_file_level_metadata_subsorting_order = Nothing } - , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) - , sam_v1_6_read_group = Nothing - , sam_v1_6_program = Nothing - , sam_v1_6_one_line_comment = Nothing - , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 99 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M2I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "3S6M1P1I4M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGATA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5S6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "GCCTAAGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just (fromString "ref,29,-,6H5M,17,0;") , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 2064 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 17 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just (fromString "ref,9,+,5S6M,30,1;") , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 147 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGGCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Just 1 , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing - } - ] - } - toy4sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing - , sam_v1_6_reference_sequence_dictionary = Nothing - , sam_v1_6_read_group = Nothing - , sam_v1_6_program = Nothing - , sam_v1_6_one_line_comment = Nothing - , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing - } - ] - } - toy5sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing - , sam_v1_6_reference_sequence_dictionary = Nothing - , sam_v1_6_read_group = Nothing - , sam_v1_6_program = Nothing - , sam_v1_6_one_line_comment = Nothing - , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing - } - ] - } + toy1sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing },SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref2" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "40" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } + toy2sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Just SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version = SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value = fromString "1.6" } , sam_v1_6_file_level_metadata_sorting_order = Just SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value = fromString "coordinate" } , sam_v1_6_file_level_metadata_alignment_grouping = Nothing , sam_v1_6_file_level_metadata_subsorting_order = Nothing } , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 99 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M2I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "3S6M1P1I4M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGATA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5S6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "GCCTAAGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = fromString "SA" , sam_v1_6_alignment_zopt_value = fromString "ref,29,-,6H5M,17,0;" } , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 2064 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 17 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = fromString "SA" , sam_v1_6_alignment_zopt_value = fromString "ref,9,+,5S6M,30,1;" } , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 147 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGGCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Just SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag = fromString "NM" , sam_v1_6_alignment_iopt_value = 1 } , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } + toy4sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Nothing , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } + toy5sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Nothing , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] }