biosff 0.3.2 → 0.3.3

raw patch · 3 files changed

+15/−5 lines, 3 filesdep ~arrayPVP: major bump suggested

API removals or changes: PVP suggests a major version bump

Dependency ranges changed: array

API changes (from Hackage documentation)

Files

• biosff.cabal +12/−4
• src/Bio/Sequence/SFF_filters.hs +2/−0
• src/Flower/Main.hs +1/−1

@@ -1,5 +1,5 @@ Name:                biosff-Version:             0.3.2+Version:             0.3.3 Synopsis:            Library and executables for working with SFF files Description:         The library contains the functionality for reading and writing 		     SFF files (sequencing data from 454 and Ion Torrent).  It duplicates@@ -17,11 +17,15 @@   Type:     darcs   Location: http://malde.org/~ketil/biohaskell/biosff -source-repository this+Source-repository this   Type:     darcs   Location: http://malde.org/~ketil/biohaskell/biosff-  Tag:      0.2+  Tag:      0.3.3 +Flag flower+  Description: Build the 'flower' executable.+  Default:     True+ Library   Exposed-modules: Bio.Sequence.SFF, Bio.Sequence.SFF_filters   Other-modules:   Bio.Sequence.SFF_name@@ -31,8 +35,12 @@  Executable flower   Main-Is:         Main.hs+  if flag(flower)+     Buildable:  True+  else+     Buildable:  False   Other-Modules:   Fork, Options, Metrics, Print-  Build-Depends:   base >= 3 && < 5, cmdargs, mtl >= 2+  Build-Depends:   base >= 3 && < 5, cmdargs, mtl >= 2, array >= 0.4   Hs-Source-Dirs:  src, src/Flower   Ghc-Options:     -Wall 

@@ -122,6 +122,8 @@  -- These are used for mate-pair libraries, should be located around the middle of the read: +flx_linker, ti_linker, rna_adapter, rna_adapter2, rna_adapter3, rapid_adapter, ti_adapter_b :: String+ flx_linker = "GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC"  -- Celera ti_linker  = "TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG"  -- 20K cod jump 

@@ -3,7 +3,7 @@  import Bio.Sequence.SFF import Bio.Sequence.SFF_filters-import Bio.Core+import Bio.Core hiding (toText)  import Print as P import Text.Printf