diff --git a/biosff.cabal b/biosff.cabal
--- a/biosff.cabal
+++ b/biosff.cabal
@@ -1,5 +1,5 @@
 Name:                biosff
-Version:             0.3.2
+Version:             0.3.3
 Synopsis:            Library and executables for working with SFF files
 Description:         The library contains the functionality for reading and writing
 		     SFF files (sequencing data from 454 and Ion Torrent).  It duplicates
@@ -17,11 +17,15 @@
   Type:     darcs
   Location: http://malde.org/~ketil/biohaskell/biosff
 
-source-repository this
+Source-repository this
   Type:     darcs
   Location: http://malde.org/~ketil/biohaskell/biosff
-  Tag:      0.2
+  Tag:      0.3.3
 
+Flag flower
+  Description: Build the 'flower' executable.
+  Default:     True
+
 Library
   Exposed-modules: Bio.Sequence.SFF, Bio.Sequence.SFF_filters
   Other-modules:   Bio.Sequence.SFF_name
@@ -31,8 +35,12 @@
 
 Executable flower
   Main-Is:         Main.hs
+  if flag(flower)
+     Buildable:  True
+  else
+     Buildable:  False
   Other-Modules:   Fork, Options, Metrics, Print
-  Build-Depends:   base >= 3 && < 5, cmdargs, mtl >= 2
+  Build-Depends:   base >= 3 && < 5, cmdargs, mtl >= 2, array >= 0.4
   Hs-Source-Dirs:  src, src/Flower
   Ghc-Options:     -Wall
 
diff --git a/src/Bio/Sequence/SFF_filters.hs b/src/Bio/Sequence/SFF_filters.hs
--- a/src/Bio/Sequence/SFF_filters.hs
+++ b/src/Bio/Sequence/SFF_filters.hs
@@ -122,6 +122,8 @@
 
 -- These are used for mate-pair libraries, should be located around the middle of the read:
 
+flx_linker, ti_linker, rna_adapter, rna_adapter2, rna_adapter3, rapid_adapter, ti_adapter_b :: String
+
 flx_linker = "GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC"  -- Celera
 ti_linker  = "TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG"  -- 20K cod jump
 
diff --git a/src/Flower/Main.hs b/src/Flower/Main.hs
--- a/src/Flower/Main.hs
+++ b/src/Flower/Main.hs
@@ -3,7 +3,7 @@
 
 import Bio.Sequence.SFF
 import Bio.Sequence.SFF_filters
-import Bio.Core
+import Bio.Core hiding (toText)
 
 import Print as P
 import Text.Printf