bio 0.5 → 0.5.0.1

raw patch · 3 files changed

+4/−29 lines, 3 filesPVP ok

version bump matches the API change (PVP)

API changes (from Hackage documentation)

Files

• Bio/Sequence/SFF.hs +2/−2
• Bio/Sequence/SFF_filters.hs +1/−26
• bio.cabal +1/−1

@@ -104,7 +104,6 @@  -- trimming the flowgram is necessary, but how to deal with the shift in flow -- sequence - i.e. what to do when trimming "splits" a flow into trimmed/untrimmed bases?- -- | Trim a read to specific sequence position, inclusive bounds -- The current implementation has the unintended side effect of  -- always trimming the flowgram down to a basecalled position.  @@ -112,7 +111,8 @@ -- since they need to have the same number of flows as given in  -- the 'CommmonHeader'. trimFromTo :: (Integral i) => i -> i -> ReadBlock -> ReadBlock-trimFromTo (l+1) r rd = let +trimFromTo x r rd = let+  l = x-1   trim_seq = LB.drop (fromIntegral l) . LB.take (fromIntegral r)   trim_seq' = B.drop (fromIntegral l) . B.take (fromIntegral r)   trim_flw = B.drop ((2*) $ fromIntegral $ baseToFlowPos rd l) . B.take ((2*) $ fromIntegral $ baseToFlowPos rd r)

@@ -138,30 +138,5 @@ rapid_adapter = "agtcgtggaggcaaggcacacagggatagg"  -- sea louse reads, key GACT ti_adapter_b  = "ctgagactgccaaggcacacagggggatagg"  -- sea bass and l.s.Ca                  -{- Email from Markus Grohme:->> Here are the sequences as filed by 454 in their patent application:->>> AdaptorA->> CTGAGACAGGGAGGGAACAGATGGGACACGCAGGGATGAGATGG->>> AdaptorB->> CTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG->>->> However, looking through some earlier project data I had, I also->> retrieved the following (by simply making a consensus of->> sequences that did not match the target genome anymore):->>> 5prime454adaptor???->> GCCTCCCTCGCGCCATCAGATCGTAGGCACCTGAAA->>> 3prime454adaptor???->> GCCTTGCCAGCCCGCTCAGATTGATGGTGCCTACAG->>->> I currently know one linker sequence (454/Roche also calls it spacer->> for GS20 and FLX paired-end sequencing:->>> flxlinker->> GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC->> For Titanium data using standard Roche protocol, you need to screen->> for two linker sequences:->>> titlinker1->> TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG->>> titlinker2->> CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA --}+

@@ -1,5 +1,5 @@ Name:                bio-Version:             0.5+Version:             0.5.0.1 License:             LGPL License-file:        LICENSE Cabal-Version:       >= 1.6