diff --git a/Bio/Sequence/SFF.hs b/Bio/Sequence/SFF.hs
--- a/Bio/Sequence/SFF.hs
+++ b/Bio/Sequence/SFF.hs
@@ -104,7 +104,6 @@
 
 -- trimming the flowgram is necessary, but how to deal with the shift in flow
 -- sequence - i.e. what to do when trimming "splits" a flow into trimmed/untrimmed bases?
-
 -- | Trim a read to specific sequence position, inclusive bounds
 -- The current implementation has the unintended side effect of 
 -- always trimming the flowgram down to a basecalled position.  
@@ -112,7 +111,8 @@
 -- since they need to have the same number of flows as given in 
 -- the 'CommmonHeader'.
 trimFromTo :: (Integral i) => i -> i -> ReadBlock -> ReadBlock
-trimFromTo (l+1) r rd = let 
+trimFromTo x r rd = let
+  l = x-1
   trim_seq = LB.drop (fromIntegral l) . LB.take (fromIntegral r)
   trim_seq' = B.drop (fromIntegral l) . B.take (fromIntegral r)
   trim_flw = B.drop ((2*) $ fromIntegral $ baseToFlowPos rd l) . B.take ((2*) $ fromIntegral $ baseToFlowPos rd r)
diff --git a/Bio/Sequence/SFF_filters.hs b/Bio/Sequence/SFF_filters.hs
--- a/Bio/Sequence/SFF_filters.hs
+++ b/Bio/Sequence/SFF_filters.hs
@@ -138,30 +138,5 @@
 rapid_adapter = "agtcgtggaggcaaggcacacagggatagg"  -- sea louse reads, key GACT
 ti_adapter_b  = "ctgagactgccaaggcacacagggggatagg"  -- sea bass and l.s.Ca
                  
-{- Email from Markus Grohme:
->> Here are the sequences as filed by 454 in their patent application:
->>> AdaptorA
->> CTGAGACAGGGAGGGAACAGATGGGACACGCAGGGATGAGATGG
->>> AdaptorB
->> CTGAGACACGCAACAGGGGATAGGCAAGGCACACAGGGGATAGG
->>
->> However, looking through some earlier project data I had, I also
->> retrieved the following (by simply making a consensus of
->> sequences that did not match the target genome anymore):
->>> 5prime454adaptor???
->> GCCTCCCTCGCGCCATCAGATCGTAGGCACCTGAAA
->>> 3prime454adaptor???
->> GCCTTGCCAGCCCGCTCAGATTGATGGTGCCTACAG
->>
->> I currently know one linker sequence (454/Roche also calls it spacer
->> for GS20 and FLX paired-end sequencing:
->>> flxlinker
->> GTTGGAACCGAAAGGGTTTGAATTCAAACCCTTTCGGTTCCAAC
->> For Titanium data using standard Roche protocol, you need to screen
->> for two linker sequences:
->>> titlinker1
->> TCGTATAACTTCGTATAATGTATGCTATACGAAGTTATTACG
->>> titlinker2
->> CGTAATAACTTCGTATAGCATACATTATACGAAGTTATACGA
 
--}
+
diff --git a/bio.cabal b/bio.cabal
--- a/bio.cabal
+++ b/bio.cabal
@@ -1,5 +1,5 @@
 Name:                bio
-Version:             0.5
+Version:             0.5.0.1
 License:             LGPL
 License-file:        LICENSE
 Cabal-Version:       >= 1.6