attoparsec 0.8.6.1 → 0.14.4
raw patch · 76 files changed
Files
- Data/Attoparsec.hs +11/−209
- Data/Attoparsec/ByteString.hs +232/−0
- Data/Attoparsec/ByteString/Char8.hs +581/−0
- Data/Attoparsec/ByteString/Internal.hs +590/−0
- Data/Attoparsec/ByteString/Lazy.hs +124/−0
- Data/Attoparsec/Char8.hs +10/−489
- Data/Attoparsec/Combinator.hs +163/−49
- Data/Attoparsec/FastSet.hs +0/−115
- Data/Attoparsec/Internal.hs +136/−418
- Data/Attoparsec/Internal/Types.hs +202/−121
- Data/Attoparsec/Lazy.hs +4/−64
- Data/Attoparsec/Number.hs +20/−1
- Data/Attoparsec/Text.hs +502/−0
- Data/Attoparsec/Text/Internal.hs +549/−0
- Data/Attoparsec/Text/Lazy.hs +115/−0
- Data/Attoparsec/Types.hs +20/−0
- Data/Attoparsec/Zepto.hs +88/−46
- README.markdown +2/−8
- attoparsec.cabal +159/−40
- benchmarks/Aeson.hs +353/−0
- benchmarks/Benchmarks.hs +126/−0
- benchmarks/Common.hs +47/−0
- benchmarks/Genome.hs +75/−0
- benchmarks/HeadersByteString.hs +36/−0
- benchmarks/HeadersByteString/Atto.hs +57/−0
- benchmarks/HeadersText.hs +56/−0
- benchmarks/Links.hs +63/−0
- benchmarks/Numbers.hs +81/−0
- benchmarks/Sets.hs +21/−0
- benchmarks/TextFastSet.hs +121/−0
- benchmarks/Tiny.hs +0/−31
- benchmarks/Warp.hs +16/−0
- benchmarks/http-request.txt +9/−0
- benchmarks/http-response.txt +14/−0
- benchmarks/json-data/example.json +88/−0
- benchmarks/json-data/geometry.json +1/−0
- benchmarks/json-data/integers.json +1/−0
- benchmarks/json-data/jp10.json +1/−0
- benchmarks/json-data/jp100.json +1/−0
- benchmarks/json-data/jp50.json +1/−0
- benchmarks/json-data/numbers.json +1/−0
- benchmarks/json-data/twitter1.json +1/−0
- benchmarks/json-data/twitter10.json +1/−0
- benchmarks/json-data/twitter100.json +1/−0
- benchmarks/json-data/twitter20.json +1/−0
- benchmarks/json-data/twitter50.json +1/−0
- benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hs +72/−0
- benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hs +172/−0
- changelog.md +136/−0
- examples/Atto_RFC2616.hs +45/−0
- examples/Makefile +6/−2
- examples/Parsec_RFC2616.hs +9/−6
- examples/RFC2616.hs +26/−51
- examples/TestRFC2616.hs +0/−37
- examples/rfc2616.c +27/−21
- internal/Data/Attoparsec/ByteString/Buffer.hs +157/−0
- internal/Data/Attoparsec/ByteString/FastSet.hs +112/−0
- internal/Data/Attoparsec/Internal/Compat.hs +27/−0
- internal/Data/Attoparsec/Internal/Fhthagn.hs +18/−0
- internal/Data/Attoparsec/Text/Buffer.hs +235/−0
- internal/Data/Attoparsec/Text/FastSet.hs +121/−0
- tests/Makefile +0/−14
- tests/QC.hs +13/−110
- tests/QC/Buffer.hs +111/−0
- tests/QC/ByteString.hs +214/−0
- tests/QC/Combinator.hs +52/−0
- tests/QC/Common.hs +113/−0
- tests/QC/IPv6/Internal.hs +316/−0
- tests/QC/IPv6/Types.hs +29/−0
- tests/QC/Rechunked.hs +56/−0
- tests/QC/Simple.hs +37/−0
- tests/QC/Text.hs +203/−0
- tests/QC/Text/FastSet.hs +15/−0
- tests/QC/Text/Regressions.hs +54/−0
- tests/QCSupport.hs +0/−52
- tests/TestFastSet.hs +0/−25
Data/Attoparsec.hs view
@@ -1,221 +1,23 @@ -- | -- Module : Data.Attoparsec--- Copyright : Bryan O'Sullivan 2007-2011+-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3--- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown ----- Simple, efficient combinator parsing for 'B.ByteString' strings,--- loosely based on the Parsec library.+-- Simple, efficient combinator parsing for+-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec+-- library.+--+-- This module is deprecated. Use "Data.Attoparsec.ByteString"+-- instead. module Data.Attoparsec+ {-# DEPRECATED "This module will be removed in the next major release." #-} (- -- * Differences from Parsec- -- $parsec-- -- * Incremental input- -- $incremental-- -- * Performance considerations- -- $performance-- -- * Parser types- I.Parser- , Result(..)-- -- ** Typeclass instances- -- $instances-- -- * Running parsers- , parse- , feed- , I.parseOnly- , parseWith- , parseTest-- -- ** Result conversion- , maybeResult- , eitherResult-- -- * Combinators- , (I.<?>)- , I.try- , module Data.Attoparsec.Combinator-- -- * Parsing individual bytes- , I.word8- , I.anyWord8- , I.notWord8- , I.satisfy- , I.satisfyWith- , I.skip-- -- ** Byte classes- , I.inClass- , I.notInClass-- -- * Efficient string handling- , I.string- , I.skipWhile- , I.take- , I.scan- , I.takeWhile- , I.takeWhile1- , I.takeTill-- -- ** Consume all remaining input- , I.takeByteString- , I.takeLazyByteString-- -- * State observation and manipulation functions- , I.endOfInput- , I.atEnd+ module Data.Attoparsec.ByteString ) where -import Data.Attoparsec.Combinator-import qualified Data.Attoparsec.Internal as I-import qualified Data.ByteString as B-import Data.Attoparsec.Internal (Result(..), parse)---- $parsec------ Compared to Parsec 3, Attoparsec makes several tradeoffs. It is--- not intended for, or ideal for, all possible uses.------ * While Attoparsec can consume input incrementally, Parsec cannot.--- Incremental input is a huge deal for efficient and secure network--- and system programming, since it gives much more control to users--- of the library over matters such as resource usage and the I/O--- model to use.------ * Much of the performance advantage of Attoparsec is gained via--- high-performance parsers such as 'I.takeWhile' and 'I.string'.--- If you use complicated combinators that return lists of bytes or--- characters, there is less performance difference between the two--- libraries.------ * Unlike Parsec 3, Attoparsec does not support being used as a--- monad transformer.------ * Attoparsec is specialised to deal only with strict 'B.ByteString'--- input. Efficiency concerns rule out both lists and lazy--- bytestrings. The usual use for lazy bytestrings would be to--- allow consumption of very large input without a large footprint.--- For this need, Attoparsec's incremental input provides an--- excellent substitute, with much more control over when input--- takes place. If you must use lazy bytestrings, see the 'Lazy'--- module, which feeds lazy chunks to a regular parser.------ * Parsec parsers can produce more helpful error messages than--- Attoparsec parsers. This is a matter of focus: Attoparsec avoids--- the extra book-keeping in favour of higher performance.---- $incremental------ Attoparsec supports incremental input, meaning that you can feed it--- a bytestring that represents only part of the expected total amount--- of data to parse. If your parser reaches the end of a fragment of--- input and could consume more input, it will suspend parsing and--- return a 'Partial' continuation.------ Supplying the 'Partial' continuation with another bytestring will--- resume parsing at the point where it was suspended. You must be--- prepared for the result of the resumed parse to be another--- 'Partial' continuation.------ To indicate that you have no more input, supply the 'Partial'--- continuation with an empty bytestring.------ Remember that some parsing combinators will not return a result--- until they reach the end of input. They may thus cause 'Partial'--- results to be returned.------ If you do not need support for incremental input, consider using--- the 'I.parseOnly' function to run your parser. It will never--- prompt for more input.---- $performance------ If you write an Attoparsec-based parser carefully, it can be--- realistic to expect it to perform within a factor of 2 of a--- hand-rolled C parser (measuring megabytes parsed per second).------ To actually achieve high performance, there are a few guidelines--- that it is useful to follow.------ Use the 'B.ByteString'-oriented parsers whenever possible,--- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyWord8'. There is--- about a factor of 100 difference in performance between the two--- kinds of parser.------ For very simple byte-testing predicates, write them by hand instead--- of using 'I.inClass' or 'I.notInClass'. For instance, both of--- these predicates test for an end-of-line byte, but the first is--- much faster than the second:------ >endOfLine_fast w = w == 13 || w == 10--- >endOfLine_slow = inClass "\r\n"------ Make active use of benchmarking and profiling tools to measure,--- find the problems with, and improve the performance of your parser.---- $instances------ The 'I.Parser' type is an instance of the following classes:------ * 'Monad', where 'fail' throws an exception (i.e. fails) with an--- error message.------ * 'Functor' and 'Applicative', which follow the usual definitions.------ * 'MonadPlus', where 'mzero' fails (with no error message) and--- 'mplus' executes the right-hand parser if the left-hand one--- fails.------ * 'Alternative', which follows 'MonadPlus'.------ The 'Result' type is an instance of 'Functor', where 'fmap'--- transforms the value in a 'Done' result.---- | If a parser has returned a 'Partial' result, supply it with more--- input.-feed :: Result r -> B.ByteString -> Result r-feed f@(Fail _ _ _) _ = f-feed (Partial k) d = k d-feed (Done bs r) d = Done (B.append bs d) r-{-# INLINE feed #-}---- | Run a parser and print its result to standard output.-parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO ()-parseTest p s = print (parse p s)---- | Run a parser with an initial input string, and a monadic action--- that can supply more input if needed.-parseWith :: Monad m =>- (m B.ByteString)- -- ^ An action that will be executed to provide the parser- -- with more input, if necessary. The action must return an- -- 'B.empty' string when there is no more input available.- -> I.Parser a- -> B.ByteString- -- ^ Initial input for the parser.- -> m (Result a)-parseWith refill p s = step $ parse p s- where step (Partial k) = (step . k) =<< refill- step r = return r-{-# INLINE parseWith #-}---- | Convert a 'Result' value to a 'Maybe' value. A 'Partial' result--- is treated as failure.-maybeResult :: Result r -> Maybe r-maybeResult (Done _ r) = Just r-maybeResult _ = Nothing---- | Convert a 'Result' value to an 'Either' value. A 'Partial' result--- is treated as failure.-eitherResult :: Result r -> Either String r-eitherResult (Done _ r) = Right r-eitherResult (Fail _ _ msg) = Left msg-eitherResult _ = Left "Result: incomplete input"+import Data.Attoparsec.ByteString
+ Data/Attoparsec/ByteString.hs view
@@ -0,0 +1,232 @@+{-# LANGUAGE CPP #-}+#if __GLASGOW_HASKELL__ >= 702+{-# LANGUAGE Trustworthy #-}+#endif+-- |+-- Module : Data.Attoparsec.ByteString+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient combinator parsing for 'B.ByteString' strings,+-- loosely based on the Parsec library.++module Data.Attoparsec.ByteString+ (+ -- * Differences from Parsec+ -- $parsec++ -- * Incremental input+ -- $incremental++ -- * Performance considerations+ -- $performance++ -- * Parser types+ I.Parser+ , Result+ , T.IResult(..)+ , I.compareResults++ -- * Running parsers+ , parse+ , feed+ , I.parseOnly+ , parseWith+ , parseTest++ -- ** Result conversion+ , maybeResult+ , eitherResult++ -- * Parsing individual bytes+ , I.word8+ , I.anyWord8+ , I.notWord8+ , I.satisfy+ , I.satisfyWith+ , I.skip++ -- ** Lookahead+ , I.peekWord8+ , I.peekWord8'++ -- ** Byte classes+ , I.inClass+ , I.notInClass++ -- * Efficient string handling+ , I.string+ , I.skipWhile+ , I.take+ , I.scan+ , I.runScanner+ , I.takeWhile+ , I.takeWhile1+ , I.takeWhileIncluding+ , I.takeTill+ , I.getChunk++ -- ** Consume all remaining input+ , I.takeByteString+ , I.takeLazyByteString++ -- * Combinators+ , try+ , (<?>)+ , choice+ , count+ , option+ , many'+ , many1+ , many1'+ , manyTill+ , manyTill'+ , sepBy+ , sepBy'+ , sepBy1+ , sepBy1'+ , skipMany+ , skipMany1+ , eitherP+ , I.match+ -- * State observation and manipulation functions+ , I.endOfInput+ , I.atEnd+ ) where++import Data.Attoparsec.Combinator+import Data.List (intercalate)+import qualified Data.Attoparsec.ByteString.Internal as I+import qualified Data.Attoparsec.Internal as I+import qualified Data.ByteString as B+import Data.Attoparsec.ByteString.Internal (Result, parse)+import qualified Data.Attoparsec.Internal.Types as T++-- $parsec+--+-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is+-- not intended for, or ideal for, all possible uses.+--+-- * While attoparsec can consume input incrementally, Parsec cannot.+-- Incremental input is a huge deal for efficient and secure network+-- and system programming, since it gives much more control to users+-- of the library over matters such as resource usage and the I/O+-- model to use.+--+-- * Much of the performance advantage of attoparsec is gained via+-- high-performance parsers such as 'I.takeWhile' and 'I.string'.+-- If you use complicated combinators that return lists of bytes or+-- characters, there is less performance difference between the two+-- libraries.+--+-- * Unlike Parsec 3, attoparsec does not support being used as a+-- monad transformer.+--+-- * attoparsec is specialised to deal only with strict 'B.ByteString'+-- input. Efficiency concerns rule out both lists and lazy+-- bytestrings. The usual use for lazy bytestrings would be to+-- allow consumption of very large input without a large footprint.+-- For this need, attoparsec's incremental input provides an+-- excellent substitute, with much more control over when input+-- takes place. If you must use lazy bytestrings, see the+-- "Data.Attoparsec.ByteString.Lazy" module, which feeds lazy chunks+-- to a regular parser.+--+-- * Parsec parsers can produce more helpful error messages than+-- attoparsec parsers. This is a matter of focus: attoparsec avoids+-- the extra book-keeping in favour of higher performance.++-- $incremental+--+-- attoparsec supports incremental input, meaning that you can feed it+-- a bytestring that represents only part of the expected total amount+-- of data to parse. If your parser reaches the end of a fragment of+-- input and could consume more input, it will suspend parsing and+-- return a 'T.Partial' continuation.+--+-- Supplying the 'T.Partial' continuation with a bytestring will+-- resume parsing at the point where it was suspended, with the+-- bytestring you supplied used as new input at the end of the+-- existing input. You must be prepared for the result of the resumed+-- parse to be another 'T.Partial' continuation.+--+-- To indicate that you have no more input, supply the 'T.Partial'+-- continuation with an empty bytestring.+--+-- Remember that some parsing combinators will not return a result+-- until they reach the end of input. They may thus cause 'T.Partial'+-- results to be returned.+--+-- If you do not need support for incremental input, consider using+-- the 'I.parseOnly' function to run your parser. It will never+-- prompt for more input.+--+-- /Note/: incremental input does /not/ imply that attoparsec will+-- release portions of its internal state for garbage collection as it+-- proceeds. Its internal representation is equivalent to a single+-- 'ByteString': if you feed incremental input to a parser, it will+-- require memory proportional to the amount of input you supply.+-- (This is necessary to support arbitrary backtracking.)++-- $performance+--+-- If you write an attoparsec-based parser carefully, it can be+-- realistic to expect it to perform similarly to a hand-rolled C+-- parser (measuring megabytes parsed per second).+--+-- To actually achieve high performance, there are a few guidelines+-- that it is useful to follow.+--+-- Use the 'B.ByteString'-oriented parsers whenever possible,+-- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyWord8'. There is+-- about a factor of 100 difference in performance between the two+-- kinds of parser.+--+-- For very simple byte-testing predicates, write them by hand instead+-- of using 'I.inClass' or 'I.notInClass'. For instance, both of+-- these predicates test for an end-of-line byte, but the first is+-- much faster than the second:+--+-- >endOfLine_fast w = w == 13 || w == 10+-- >endOfLine_slow = inClass "\r\n"+--+-- Make active use of benchmarking and profiling tools to measure,+-- find the problems with, and improve the performance of your parser.++-- | Run a parser and print its result to standard output.+parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO ()+parseTest p s = print (parse p s)++-- | Run a parser with an initial input string, and a monadic action+-- that can supply more input if needed.+parseWith :: Monad m =>+ (m B.ByteString)+ -- ^ An action that will be executed to provide the parser+ -- with more input, if necessary. The action must return an+ -- 'B.empty' string when there is no more input available.+ -> I.Parser a+ -> B.ByteString+ -- ^ Initial input for the parser.+ -> m (Result a)+parseWith refill p s = step $ parse p s+ where step (T.Partial k) = (step . k) =<< refill+ step r = return r+{-# INLINE parseWith #-}++-- | Convert a 'Result' value to a 'Maybe' value. A 'T.Partial' result+-- is treated as failure.+maybeResult :: Result r -> Maybe r+maybeResult (T.Done _ r) = Just r+maybeResult _ = Nothing++-- | Convert a 'Result' value to an 'Either' value. A 'T.Partial'+-- result is treated as failure.+eitherResult :: Result r -> Either String r+eitherResult (T.Done _ r) = Right r+eitherResult (T.Fail _ [] msg) = Left msg+eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)+eitherResult _ = Left "Result: incomplete input"
+ Data/Attoparsec/ByteString/Char8.hs view
@@ -0,0 +1,581 @@+{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeFamilies,+ TypeSynonymInstances, GADTs #-}+#if __GLASGOW_HASKELL__ >= 702+{-# LANGUAGE Trustworthy #-} -- Imports internal modules+#endif+{-# OPTIONS_GHC -fno-warn-orphans -fno-warn-warnings-deprecations #-}++-- |+-- Module : Data.Attoparsec.ByteString.Char8+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient, character-oriented combinator parsing for+-- 'B.ByteString' strings, loosely based on the Parsec library.++module Data.Attoparsec.ByteString.Char8+ (+ -- * Character encodings+ -- $encodings++ -- * Parser types+ Parser+ , A.Result+ , A.IResult(..)+ , I.compareResults++ -- * Running parsers+ , A.parse+ , A.feed+ , A.parseOnly+ , A.parseWith+ , A.parseTest++ -- ** Result conversion+ , A.maybeResult+ , A.eitherResult++ -- * Parsing individual characters+ , char+ , char8+ , anyChar+ , notChar+ , satisfy++ -- ** Lookahead+ , peekChar+ , peekChar'++ -- ** Special character parsers+ , digit+ , letter_iso8859_15+ , letter_ascii+ , space++ -- ** Fast predicates+ , isDigit+ , isDigit_w8+ , isAlpha_iso8859_15+ , isAlpha_ascii+ , isSpace+ , isSpace_w8++ -- *** Character classes+ , inClass+ , notInClass++ -- * Efficient string handling+ , I.string+ , I.stringCI+ , skipSpace+ , skipWhile+ , I.take+ , scan+ , takeWhile+ , takeWhile1+ , takeTill++ -- ** String combinators+ -- $specalt+ , (.*>)+ , (<*.)++ -- ** Consume all remaining input+ , I.takeByteString+ , I.takeLazyByteString++ -- * Text parsing+ , I.endOfLine+ , isEndOfLine+ , isHorizontalSpace++ -- * Numeric parsers+ , decimal+ , hexadecimal+ , signed+ , double+ , Number(..)+ , number+ , rational+ , scientific++ -- * Combinators+ , try+ , (<?>)+ , choice+ , count+ , option+ , many'+ , many1+ , many1'+ , manyTill+ , manyTill'+ , sepBy+ , sepBy'+ , sepBy1+ , sepBy1'+ , skipMany+ , skipMany1+ , eitherP+ , I.match+ -- * State observation and manipulation functions+ , I.endOfInput+ , I.atEnd+ ) where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative (pure, (*>), (<*), (<$>))+import Data.Word (Word)+#endif+import Control.Applicative ((<|>))+import Control.Monad (void, when)+import Data.Attoparsec.ByteString.FastSet (charClass, memberChar)+import Data.Attoparsec.ByteString.Internal (Parser)+import Data.Attoparsec.Combinator+import Data.Attoparsec.Number (Number(..))+import Data.Bits (Bits, (.|.), shiftL)+import Data.ByteString.Internal (c2w, w2c)+import Data.Int (Int8, Int16, Int32, Int64)+import Data.String (IsString(..))+import Data.Scientific (Scientific)+import qualified Data.Scientific as Sci+import Data.Word (Word8, Word16, Word32, Word64)+import Prelude hiding (takeWhile)+import qualified Data.Attoparsec.ByteString as A+import qualified Data.Attoparsec.ByteString.Internal as I+import qualified Data.Attoparsec.Internal as I+import qualified Data.ByteString as B8+import qualified Data.ByteString.Char8 as B++instance (a ~ B.ByteString) => IsString (Parser a) where+ fromString = I.string . B.pack++-- $encodings+--+-- This module is intended for parsing text that is+-- represented using an 8-bit character set, e.g. ASCII or+-- ISO-8859-15. It /does not/ make any attempt to deal with character+-- encodings, multibyte characters, or wide characters. In+-- particular, all attempts to use characters above code point U+00FF+-- will give wrong answers.+--+-- Code points below U+0100 are simply translated to and from their+-- numeric values, so e.g. the code point U+00A4 becomes the byte+-- @0xA4@ (which is the Euro symbol in ISO-8859-15, but the generic+-- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF+-- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.++-- | Consume input as long as the predicate returns 'True', and return+-- the consumed input.+--+-- This parser requires the predicate to succeed on at least one byte+-- of input: it will fail if the predicate never returns 'True' or if+-- there is no input left.+takeWhile1 :: (Char -> Bool) -> Parser B.ByteString+takeWhile1 p = I.takeWhile1 (p . w2c)+{-# INLINE takeWhile1 #-}++-- | The parser @satisfy p@ succeeds for any byte for which the+-- predicate @p@ returns 'True'. Returns the byte that is actually+-- parsed.+--+-- >digit = satisfy isDigit+-- > where isDigit c = c >= '0' && c <= '9'+satisfy :: (Char -> Bool) -> Parser Char+satisfy = I.satisfyWith w2c+{-# INLINE satisfy #-}++-- | Match a letter, in the ISO-8859-15 encoding.+letter_iso8859_15 :: Parser Char+letter_iso8859_15 = satisfy isAlpha_iso8859_15 <?> "letter_iso8859_15"+{-# INLINE letter_iso8859_15 #-}++-- | Match a letter, in the ASCII encoding.+letter_ascii :: Parser Char+letter_ascii = satisfy isAlpha_ascii <?> "letter_ascii"+{-# INLINE letter_ascii #-}++-- | A fast alphabetic predicate for the ISO-8859-15 encoding+--+-- /Note/: For all character encodings other than ISO-8859-15, and+-- almost all Unicode code points above U+00A3, this predicate gives+-- /wrong answers/.+isAlpha_iso8859_15 :: Char -> Bool+isAlpha_iso8859_15 c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') ||+ (c >= '\166' && moby c)+ where moby = notInClass "\167\169\171-\179\182\183\185\187\191\215\247"+ {-# NOINLINE moby #-}+{-# INLINE isAlpha_iso8859_15 #-}++-- | A fast alphabetic predicate for the ASCII encoding+--+-- /Note/: For all character encodings other than ASCII, and+-- almost all Unicode code points above U+007F, this predicate gives+-- /wrong answers/.+isAlpha_ascii :: Char -> Bool+isAlpha_ascii c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')+{-# INLINE isAlpha_ascii #-}++-- | Parse a single digit.+digit :: Parser Char+digit = satisfy isDigit <?> "digit"+{-# INLINE digit #-}++-- | A fast digit predicate.+isDigit :: Char -> Bool+isDigit c = c >= '0' && c <= '9'+{-# INLINE isDigit #-}++-- | A fast digit predicate.+isDigit_w8 :: Word8 -> Bool+isDigit_w8 w = w - 48 <= 9+{-# INLINE isDigit_w8 #-}++-- | Match any character.+anyChar :: Parser Char+anyChar = satisfy $ const True+{-# INLINE anyChar #-}++-- | Match any character, to perform lookahead. Returns 'Nothing' if+-- end of input has been reached. Does not consume any input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'many', because such parsers loop until a+-- failure occurs. Careless use will thus result in an infinite loop.+peekChar :: Parser (Maybe Char)+peekChar = (fmap w2c) `fmap` I.peekWord8+{-# INLINE peekChar #-}++-- | Match any character, to perform lookahead. Does not consume any+-- input, but will fail if end of input has been reached.+peekChar' :: Parser Char+peekChar' = w2c `fmap` I.peekWord8'+{-# INLINE peekChar' #-}++-- | Fast predicate for matching ASCII space characters.+--+-- /Note/: This predicate only gives correct answers for the ASCII+-- encoding. For instance, it does not recognise U+00A0 (non-breaking+-- space) as a space character, even though it is a valid ISO-8859-15+-- byte. For a Unicode-aware and only slightly slower predicate,+-- use 'Data.Char.isSpace'+isSpace :: Char -> Bool+isSpace c = (c == ' ') || ('\t' <= c && c <= '\r')+{-# INLINE isSpace #-}++-- | Fast 'Word8' predicate for matching ASCII space characters.+isSpace_w8 :: Word8 -> Bool+isSpace_w8 w = w == 32 || w - 9 <= 4+{-# INLINE isSpace_w8 #-}+++-- | Parse a space character.+--+-- /Note/: This parser only gives correct answers for the ASCII+-- encoding. For instance, it does not recognise U+00A0 (non-breaking+-- space) as a space character, even though it is a valid ISO-8859-15+-- byte.+space :: Parser Char+space = satisfy isSpace <?> "space"+{-# INLINE space #-}++-- | Match a specific character.+char :: Char -> Parser Char+char c = satisfy (== c) <?> [c]+{-# INLINE char #-}++-- | Match a specific character, but return its 'Word8' value.+char8 :: Char -> Parser Word8+char8 c = I.satisfy (== c2w c) <?> [c]+{-# INLINE char8 #-}++-- | Match any character except the given one.+notChar :: Char -> Parser Char+notChar c = satisfy (/= c) <?> "not " ++ [c]+{-# INLINE notChar #-}++-- | Match any character in a set.+--+-- >vowel = inClass "aeiou"+--+-- Range notation is supported.+--+-- >halfAlphabet = inClass "a-nA-N"+--+-- To add a literal \'-\' to a set, place it at the beginning or end+-- of the string.+inClass :: String -> Char -> Bool+inClass s = (`memberChar` mySet)+ where mySet = charClass s+{-# INLINE inClass #-}++-- | Match any character not in a set.+notInClass :: String -> Char -> Bool+notInClass s = not . inClass s+{-# INLINE notInClass #-}++-- | Consume input as long as the predicate returns 'True', and return+-- the consumed input.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'False' on the first byte of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'many', because such parsers loop until a+-- failure occurs. Careless use will thus result in an infinite loop.+takeWhile :: (Char -> Bool) -> Parser B.ByteString+takeWhile p = I.takeWhile (p . w2c)+{-# INLINE takeWhile #-}++-- | A stateful scanner. The predicate consumes and transforms a+-- state argument, and each transformed state is passed to successive+-- invocations of the predicate on each byte of the input until one+-- returns 'Nothing' or the input ends.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'Nothing' on the first byte of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'many', because such parsers loop until a+-- failure occurs. Careless use will thus result in an infinite loop.+scan :: s -> (s -> Char -> Maybe s) -> Parser B.ByteString+scan s0 p = I.scan s0 (\s -> p s . w2c)+{-# INLINE scan #-}++-- | Consume input as long as the predicate returns 'False'+-- (i.e. until it returns 'True'), and return the consumed input.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'True' on the first byte of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'many', because such parsers loop until a+-- failure occurs. Careless use will thus result in an infinite loop.+takeTill :: (Char -> Bool) -> Parser B.ByteString+takeTill p = I.takeTill (p . w2c)+{-# INLINE takeTill #-}++-- | Skip past input for as long as the predicate returns 'True'.+skipWhile :: (Char -> Bool) -> Parser ()+skipWhile p = I.skipWhile (p . w2c)+{-# INLINE skipWhile #-}++-- | Skip over white space.+skipSpace :: Parser ()+skipSpace = I.skipWhile isSpace_w8+{-# INLINE skipSpace #-}++-- $specalt+--+-- If you enable the @OverloadedStrings@ language extension, you can+-- use the '*>' and '<*' combinators to simplify the common task of+-- matching a statically known string, then immediately parsing+-- something else.+--+-- Instead of writing something like this:+--+-- @+--'I.string' \"foo\" '*>' wibble+-- @+--+-- Using @OverloadedStrings@, you can omit the explicit use of+-- 'I.string', and write a more compact version:+--+-- @+-- \"foo\" '*>' wibble+-- @+--+-- (Note: the '.*>' and '<*.' combinators that were originally+-- provided for this purpose are obsolete and unnecessary, and will be+-- removed in the next major version.)++-- | /Obsolete/. A type-specialized version of '*>' for+-- 'B.ByteString'. Use '*>' instead.+(.*>) :: B.ByteString -> Parser a -> Parser a+s .*> f = I.string s *> f+{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}++-- | /Obsolete/. A type-specialized version of '<*' for+-- 'B.ByteString'. Use '<*' instead.+(<*.) :: Parser a -> B.ByteString -> Parser a+f <*. s = f <* I.string s+{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}++-- | A predicate that matches either a carriage return @\'\\r\'@ or+-- newline @\'\\n\'@ character.+isEndOfLine :: Word8 -> Bool+isEndOfLine w = w == 13 || w == 10+{-# INLINE isEndOfLine #-}++-- | A predicate that matches either a space @\' \'@ or horizontal tab+-- @\'\\t\'@ character.+isHorizontalSpace :: Word8 -> Bool+isHorizontalSpace w = w == 32 || w == 9+{-# INLINE isHorizontalSpace #-}++-- | Parse and decode an unsigned hexadecimal number. The hex digits+-- @\'a\'@ through @\'f\'@ may be upper or lower case.+--+-- This parser does not accept a leading @\"0x\"@ string.+hexadecimal :: (Integral a, Bits a) => Parser a+hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit+ where+ isHexDigit w = (w >= 48 && w <= 57) ||+ (w >= 97 && w <= 102) ||+ (w >= 65 && w <= 70)+ step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)+ | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)+ | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)+{-# SPECIALISE hexadecimal :: Parser Int #-}+{-# SPECIALISE hexadecimal :: Parser Int8 #-}+{-# SPECIALISE hexadecimal :: Parser Int16 #-}+{-# SPECIALISE hexadecimal :: Parser Int32 #-}+{-# SPECIALISE hexadecimal :: Parser Int64 #-}+{-# SPECIALISE hexadecimal :: Parser Integer #-}+{-# SPECIALISE hexadecimal :: Parser Word #-}+{-# SPECIALISE hexadecimal :: Parser Word8 #-}+{-# SPECIALISE hexadecimal :: Parser Word16 #-}+{-# SPECIALISE hexadecimal :: Parser Word32 #-}+{-# SPECIALISE hexadecimal :: Parser Word64 #-}++-- | Parse and decode an unsigned decimal number.+decimal :: Integral a => Parser a+decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDigit_w8+ where step a w = a * 10 + fromIntegral (w - 48)+{-# SPECIALISE decimal :: Parser Int #-}+{-# SPECIALISE decimal :: Parser Int8 #-}+{-# SPECIALISE decimal :: Parser Int16 #-}+{-# SPECIALISE decimal :: Parser Int32 #-}+{-# SPECIALISE decimal :: Parser Int64 #-}+{-# SPECIALISE decimal :: Parser Integer #-}+{-# SPECIALISE decimal :: Parser Word #-}+{-# SPECIALISE decimal :: Parser Word8 #-}+{-# SPECIALISE decimal :: Parser Word16 #-}+{-# SPECIALISE decimal :: Parser Word32 #-}+{-# SPECIALISE decimal :: Parser Word64 #-}++-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign+-- character.+signed :: Num a => Parser a -> Parser a+{-# SPECIALISE signed :: Parser Int -> Parser Int #-}+{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-}+{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-}+{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-}+{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-}+{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-}+signed p = (negate <$> (char8 '-' *> p))+ <|> (char8 '+' *> p)+ <|> p++-- | Parse a rational number.+--+-- The syntax accepted by this parser is the same as for 'double'.+--+-- /Note/: this parser is not safe for use with inputs from untrusted+-- sources. An input with a suitably large exponent such as+-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,+-- resulting in what is effectively a denial-of-service attack.+--+-- In most cases, it is better to use 'double' or 'scientific'+-- instead.+rational :: Fractional a => Parser a+{-# SPECIALIZE rational :: Parser Double #-}+{-# SPECIALIZE rational :: Parser Float #-}+{-# SPECIALIZE rational :: Parser Rational #-}+{-# SPECIALIZE rational :: Parser Scientific #-}+rational = scientifically realToFrac++-- | Parse a 'Double'.+--+-- This parser accepts an optional leading sign character, followed by+-- at most one decimal digit. The syntax is similar to that accepted by+-- the 'read' function, with the exception that a trailing @\'.\'@ is+-- consumed.+--+-- === Examples+--+-- These examples use this helper:+--+-- @+-- r :: 'Parser' a -> 'Data.ByteString.ByteString' -> 'Data.Attoparsec.ByteString.Result' a+-- r p s = 'feed' ('Data.Attoparsec.parse' p s) 'mempty'+-- @+--+-- Examples with behaviour identical to 'read', if you feed an empty+-- continuation to the first result:+--+-- > double "3" == Done "" 3.0+-- > double "3.1" == Done "" 3.1+-- > double "3e4" == Done "" 30000.0+-- > double "3.1e4" == Done "" 31000.0+-- > double "3e" == Done "e" 3.0+--+-- Examples with behaviour identical to 'read':+--+-- > double ".3" == Fail ".3" _ _+-- > double "e3" == Fail "e3" _ _+--+-- Example of difference from 'read':+--+-- > double "3.foo" == Done "foo" 3.0+--+-- This function does not accept string representations of \"NaN\" or+-- \"Infinity\".+double :: Parser Double+double = scientifically Sci.toRealFloat++-- | Parse a number, attempting to preserve both speed and precision.+--+-- The syntax accepted by this parser is the same as for 'double'.+number :: Parser Number+number = scientifically $ \s ->+ let e = Sci.base10Exponent s+ c = Sci.coefficient s+ in if e >= 0+ then I (c * 10 ^ e)+ else D (Sci.toRealFloat s)+{-# DEPRECATED number "Use 'scientific' instead." #-}++-- | Parse a scientific number.+--+-- The syntax accepted by this parser is the same as for 'double'.+scientific :: Parser Scientific+scientific = scientifically id++-- A strict pair+data SP = SP !Integer {-# UNPACK #-}!Int++{-# INLINE scientifically #-}+scientifically :: (Scientific -> a) -> Parser a+scientifically h = do+ let minus = 45+ plus = 43+ sign <- I.peekWord8'+ let !positive = sign == plus || sign /= minus+ when (sign == plus || sign == minus) $+ void $ I.anyWord8++ n <- decimal++ let f fracDigits = SP (B8.foldl' step n fracDigits)+ (negate $ B8.length fracDigits)+ step a w = a * 10 + fromIntegral (w - 48)++ dotty <- I.peekWord8+ -- '.' -> ascii 46+ SP c e <- case dotty of+ Just 46 -> I.anyWord8 *> (f <$> I.takeWhile isDigit_w8)+ _ -> pure (SP n 0)++ let !signedCoeff | positive = c+ | otherwise = -c++ let littleE = 101+ bigE = 69+ (I.satisfy (\ex -> ex == littleE || ex == bigE) *>+ fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>+ return (h $ Sci.scientific signedCoeff e)
+ Data/Attoparsec/ByteString/Internal.hs view
@@ -0,0 +1,590 @@+{-# LANGUAGE BangPatterns, CPP, GADTs, OverloadedStrings, RankNTypes,+ RecordWildCards #-}+-- |+-- Module : Data.Attoparsec.ByteString.Internal+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient parser combinators for 'ByteString' strings,+-- loosely based on the Parsec library.++module Data.Attoparsec.ByteString.Internal+ (+ -- * Parser types+ Parser+ , Result++ -- * Running parsers+ , parse+ , parseOnly++ -- * Combinators+ , module Data.Attoparsec.Combinator++ -- * Parsing individual bytes+ , satisfy+ , satisfyWith+ , anyWord8+ , skip+ , word8+ , notWord8++ -- ** Lookahead+ , peekWord8+ , peekWord8'++ -- ** Byte classes+ , inClass+ , notInClass++ -- * Parsing more complicated structures+ , storable++ -- * Efficient string handling+ , skipWhile+ , string+ , stringCI+ , take+ , scan+ , runScanner+ , takeWhile+ , takeWhile1+ , takeWhileIncluding+ , takeTill+ , getChunk++ -- ** Consume all remaining input+ , takeByteString+ , takeLazyByteString++ -- * Utilities+ , endOfLine+ , endOfInput+ , match+ , atEnd+ ) where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((<$>))+#endif+import Control.Applicative ((<|>))+import Control.Monad (when)+import Data.Attoparsec.ByteString.Buffer (Buffer, buffer)+import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8)+import Data.Attoparsec.Combinator ((<?>))+import Data.Attoparsec.Internal+import Data.Attoparsec.Internal.Compat+import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)+import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)+import Data.ByteString (ByteString)+import Data.List (intercalate)+import Data.Word (Word8)+import Foreign.ForeignPtr (withForeignPtr)+import Foreign.Ptr (castPtr, minusPtr, plusPtr)+import Foreign.Storable (Storable(peek, sizeOf))+import Prelude hiding (getChar, succ, take, takeWhile)+import qualified Data.Attoparsec.ByteString.Buffer as Buf+import qualified Data.Attoparsec.Internal.Types as T+import qualified Data.ByteString as B8+import qualified Data.ByteString.Char8 as B+import qualified Data.ByteString.Internal as B+import qualified Data.ByteString.Lazy as L+import qualified Data.ByteString.Unsafe as B++type Parser = T.Parser ByteString+type Result = IResult ByteString+type Failure r = T.Failure ByteString Buffer r+type Success a r = T.Success ByteString Buffer a r++-- | The parser @satisfy p@ succeeds for any byte for which the+-- predicate @p@ returns 'True'. Returns the byte that is actually+-- parsed.+--+-- >digit = satisfy isDigit+-- > where isDigit w = w >= 48 && w <= 57+satisfy :: (Word8 -> Bool) -> Parser Word8+satisfy p = do+ h <- peekWord8'+ if p h+ then advance 1 >> return h+ else fail "satisfy"+{-# INLINE satisfy #-}++-- | The parser @skip p@ succeeds for any byte for which the predicate+-- @p@ returns 'True'.+--+-- >skipDigit = skip isDigit+-- > where isDigit w = w >= 48 && w <= 57+skip :: (Word8 -> Bool) -> Parser ()+skip p = do+ h <- peekWord8'+ if p h+ then advance 1+ else fail "skip"++-- | The parser @satisfyWith f p@ transforms a byte, and succeeds if+-- the predicate @p@ returns 'True' on the transformed value. The+-- parser returns the transformed byte that was parsed.+satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a+satisfyWith f p = do+ h <- peekWord8'+ let c = f h+ if p c+ then advance 1 >> return c+ else fail "satisfyWith"+{-# INLINE satisfyWith #-}++storable :: Storable a => Parser a+storable = hack undefined+ where+ hack :: Storable b => b -> Parser b+ hack dummy = do+ (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy)+ return . inlinePerformIO . withForeignPtr fp $ \p ->+ peek (castPtr $ p `plusPtr` o)++-- | Consume exactly @n@ bytes of input.+take :: Int -> Parser ByteString+take n0 = do+ let n = max n0 0+ s <- ensure n+ advance n >> return s+{-# INLINE take #-}++-- | @string s@ parses a sequence of bytes that identically match+-- @s@. Returns the parsed string (i.e. @s@). This parser consumes no+-- input if it fails (even if a partial match).+--+-- /Note/: The behaviour of this parser is different to that of the+-- similarly-named parser in Parsec, as this one is all-or-nothing.+-- To illustrate the difference, the following parser will fail under+-- Parsec given an input of @\"for\"@:+--+-- >string "foo" <|> string "for"+--+-- The reason for its failure is that the first branch is a+-- partial match, and will consume the letters @\'f\'@ and @\'o\'@+-- before failing. In attoparsec, the above parser will /succeed/ on+-- that input, because the failed first branch will consume nothing.+string :: ByteString -> Parser ByteString+string s = string_ (stringSuspended id) id s+{-# INLINE string #-}++-- ASCII-specific but fast, oh yes.+toLower :: Word8 -> Word8+toLower w | w >= 65 && w <= 90 = w + 32+ | otherwise = w++-- | Satisfy a literal string, ignoring case.+stringCI :: ByteString -> Parser ByteString+stringCI s = string_ (stringSuspended lower) lower s+ where lower = B8.map toLower+{-# INLINE stringCI #-}++string_ :: (forall r. ByteString -> ByteString -> Buffer -> Pos -> More+ -> Failure r -> Success ByteString r -> Result r)+ -> (ByteString -> ByteString)+ -> ByteString -> Parser ByteString+string_ suspended f s0 = T.Parser $ \t pos more lose succ ->+ let n = B.length s+ s = f s0+ in if lengthAtLeast pos n t+ then let t' = substring pos (Pos n) t+ in if s == f t'+ then succ t (pos + Pos n) more t'+ else lose t pos more [] "string"+ else let t' = Buf.unsafeDrop (fromPos pos) t+ in if f t' `B.isPrefixOf` s+ then suspended s (B.drop (B.length t') s) t pos more lose succ+ else lose t pos more [] "string"+{-# INLINE string_ #-}++stringSuspended :: (ByteString -> ByteString)+ -> ByteString -> ByteString -> Buffer -> Pos -> More+ -> Failure r+ -> Success ByteString r+ -> Result r+stringSuspended f s0 s t pos more lose succ =+ runParser (demandInput_ >>= go) t pos more lose succ+ where go s'0 = T.Parser $ \t' pos' more' lose' succ' ->+ let m = B.length s+ s' = f s'0+ n = B.length s'+ in if n >= m+ then if B.unsafeTake m s' == s+ then let o = Pos (B.length s0)+ in succ' t' (pos' + o) more'+ (substring pos' o t')+ else lose' t' pos' more' [] "string"+ else if s' == B.unsafeTake n s+ then stringSuspended f s0 (B.unsafeDrop n s)+ t' pos' more' lose' succ'+ else lose' t' pos' more' [] "string"++-- | Skip past input for as long as the predicate returns 'True'.+skipWhile :: (Word8 -> Bool) -> Parser ()+skipWhile p = go+ where+ go = do+ t <- B8.takeWhile p <$> get+ continue <- inputSpansChunks (B.length t)+ when continue go+{-# INLINE skipWhile #-}++-- | Consume input as long as the predicate returns 'False'+-- (i.e. until it returns 'True'), and return the consumed input.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'True' on the first byte of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+takeTill :: (Word8 -> Bool) -> Parser ByteString+takeTill p = takeWhile (not . p)+{-# INLINE takeTill #-}++-- | Consume input as long as the predicate returns 'True', and return+-- the consumed input.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'False' on the first byte of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+takeWhile :: (Word8 -> Bool) -> Parser ByteString+takeWhile p = do+ s <- B8.takeWhile p <$> get+ continue <- inputSpansChunks (B.length s)+ if continue+ then takeWhileAcc p [s]+ else return s+{-# INLINE takeWhile #-}++takeWhileAcc :: (Word8 -> Bool) -> [ByteString] -> Parser ByteString+takeWhileAcc p = go+ where+ go acc = do+ s <- B8.takeWhile p <$> get+ continue <- inputSpansChunks (B.length s)+ if continue+ then go (s:acc)+ else return $ concatReverse (s:acc)+{-# INLINE takeWhileAcc #-}++-- | Consume input until immediately after the predicate returns 'True', and return+-- the consumed input.+--+-- This parser will consume at least one 'Word8' or fail.+takeWhileIncluding :: (Word8 -> Bool) -> Parser B.ByteString+takeWhileIncluding p = do+ (s', t) <- B8.span p <$> get+ case B8.uncons t of+ -- Since we reached a break point and managed to get the next byte,+ -- input can not have been exhausted thus we succed and advance unconditionally.+ Just (h, _) -> do+ let s = s' `B8.snoc` h+ advance (B8.length s)+ return s+ -- The above isn't true so either we ran out of input or we need to process the next chunk.+ Nothing -> do+ continue <- inputSpansChunks (B8.length s')+ if continue+ then takeWhileIncAcc p [s']+ -- Our spec says that if we run out of input we fail.+ else fail "takeWhileIncluding reached end of input"+{-# INLINE takeWhileIncluding #-}++takeWhileIncAcc :: (Word8 -> Bool) -> [B.ByteString] -> Parser B.ByteString+takeWhileIncAcc p = go+ where+ go acc = do+ (s', t) <- B8.span p <$> get+ case B8.uncons t of+ Just (h, _) -> do+ let s = s' `B8.snoc` h+ advance (B8.length s)+ return (concatReverse $ s:acc)+ Nothing -> do+ continue <- inputSpansChunks (B8.length s')+ if continue+ then go (s':acc)+ else fail "takeWhileIncAcc reached end of input"+{-# INLINE takeWhileIncAcc #-}++takeRest :: Parser [ByteString]+takeRest = go []+ where+ go acc = do+ input <- wantInput+ if input+ then do+ s <- get+ advance (B.length s)+ go (s:acc)+ else return (reverse acc)++-- | Consume all remaining input and return it as a single string.+takeByteString :: Parser ByteString+takeByteString = B.concat `fmap` takeRest++-- | Consume all remaining input and return it as a single string.+takeLazyByteString :: Parser L.ByteString+takeLazyByteString = L.fromChunks `fmap` takeRest++-- | Return the rest of the current chunk without consuming anything.+--+-- If the current chunk is empty, then ask for more input.+-- If there is no more input, then return 'Nothing'+getChunk :: Parser (Maybe ByteString)+getChunk = do+ input <- wantInput+ if input+ then Just <$> get+ else return Nothing++data T s = T {-# UNPACK #-} !Int s++scan_ :: (s -> [ByteString] -> Parser r) -> s -> (s -> Word8 -> Maybe s)+ -> Parser r+scan_ f s0 p = go [] s0+ where+ go acc s1 = do+ let scanner bs = withPS bs $ \fp off len ->+ withForeignPtr fp $ \ptr0 -> do+ let start = ptr0 `plusPtr` off+ end = start `plusPtr` len+ inner ptr !s+ | ptr < end = do+ w <- peek ptr+ case p s w of+ Just s' -> inner (ptr `plusPtr` 1) s'+ _ -> done (ptr `minusPtr` start) s+ | otherwise = done (ptr `minusPtr` start) s+ done !i !s = return (T i s)+ inner start s1+ bs <- get+ let T i s' = inlinePerformIO $ scanner bs+ !h = B.unsafeTake i bs+ continue <- inputSpansChunks i+ if continue+ then go (h:acc) s'+ else f s' (h:acc)+{-# INLINE scan_ #-}++-- | A stateful scanner. The predicate consumes and transforms a+-- state argument, and each transformed state is passed to successive+-- invocations of the predicate on each byte of the input until one+-- returns 'Nothing' or the input ends.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'Nothing' on the first byte of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+scan :: s -> (s -> Word8 -> Maybe s) -> Parser ByteString+scan = scan_ $ \_ chunks -> return $! concatReverse chunks+{-# INLINE scan #-}++-- | Like 'scan', but generalized to return the final state of the+-- scanner.+runScanner :: s -> (s -> Word8 -> Maybe s) -> Parser (ByteString, s)+runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)+{-# INLINE runScanner #-}++-- | Consume input as long as the predicate returns 'True', and return+-- the consumed input.+--+-- This parser requires the predicate to succeed on at least one byte+-- of input: it will fail if the predicate never returns 'True' or if+-- there is no input left.+takeWhile1 :: (Word8 -> Bool) -> Parser ByteString+takeWhile1 p = do+ (`when` demandInput) =<< endOfChunk+ s <- B8.takeWhile p <$> get+ let len = B.length s+ if len == 0+ then fail "takeWhile1"+ else do+ advance len+ eoc <- endOfChunk+ if eoc+ then takeWhileAcc p [s]+ else return s+{-# INLINE takeWhile1 #-}++-- | Match any byte in a set.+--+-- >vowel = inClass "aeiou"+--+-- Range notation is supported.+--+-- >halfAlphabet = inClass "a-nA-N"+--+-- To add a literal @\'-\'@ to a set, place it at the beginning or end+-- of the string.+inClass :: String -> Word8 -> Bool+inClass s = (`memberWord8` mySet)+ where mySet = charClass s+ {-# NOINLINE mySet #-}+{-# INLINE inClass #-}++-- | Match any byte not in a set.+notInClass :: String -> Word8 -> Bool+notInClass s = not . inClass s+{-# INLINE notInClass #-}++-- | Match any byte.+anyWord8 :: Parser Word8+anyWord8 = satisfy $ const True+{-# INLINE anyWord8 #-}++-- | Match a specific byte.+word8 :: Word8 -> Parser Word8+word8 c = satisfy (== c) <?> show c+{-# INLINE word8 #-}++-- | Match any byte except the given one.+notWord8 :: Word8 -> Parser Word8+notWord8 c = satisfy (/= c) <?> "not " ++ show c+{-# INLINE notWord8 #-}++-- | Match any byte, to perform lookahead. Returns 'Nothing' if end of+-- input has been reached. Does not consume any input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+peekWord8 :: Parser (Maybe Word8)+peekWord8 = T.Parser $ \t pos@(Pos pos_) more _lose succ ->+ case () of+ _| pos_ < Buf.length t ->+ let !w = Buf.unsafeIndex t pos_+ in succ t pos more (Just w)+ | more == Complete ->+ succ t pos more Nothing+ | otherwise ->+ let succ' t' pos' more' = let !w = Buf.unsafeIndex t' pos_+ in succ t' pos' more' (Just w)+ lose' t' pos' more' = succ t' pos' more' Nothing+ in prompt t pos more lose' succ'+{-# INLINE peekWord8 #-}++-- | Match any byte, to perform lookahead. Does not consume any+-- input, but will fail if end of input has been reached.+peekWord8' :: Parser Word8+peekWord8' = T.Parser $ \t pos more lose succ ->+ if lengthAtLeast pos 1 t+ then succ t pos more (Buf.unsafeIndex t (fromPos pos))+ else let succ' t' pos' more' bs' = succ t' pos' more' $! B.unsafeHead bs'+ in ensureSuspended 1 t pos more lose succ'+{-# INLINE peekWord8' #-}++-- | Match either a single newline character @\'\\n\'@, or a carriage+-- return followed by a newline character @\"\\r\\n\"@.+endOfLine :: Parser ()+endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ())++-- | Terminal failure continuation.+failK :: Failure a+failK t (Pos pos) _more stack msg = Fail (Buf.unsafeDrop pos t) stack msg+{-# INLINE failK #-}++-- | Terminal success continuation.+successK :: Success a a+successK t (Pos pos) _more a = Done (Buf.unsafeDrop pos t) a+{-# INLINE successK #-}++-- | Run a parser.+parse :: Parser a -> ByteString -> Result a+parse m s = T.runParser m (buffer s) (Pos 0) Incomplete failK successK+{-# INLINE parse #-}++-- | Run a parser that cannot be resupplied via a 'Partial' result.+--+-- This function does not force a parser to consume all of its input.+-- Instead, any residual input will be discarded. To force a parser+-- to consume all of its input, use something like this:+--+-- @+--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')+-- @+parseOnly :: Parser a -> ByteString -> Either String a+parseOnly m s = case T.runParser m (buffer s) (Pos 0) Complete failK successK of+ Fail _ [] err -> Left err+ Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)+ Done _ a -> Right a+ _ -> error "parseOnly: impossible error!"+{-# INLINE parseOnly #-}++get :: Parser ByteString+get = T.Parser $ \t pos more _lose succ ->+ succ t pos more (Buf.unsafeDrop (fromPos pos) t)+{-# INLINE get #-}++endOfChunk :: Parser Bool+endOfChunk = T.Parser $ \t pos more _lose succ ->+ succ t pos more (fromPos pos == Buf.length t)+{-# INLINE endOfChunk #-}++inputSpansChunks :: Int -> Parser Bool+inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->+ let pos = pos_ + Pos i+ in if fromPos pos < Buf.length t || more == Complete+ then succ t pos more False+ else let lose' t' pos' more' = succ t' pos' more' False+ succ' t' pos' more' = succ t' pos' more' True+ in prompt t pos more lose' succ'+{-# INLINE inputSpansChunks #-}++advance :: Int -> Parser ()+advance n = T.Parser $ \t pos more _lose succ ->+ succ t (pos + Pos n) more ()+{-# INLINE advance #-}++ensureSuspended :: Int -> Buffer -> Pos -> More+ -> Failure r+ -> Success ByteString r+ -> Result r+ensureSuspended n t pos more lose succ =+ runParser (demandInput >> go) t pos more lose succ+ where go = T.Parser $ \t' pos' more' lose' succ' ->+ if lengthAtLeast pos' n t'+ then succ' t' pos' more' (substring pos (Pos n) t')+ else runParser (demandInput >> go) t' pos' more' lose' succ'++-- | If at least @n@ elements of input are available, return the+-- current input, otherwise fail.+ensure :: Int -> Parser ByteString+ensure n = T.Parser $ \t pos more lose succ ->+ if lengthAtLeast pos n t+ then succ t pos more (substring pos (Pos n) t)+ -- The uncommon case is kept out-of-line to reduce code size:+ else ensureSuspended n t pos more lose succ+{-# INLINE ensure #-}++-- | Return both the result of a parse and the portion of the input+-- that was consumed while it was being parsed.+match :: Parser a -> Parser (ByteString, a)+match p = T.Parser $ \t pos more lose succ ->+ let succ' t' pos' more' a =+ succ t' pos' more' (substring pos (pos'-pos) t', a)+ in runParser p t pos more lose succ'++lengthAtLeast :: Pos -> Int -> Buffer -> Bool+lengthAtLeast (Pos pos) n bs = Buf.length bs >= pos + n+{-# INLINE lengthAtLeast #-}++substring :: Pos -> Pos -> Buffer -> ByteString+substring (Pos pos) (Pos n) = Buf.substring pos n+{-# INLINE substring #-}
+ Data/Attoparsec/ByteString/Lazy.hs view
@@ -0,0 +1,124 @@+{-# LANGUAGE CPP #-}+#if __GLASGOW_HASKELL__ >= 702+{-# LANGUAGE Trustworthy #-} -- Imports internal modules+#endif++-- |+-- Module : Data.Attoparsec.ByteString.Lazy+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient combinator parsing that can consume lazy+-- 'ByteString' strings, loosely based on the Parsec library.+--+-- This is essentially the same code as in the 'Data.Attoparsec'+-- module, only with a 'parse' function that can consume a lazy+-- 'ByteString' incrementally, and a 'Result' type that does not allow+-- more input to be fed in. Think of this as suitable for use with a+-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.+--+-- /Note:/ The various parser functions and combinators such as+-- 'string' still expect /strict/ 'B.ByteString' parameters, and+-- return strict 'B.ByteString' results. Behind the scenes, strict+-- 'B.ByteString' values are still used internally to store parser+-- input and manipulate it efficiently.++module Data.Attoparsec.ByteString.Lazy+ (+ Result(..)+ , module Data.Attoparsec.ByteString+ -- * Running parsers+ , parse+ , parseOnly+ , parseTest+ -- ** Result conversion+ , maybeResult+ , eitherResult+ ) where++import Control.DeepSeq (NFData(rnf))+import Data.ByteString.Lazy.Internal (ByteString(..), chunk)+import Data.List (intercalate)+import qualified Data.ByteString as B+import qualified Data.Attoparsec.ByteString as A+import qualified Data.Attoparsec.Internal.Types as T+import Data.Attoparsec.ByteString+ hiding (IResult(..), Result, eitherResult, maybeResult,+ parse, parseOnly, parseWith, parseTest)++-- | The result of a parse.+data Result r = Fail ByteString [String] String+ -- ^ The parse failed. The 'ByteString' is the input+ -- that had not yet been consumed when the failure+ -- occurred. The @[@'String'@]@ is a list of contexts+ -- in which the error occurred. The 'String' is the+ -- message describing the error, if any.+ | Done ByteString r+ -- ^ The parse succeeded. The 'ByteString' is the+ -- input that had not yet been consumed (if any) when+ -- the parse succeeded.++instance NFData r => NFData (Result r) where+ rnf (Fail bs ctxs msg) = rnfBS bs `seq` rnf ctxs `seq` rnf msg+ rnf (Done bs r) = rnfBS bs `seq` rnf r+ {-# INLINE rnf #-}++rnfBS :: ByteString -> ()+rnfBS (Chunk _ xs) = rnfBS xs+rnfBS Empty = ()+{-# INLINE rnfBS #-}++instance Show r => Show (Result r) where+ show (Fail bs stk msg) =+ "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg+ show (Done bs r) = "Done " ++ show bs ++ " " ++ show r++fmapR :: (a -> b) -> Result a -> Result b+fmapR _ (Fail st stk msg) = Fail st stk msg+fmapR f (Done bs r) = Done bs (f r)++instance Functor Result where+ fmap = fmapR++-- | Run a parser and return its result.+parse :: A.Parser a -> ByteString -> Result a+parse p s = case s of+ Chunk x xs -> go (A.parse p x) xs+ empty -> go (A.parse p B.empty) empty+ where+ go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg+ go (T.Done x r) ys = Done (chunk x ys) r+ go (T.Partial k) (Chunk y ys) = go (k y) ys+ go (T.Partial k) empty = go (k B.empty) empty++-- | Run a parser and print its result to standard output.+parseTest :: (Show a) => A.Parser a -> ByteString -> IO ()+parseTest p s = print (parse p s)++-- | Convert a 'Result' value to a 'Maybe' value.+maybeResult :: Result r -> Maybe r+maybeResult (Done _ r) = Just r+maybeResult _ = Nothing++-- | Convert a 'Result' value to an 'Either' value.+eitherResult :: Result r -> Either String r+eitherResult (Done _ r) = Right r+eitherResult (Fail _ [] msg) = Left msg+eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)++-- | Run a parser that cannot be resupplied via a 'T.Partial' result.+--+-- This function does not force a parser to consume all of its input.+-- Instead, any residual input will be discarded. To force a parser+-- to consume all of its input, use something like this:+--+-- @+--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')+-- @+parseOnly :: A.Parser a -> ByteString -> Either String a+parseOnly p = eitherResult . parse p+{-# INLINE parseOnly #-}
Data/Attoparsec/Char8.hs view
@@ -1,502 +1,23 @@-{-# LANGUAGE BangPatterns, FlexibleInstances #-}-{-# OPTIONS_GHC -fno-warn-orphans #-}- -- | -- Module : Data.Attoparsec.Char8--- Copyright : Bryan O'Sullivan 2007-2010+-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3--- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient, character-oriented combinator parsing for--- 'B.ByteString' strings, loosely based on the Parsec library.+-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec+-- library.+--+-- This module is deprecated. Use "Data.Attoparsec.ByteString.Char8"+-- instead. module Data.Attoparsec.Char8+ {-# DEPRECATED "This module will be removed in the next major release." #-} (- -- * Character encodings- -- $encodings-- -- * Parser types- Parser- , A.Result(..)-- -- * Running parsers- , A.parse- , A.feed- , A.parseOnly- , A.parseTest- , A.parseWith-- -- ** Result conversion- , A.maybeResult- , A.eitherResult-- -- * Combinators- , (I.<?>)- , I.try- , module Data.Attoparsec.Combinator-- -- * Parsing individual characters- , char- , char8- , anyChar- , notChar- , satisfy-- -- ** Special character parsers- , digit- , letter_iso8859_15- , letter_ascii- , space-- -- ** Fast predicates- , isDigit- , isDigit_w8- , isAlpha_iso8859_15- , isAlpha_ascii- , isSpace- , isSpace_w8-- -- *** Character classes- , inClass- , notInClass-- -- * Efficient string handling- , I.string- , stringCI- , skipSpace- , skipWhile- , I.take- , scan- , takeWhile- , takeWhile1- , takeTill-- -- ** Consume all remaining input- , I.takeByteString- , I.takeLazyByteString-- -- * Text parsing- , I.endOfLine- , isEndOfLine- , isHorizontalSpace-- -- * Numeric parsers- , decimal- , hexadecimal- , signed- , double- , Number(..)- , number- , rational-- -- * State observation and manipulation functions- , I.endOfInput- , I.atEnd+ module Data.Attoparsec.ByteString.Char8 ) where -import Control.Applicative ((*>), (<$>), (<|>))-import Data.Attoparsec.Combinator-import Data.Attoparsec.FastSet (charClass, memberChar)-import Data.Attoparsec.Internal (Parser, (<?>))-import Data.Attoparsec.Number (Number(..))-import Data.Bits (Bits, (.|.), shiftL)-import Data.ByteString.Internal (c2w, w2c)-import Data.Int (Int8, Int16, Int32, Int64)-import Data.Ratio ((%))-import Data.String (IsString(..))-import Data.Word (Word8, Word16, Word32, Word64, Word)-import Prelude hiding (takeWhile)-import qualified Data.Attoparsec as A-import qualified Data.Attoparsec.Internal as I-import qualified Data.ByteString as B8-import qualified Data.ByteString.Char8 as B--instance IsString (Parser B.ByteString) where- fromString = I.string . B.pack---- $encodings------ This module is intended for parsing text that is--- represented using an 8-bit character set, e.g. ASCII or--- ISO-8859-15. It /does not/ make any attempt to deal with character--- encodings, multibyte characters, or wide characters. In--- particular, all attempts to use characters above code point U+00FF--- will give wrong answers.------ Code points below U+0100 are simply translated to and from their--- numeric values, so e.g. the code point U+00A4 becomes the byte--- @0xA4@ (which is the Euro symbol in ISO-8859-15, but the generic--- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF--- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.---- ASCII-specific but fast, oh yes.-toLower :: Word8 -> Word8-toLower w | w >= 65 && w <= 90 = w + 32- | otherwise = w---- | Satisfy a literal string, ignoring case.-stringCI :: B.ByteString -> Parser B.ByteString-stringCI = I.stringTransform (B8.map toLower)-{-# INLINE stringCI #-}---- | Consume input as long as the predicate returns 'True', and return--- the consumed input.------ This parser requires the predicate to succeed on at least one byte--- of input: it will fail if the predicate never returns 'True' or if--- there is no input left.-takeWhile1 :: (Char -> Bool) -> Parser B.ByteString-takeWhile1 p = I.takeWhile1 (p . w2c)-{-# INLINE takeWhile1 #-}---- | The parser @satisfy p@ succeeds for any byte for which the--- predicate @p@ returns 'True'. Returns the byte that is actually--- parsed.------ >digit = satisfy isDigit--- > where isDigit c = c >= '0' && c <= '9'-satisfy :: (Char -> Bool) -> Parser Char-satisfy = I.satisfyWith w2c-{-# INLINE satisfy #-}---- | Match a letter, in the ISO-8859-15 encoding.-letter_iso8859_15 :: Parser Char-letter_iso8859_15 = satisfy isAlpha_iso8859_15 <?> "letter_iso8859_15"-{-# INLINE letter_iso8859_15 #-}---- | Match a letter, in the ASCII encoding.-letter_ascii :: Parser Char-letter_ascii = satisfy isAlpha_ascii <?> "letter_ascii"-{-# INLINE letter_ascii #-}---- | A fast alphabetic predicate for the ISO-8859-15 encoding------ /Note/: For all character encodings other than ISO-8859-15, and--- almost all Unicode code points above U+00A3, this predicate gives--- /wrong answers/.-isAlpha_iso8859_15 :: Char -> Bool-isAlpha_iso8859_15 c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') ||- (c >= '\166' && moby c)- where moby = notInClass "\167\169\171-\179\182\183\185\187\191\215\247"- {-# NOINLINE moby #-}-{-# INLINE isAlpha_iso8859_15 #-}---- | A fast alphabetic predicate for the ASCII encoding------ /Note/: For all character encodings other than ASCII, and--- almost all Unicode code points above U+007F, this predicate gives--- /wrong answers/.-isAlpha_ascii :: Char -> Bool-isAlpha_ascii c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')-{-# INLINE isAlpha_ascii #-}---- | Parse a single digit.-digit :: Parser Char-digit = satisfy isDigit <?> "digit"-{-# INLINE digit #-}---- | A fast digit predicate.-isDigit :: Char -> Bool-isDigit c = c >= '0' && c <= '9'-{-# INLINE isDigit #-}---- | A fast digit predicate.-isDigit_w8 :: Word8 -> Bool-isDigit_w8 w = w >= 48 && w <= 57-{-# INLINE isDigit_w8 #-}---- | Match any character.-anyChar :: Parser Char-anyChar = satisfy $ const True-{-# INLINE anyChar #-}---- | Fast predicate for matching ASCII space characters.------ /Note/: This predicate only gives correct answers for the ASCII--- encoding. For instance, it does not recognise U+00A0 (non-breaking--- space) as a space character, even though it is a valid ISO-8859-15--- byte. For a Unicode-aware and only slightly slower predicate,--- use 'Data.Char.isSpace'-isSpace :: Char -> Bool-isSpace c = (c == ' ') || ('\t' <= c && c <= '\r')-{-# INLINE isSpace #-}---- | Fast 'Word8' predicate for matching ASCII space characters.-isSpace_w8 :: Word8 -> Bool-isSpace_w8 w = (w == 32) || (9 <= w && w <= 13)-{-# INLINE isSpace_w8 #-}----- | Parse a space character.------ /Note/: This parser only gives correct answers for the ASCII--- encoding. For instance, it does not recognise U+00A0 (non-breaking--- space) as a space character, even though it is a valid ISO-8859-15--- byte.-space :: Parser Char-space = satisfy isSpace <?> "space"-{-# INLINE space #-}---- | Match a specific character.-char :: Char -> Parser Char-char c = satisfy (== c) <?> [c]-{-# INLINE char #-}---- | Match a specific character, but return its 'Word8' value.-char8 :: Char -> Parser Word8-char8 c = I.satisfy (== c2w c) <?> [c]-{-# INLINE char8 #-}---- | Match any character except the given one.-notChar :: Char -> Parser Char-notChar c = satisfy (/= c) <?> "not " ++ [c]-{-# INLINE notChar #-}---- | Match any character in a set.------ >vowel = inClass "aeiou"------ Range notation is supported.------ >halfAlphabet = inClass "a-nA-N"------ To add a literal \'-\' to a set, place it at the beginning or end--- of the string.-inClass :: String -> Char -> Bool-inClass s = (`memberChar` mySet)- where mySet = charClass s-{-# INLINE inClass #-}---- | Match any character not in a set.-notInClass :: String -> Char -> Bool-notInClass s = not . inClass s-{-# INLINE notInClass #-}---- | Consume input as long as the predicate returns 'True', and return--- the consumed input.------ This parser does not fail. It will return an empty string if the--- predicate returns 'False' on the first byte of input.------ /Note/: Because this parser does not fail, do not use it with--- combinators such as 'many', because such parsers loop until a--- failure occurs. Careless use will thus result in an infinite loop.-takeWhile :: (Char -> Bool) -> Parser B.ByteString-takeWhile p = I.takeWhile (p . w2c)-{-# INLINE takeWhile #-}---- | A stateful scanner. The predicate consumes and transforms a--- state argument, and each transformed state is passed to successive--- invocations of the predicate on each byte of the input until one--- returns 'Nothing' or the input ends.------ This parser does not fail. It will return an empty string if the--- predicate returns 'Nothing' on the first byte of input.------ /Note/: Because this parser does not fail, do not use it with--- combinators such as 'many', because such parsers loop until a--- failure occurs. Careless use will thus result in an infinite loop.-scan :: s -> (s -> Char -> Maybe s) -> Parser B.ByteString-scan s0 p = I.scan s0 (\s -> p s . w2c)-{-# INLINE scan #-}---- | Consume input as long as the predicate returns 'False'--- (i.e. until it returns 'True'), and return the consumed input.------ This parser does not fail. It will return an empty string if the--- predicate returns 'True' on the first byte of input.------ /Note/: Because this parser does not fail, do not use it with--- combinators such as 'many', because such parsers loop until a--- failure occurs. Careless use will thus result in an infinite loop.-takeTill :: (Char -> Bool) -> Parser B.ByteString-takeTill p = I.takeTill (p . w2c)-{-# INLINE takeTill #-}---- | Skip past input for as long as the predicate returns 'True'.-skipWhile :: (Char -> Bool) -> Parser ()-skipWhile p = I.skipWhile (p . w2c)-{-# INLINE skipWhile #-}---- | Skip over white space.-skipSpace :: Parser ()-skipSpace = I.skipWhile isSpace_w8-{-# INLINE skipSpace #-}---- | A predicate that matches either a carriage return @\'\\r\'@ or--- newline @\'\\n\'@ character.-isEndOfLine :: Word8 -> Bool-isEndOfLine w = w == 13 || w == 10-{-# INLINE isEndOfLine #-}---- | A predicate that matches either a space @\' \'@ or horizontal tab--- @\'\\t\'@ character.-isHorizontalSpace :: Word8 -> Bool-isHorizontalSpace w = w == 32 || w == 9-{-# INLINE isHorizontalSpace #-}---- | Parse and decode an unsigned hexadecimal number. The hex digits--- @\'a\'@ through @\'f\'@ may be upper or lower case.------ This parser does not accept a leading @\"0x\"@ string.-hexadecimal :: (Integral a, Bits a) => Parser a-hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit- where- isHexDigit w = (w >= 48 && w <= 57) ||- (w >= 97 && w <= 102) ||- (w >= 65 && w <= 90)- step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)- | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)- | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)-{-# SPECIALISE hexadecimal :: Parser Int #-}-{-# SPECIALISE hexadecimal :: Parser Int8 #-}-{-# SPECIALISE hexadecimal :: Parser Int16 #-}-{-# SPECIALISE hexadecimal :: Parser Int32 #-}-{-# SPECIALISE hexadecimal :: Parser Int64 #-}-{-# SPECIALISE hexadecimal :: Parser Integer #-}-{-# SPECIALISE hexadecimal :: Parser Word #-}-{-# SPECIALISE hexadecimal :: Parser Word8 #-}-{-# SPECIALISE hexadecimal :: Parser Word16 #-}-{-# SPECIALISE hexadecimal :: Parser Word32 #-}-{-# SPECIALISE hexadecimal :: Parser Word64 #-}---- | Parse and decode an unsigned decimal number.-decimal :: Integral a => Parser a-decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDig- where isDig w = w >= 48 && w <= 57- step a w = a * 10 + fromIntegral (w - 48)-{-# SPECIALISE decimal :: Parser Int #-}-{-# SPECIALISE decimal :: Parser Int8 #-}-{-# SPECIALISE decimal :: Parser Int16 #-}-{-# SPECIALISE decimal :: Parser Int32 #-}-{-# SPECIALISE decimal :: Parser Int64 #-}-{-# SPECIALISE decimal :: Parser Integer #-}-{-# SPECIALISE decimal :: Parser Word #-}-{-# SPECIALISE decimal :: Parser Word8 #-}-{-# SPECIALISE decimal :: Parser Word16 #-}-{-# SPECIALISE decimal :: Parser Word32 #-}-{-# SPECIALISE decimal :: Parser Word64 #-}---- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign--- character.-signed :: Num a => Parser a -> Parser a-{-# SPECIALISE signed :: Parser Int -> Parser Int #-}-{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-}-{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-}-{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-}-{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-}-{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-}-signed p = (negate <$> (char8 '-' *> p))- <|> (char8 '+' *> p)- <|> p---- | Parse a rational number.------ This parser accepts an optional leading sign character, followed by--- at least one decimal digit. The syntax similar to that accepted by--- the 'read' function, with the exception that a trailing @\'.\'@ or--- @\'e\'@ /not/ followed by a number is not consumed.------ Examples with behaviour identical to 'read', if you feed an empty--- continuation to the first result:------ >rational "3" == Done 3.0 ""--- >rational "3.1" == Done 3.1 ""--- >rational "3e4" == Done 30000.0 ""--- >rational "3.1e4" == Done 31000.0, ""---- Examples with behaviour identical to 'read':------ >rational ".3" == Fail "input does not start with a digit"--- >rational "e3" == Fail "input does not start with a digit"------ Examples of differences from 'read':------ >rational "3.foo" == Done 3.0 ".foo"--- >rational "3e" == Done 3.0 "e"------ This function does not accept string representations of \"NaN\" or--- \"Infinity\".-rational :: Fractional a => Parser a-{-# SPECIALIZE rational :: Parser Double #-}-{-# SPECIALIZE rational :: Parser Float #-}-{-# SPECIALIZE rational :: Parser Rational #-}-rational = floaty $ \real frac fracDenom -> fromRational $- real % 1 + frac % fracDenom---- | Parse a rational number.------ The syntax accepted by this parser is the same as for 'rational'.------ /Note/: This function is almost ten times faster than 'rational',--- but is slightly less accurate.------ The 'Double' type supports about 16 decimal places of accuracy.--- For 94.2% of numbers, this function and 'rational' give identical--- results, but for the remaining 5.8%, this function loses precision--- around the 15th decimal place. For 0.001% of numbers, this--- function will lose precision at the 13th or 14th decimal place.------ This function does not accept string representations of \"NaN\" or--- \"Infinity\".-double :: Parser Double-double = floaty asDouble--asDouble :: Integer -> Integer -> Integer -> Double-asDouble real frac fracDenom =- fromIntegral real + fromIntegral frac / fromIntegral fracDenom-{-# INLINE asDouble #-}---- | Parse a number, attempting to preserve both speed and precision.------ The syntax accepted by this parser is the same as for 'rational'.------ /Note/: This function is almost ten times faster than 'rational'.--- On integral inputs, it gives perfectly accurate answers, and on--- floating point inputs, it is slightly less accurate than--- 'rational'.------ This function does not accept string representations of \"NaN\" or--- \"Infinity\".-number :: Parser Number-number = floaty $ \real frac fracDenom ->- if frac == 0 && fracDenom == 0- then I real- else D (asDouble real frac fracDenom)-{-# INLINE number #-}--data T = T !Integer !Int--floaty :: Fractional a => (Integer -> Integer -> Integer -> a) -> Parser a-{-# INLINE floaty #-}-floaty f = do- let minus = 45- plus = 43- !positive <- ((== plus) <$> I.satisfy (\c -> c == minus || c == plus)) <|>- return True- real <- decimal- let tryFraction = do- let dot = 46- _ <- I.satisfy (==dot)- ds <- I.takeWhile isDigit_w8- case I.parseOnly decimal ds of- Right n -> return $ T n (B.length ds)- _ -> fail "no digits after decimal"- T fraction fracDigits <- tryFraction <|> return (T 0 0)- let littleE = 101- bigE = 69- e w = w == littleE || w == bigE- power <- (I.satisfy e *> signed decimal) <|> return (0::Int)- let n = if fracDigits == 0- then if power == 0- then fromIntegral real- else fromIntegral real * (10 ^^ power)- else if power == 0- then f real fraction (10 ^ fracDigits)- else f real fraction (10 ^ fracDigits) * (10 ^^ power)- return $ if positive- then n- else -n+import Data.Attoparsec.ByteString.Char8
Data/Attoparsec/Combinator.hs view
@@ -1,9 +1,12 @@ {-# LANGUAGE BangPatterns, CPP #-}+#if __GLASGOW_HASKELL__ >= 702+{-# LANGUAGE Trustworthy #-} -- Imports internal modules+#endif -- | -- Module : Data.Attoparsec.Combinator--- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2009-2010+-- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2015 -- License : BSD3--- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : portable@@ -11,42 +14,73 @@ -- Useful parser combinators, similar to those provided by Parsec. module Data.Attoparsec.Combinator (- choice+ -- * Combinators+ try+ , (<?>)+ , choice , count , option+ , many' , many1+ , many1' , manyTill+ , manyTill' , sepBy+ , sepBy' , sepBy1+ , sepBy1' , skipMany , skipMany1 , eitherP-- -- * Inlined implementations of existing functions- --- -- These are exact duplicates of functions already exported by the- -- 'Control.Applicative' module, but whose definitions are- -- inlined. In many cases, this leads to 2x performance- -- improvements.- , many+ , feed+ , satisfyElem+ , endOfInput+ , atEnd+ , lookAhead ) where -import Control.Applicative (Alternative, Applicative(..), empty, liftA2,- (<|>), (*>), (<$>))-#if __GLASGOW_HASKELL__ >= 700-import Data.Attoparsec.Internal.Types (Parser)-import qualified Data.Attoparsec.Zepto as Z+#if !MIN_VERSION_base(4,8,0)+import Control.Applicative (Applicative(..), (<$>))+import Data.Monoid (Monoid(mappend)) #endif+import Control.Applicative (Alternative(..), liftA2, many, (<|>))+import Control.Monad (MonadPlus(..))+import Data.Attoparsec.Internal.Types (Parser(..), IResult(..))+import Data.Attoparsec.Internal (endOfInput, atEnd, satisfyElem)+import Data.ByteString (ByteString)+import Data.Foldable (asum)+import Data.Text (Text)+import qualified Data.Attoparsec.Zepto as Z+import Prelude hiding (succ) +-- | Attempt a parse, and if it fails, rewind the input so that no+-- input appears to have been consumed.+--+-- This combinator is provided for compatibility with Parsec.+-- attoparsec parsers always backtrack on failure.+try :: Parser i a -> Parser i a+try = id+{-# INLINE try #-}++-- | Name the parser, in case failure occurs.+(<?>) :: Parser i a+ -> String -- ^ the name to use if parsing fails+ -> Parser i a+p <?> msg0 = Parser $ \t pos more lose succ ->+ let lose' t' pos' more' strs msg = lose t' pos' more' (msg0:strs) msg+ in runParser p t pos more lose' succ+{-# INLINE (<?>) #-}+infix 0 <?>+ -- | @choice ps@ tries to apply the actions in the list @ps@ in order, -- until one of them succeeds. Returns the value of the succeeding -- action. choice :: Alternative f => [f a] -> f a-choice = foldr (<|>) empty-#if __GLASGOW_HASKELL__ >= 700-{-# SPECIALIZE choice :: [Parser a] -> Parser a #-}+choice = asum+{-# SPECIALIZE choice :: [Parser ByteString a]+ -> Parser ByteString a #-}+{-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-} {-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-}-#endif -- | @option x p@ tries to apply action @p@. If @p@ fails without -- consuming input, it returns the value @x@, otherwise the value@@ -55,11 +89,30 @@ -- > priority = option 0 (digitToInt <$> digit) option :: Alternative f => a -> f a -> f a option x p = p <|> pure x-#if __GLASGOW_HASKELL__ >= 700-{-# SPECIALIZE option :: a -> Parser a -> Parser a #-}+{-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-}+{-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-} {-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-}-#endif +-- | A version of 'liftM2' that is strict in the result of its first+-- action.+liftM2' :: (Monad m) => (a -> b -> c) -> m a -> m b -> m c+liftM2' f a b = do+ !x <- a+ y <- b+ return (f x y)+{-# INLINE liftM2' #-}++-- | @many' p@ applies the action @p@ /zero/ or more times. Returns a+-- list of the returned values of @p@. The value returned by @p@ is+-- forced to WHNF.+--+-- > word = many' letter+many' :: (MonadPlus m) => m a -> m [a]+many' p = many_p+ where many_p = some_p `mplus` return []+ some_p = liftM2' (:) p many_p+{-# INLINE many' #-}+ -- | @many1 p@ applies the action @p@ /one/ or more times. Returns a -- list of the returned values of @p@. --@@ -68,61 +121,114 @@ many1 p = liftA2 (:) p (many p) {-# INLINE many1 #-} +-- | @many1' p@ applies the action @p@ /one/ or more times. Returns a+-- list of the returned values of @p@. The value returned by @p@ is+-- forced to WHNF.+--+-- > word = many1' letter+many1' :: (MonadPlus m) => m a -> m [a]+many1' p = liftM2' (:) p (many' p)+{-# INLINE many1' #-}+ -- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. ----- > commaSep p = p `sepBy` (symbol ",")+-- > commaSep p = p `sepBy` (char ',') sepBy :: Alternative f => f a -> f s -> f [a] sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure []-#if __GLASGOW_HASKELL__ >= 700-{-# SPECIALIZE sepBy :: Parser a -> Parser s -> Parser [a] #-}+{-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s+ -> Parser ByteString [a] #-}+{-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}-#endif +-- | @sepBy' p sep@ applies /zero/ or more occurrences of @p@, separated+-- by @sep@. Returns a list of the values returned by @p@. The value+-- returned by @p@ is forced to WHNF.+--+-- > commaSep p = p `sepBy'` (char ',')+sepBy' :: (MonadPlus m) => m a -> m s -> m [a]+sepBy' p s = scan `mplus` return []+ where scan = liftM2' (:) p ((s >> sepBy1' p s) `mplus` return [])+{-# SPECIALIZE sepBy' :: Parser ByteString a -> Parser ByteString s+ -> Parser ByteString [a] #-}+{-# SPECIALIZE sepBy' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}+{-# SPECIALIZE sepBy' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}+ -- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. ----- > commaSep p = p `sepBy` (symbol ",")+-- > commaSep p = p `sepBy1` (char ',') sepBy1 :: Alternative f => f a -> f s -> f [a] sepBy1 p s = scan where scan = liftA2 (:) p ((s *> scan) <|> pure [])-#if __GLASGOW_HASKELL__ >= 700-{-# SPECIALIZE sepBy1 :: Parser a -> Parser s -> Parser [a] #-}+{-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s+ -> Parser ByteString [a] #-}+{-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}-#endif +-- | @sepBy1' p sep@ applies /one/ or more occurrences of @p@, separated+-- by @sep@. Returns a list of the values returned by @p@. The value+-- returned by @p@ is forced to WHNF.+--+-- > commaSep p = p `sepBy1'` (char ',')+sepBy1' :: (MonadPlus m) => m a -> m s -> m [a]+sepBy1' p s = scan+ where scan = liftM2' (:) p ((s >> scan) `mplus` return [])+{-# SPECIALIZE sepBy1' :: Parser ByteString a -> Parser ByteString s+ -> Parser ByteString [a] #-}+{-# SPECIALIZE sepBy1' :: Parser Text a -> Parser Text s -> Parser Text [a] #-}+{-# SPECIALIZE sepBy1' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-}+ -- | @manyTill p end@ applies action @p@ /zero/ or more times until -- action @end@ succeeds, and returns the list of values returned by -- @p@. This can be used to scan comments: ----- > simpleComment = string "<!--" *> manyTill anyChar (try (string "-->"))+-- > simpleComment = string "<!--" *> manyTill anyChar (string "-->") ----- Note the overlapping parsers @anyChar@ and @string \"<!--\"@, and--- therefore the use of the 'try' combinator.+-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.+-- While this will work, it is not very efficient, as it will cause a+-- lot of backtracking.) manyTill :: Alternative f => f a -> f b -> f [a] manyTill p end = scan where scan = (end *> pure []) <|> liftA2 (:) p scan-#if __GLASGOW_HASKELL__ >= 700-{-# SPECIALIZE manyTill :: Parser a -> Parser b -> Parser [a] #-}+{-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b+ -> Parser ByteString [a] #-}+{-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-} {-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}-#endif +-- | @manyTill' p end@ applies action @p@ /zero/ or more times until+-- action @end@ succeeds, and returns the list of values returned by+-- @p@. This can be used to scan comments:+--+-- > simpleComment = string "<!--" *> manyTill' anyChar (string "-->")+--+-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@.+-- While this will work, it is not very efficient, as it will cause a+-- lot of backtracking.)+--+-- The value returned by @p@ is forced to WHNF.+manyTill' :: (MonadPlus m) => m a -> m b -> m [a]+manyTill' p end = scan+ where scan = (end >> return []) `mplus` liftM2' (:) p scan+{-# SPECIALIZE manyTill' :: Parser ByteString a -> Parser ByteString b+ -> Parser ByteString [a] #-}+{-# SPECIALIZE manyTill' :: Parser Text a -> Parser Text b -> Parser Text [a] #-}+{-# SPECIALIZE manyTill' :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-}+ -- | Skip zero or more instances of an action. skipMany :: Alternative f => f a -> f () skipMany p = scan where scan = (p *> scan) <|> pure ()-#if __GLASGOW_HASKELL__ >= 700-{-# SPECIALIZE skipMany :: Parser a -> Parser () #-}+{-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-}+{-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-} {-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-}-#endif -- | Skip one or more instances of an action. skipMany1 :: Alternative f => f a -> f () skipMany1 p = p *> skipMany p-#if __GLASGOW_HASKELL__ >= 700-{-# SPECIALIZE skipMany1 :: Parser a -> Parser () #-}+{-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-}+{-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-} {-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-}-#endif -- | Apply the given action repeatedly, returning every result. count :: Monad m => Int -> m a -> m [a]@@ -134,9 +240,17 @@ eitherP a b = (Left <$> a) <|> (Right <$> b) {-# INLINE eitherP #-} --- | Zero or more.-many :: (Alternative f) => f a -> f [a]-many v = many_v- where many_v = some_v <|> pure []- some_v = (:) <$> v <*> many_v-{-# INLINE many #-}+-- | If a parser has returned a 'T.Partial' result, supply it with more+-- input.+feed :: Monoid i => IResult i r -> i -> IResult i r+feed (Fail t ctxs msg) d = Fail (mappend t d) ctxs msg+feed (Partial k) d = k d+feed (Done t r) d = Done (mappend t d) r+{-# INLINE feed #-}++-- | Apply a parser without consuming any input.+lookAhead :: Parser i a -> Parser i a+lookAhead p = Parser $ \t pos more lose succ ->+ let succ' t' _pos' more' = succ t' pos more'+ in runParser p t pos more lose succ'+{-# INLINE lookAhead #-}
− Data/Attoparsec/FastSet.hs
@@ -1,115 +0,0 @@-{-# LANGUAGE BangPatterns, MagicHash #-}---------------------------------------------------------------------------------- |--- Module : Data.Attoparsec.FastSet--- Copyright : Bryan O'Sullivan 2008--- License : BSD3--- --- Maintainer : bos@serpentine.com--- Stability : experimental--- Portability : unknown------ Fast set membership tests for 'Word8' and 8-bit 'Char' values. The--- set representation is unboxed for efficiency. For small sets, we--- test for membership using a binary search. For larger sets, we use--- a lookup table.--- -------------------------------------------------------------------------------module Data.Attoparsec.FastSet- (- -- * Data type- FastSet- -- * Construction- , fromList- , set- -- * Lookup- , memberChar- , memberWord8- -- * Debugging- , fromSet- -- * Handy interface- , charClass- ) where--import Data.Bits ((.&.), (.|.))-import Foreign.Storable (peekByteOff, pokeByteOff)-import GHC.Base (Int(I#), iShiftRA#, narrow8Word#, shiftL#)-import GHC.Word (Word8(W8#))-import qualified Data.ByteString as B-import qualified Data.ByteString.Char8 as B8-import qualified Data.ByteString.Internal as I-import qualified Data.ByteString.Unsafe as U--data FastSet = Sorted { fromSet :: !B.ByteString }- | Table { fromSet :: !B.ByteString }- deriving (Eq, Ord)--instance Show FastSet where- show (Sorted s) = "FastSet Sorted " ++ show (B8.unpack s)- show (Table _) = "FastSet Table"---- | The lower bound on the size of a lookup table. We choose this to--- balance table density against performance.-tableCutoff :: Int-tableCutoff = 8---- | Create a set.-set :: B.ByteString -> FastSet-set s | B.length s < tableCutoff = Sorted . B.sort $ s- | otherwise = Table . mkTable $ s--fromList :: [Word8] -> FastSet-fromList = set . B.pack--data I = I {-# UNPACK #-} !Int {-# UNPACK #-} !Word8--shiftR :: Int -> Int -> Int-shiftR (I# x#) (I# i#) = I# (x# `iShiftRA#` i#)--shiftL :: Word8 -> Int -> Word8-shiftL (W8# x#) (I# i#) = W8# (narrow8Word# (x# `shiftL#` i#))--index :: Int -> I-index i = I (i `shiftR` 3) (1 `shiftL` (i .&. 7))-{-# INLINE index #-}---- | Check the set for membership.-memberWord8 :: Word8 -> FastSet -> Bool-memberWord8 w (Table t) =- let I byte bit = index (fromIntegral w)- in U.unsafeIndex t byte .&. bit /= 0-memberWord8 w (Sorted s) = search 0 (B.length s - 1)- where search lo hi- | hi < lo = False- | otherwise =- let mid = (lo + hi) `div` 2- in case compare w (U.unsafeIndex s mid) of- GT -> search (mid + 1) hi- LT -> search lo (mid - 1)- _ -> True---- | Check the set for membership. Only works with 8-bit characters:--- characters above code point 255 will give wrong answers.-memberChar :: Char -> FastSet -> Bool-memberChar c = memberWord8 (I.c2w c)-{-# INLINE memberChar #-}--mkTable :: B.ByteString -> B.ByteString-mkTable s = I.unsafeCreate 32 $ \t -> do- _ <- I.memset t 0 32- U.unsafeUseAsCStringLen s $ \(p, l) ->- let loop n | n == l = return ()- | otherwise = do- c <- peekByteOff p n :: IO Word8- let I byte bit = index (fromIntegral c)- prev <- peekByteOff t byte :: IO Word8- pokeByteOff t byte (prev .|. bit)- loop (n + 1)- in loop 0--charClass :: String -> FastSet-charClass = set . B8.pack . go- where go (a:'-':b:xs) = [a..b] ++ go xs- go (x:xs) = x : go xs- go _ = ""
Data/Attoparsec/Internal.hs view
@@ -1,453 +1,171 @@-{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}+{-# LANGUAGE BangPatterns, CPP, ScopedTypeVariables #-} -- | -- Module : Data.Attoparsec.Internal--- Copyright : Bryan O'Sullivan 2007-2011+-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown ----- Simple, efficient parser combinators for 'B.ByteString' strings,--- loosely based on the Parsec library.+-- Simple, efficient parser combinators, loosely based on the Parsec+-- library. module Data.Attoparsec.Internal- (- -- * Parser types- Parser- , Result(..)-- -- * Running parsers- , parse- , parseOnly-- -- * Combinators- , (<?>)- , try- , module Data.Attoparsec.Combinator-- -- * Parsing individual bytes- , satisfy- , satisfyWith- , anyWord8- , skip- , word8- , notWord8-- -- ** Byte classes- , inClass- , notInClass-- -- * Parsing more complicated structures- , storable-- -- * Efficient string handling- , skipWhile- , string- , stringTransform- , take- , scan- , takeWhile- , takeWhile1- , takeTill-- -- ** Consume all remaining input- , takeByteString- , takeLazyByteString-- -- * State observation and manipulation functions+ ( compareResults+ , prompt+ , demandInput+ , demandInput_+ , wantInput , endOfInput , atEnd- , ensure-- -- * Utilities- , endOfLine+ , satisfyElem+ , concatReverse ) where -import Control.Applicative ((<|>), (<$>))-import Control.Monad (when)-import Data.Attoparsec.Combinator-import Data.Attoparsec.FastSet (charClass, memberWord8)+#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((<$>))+import Data.Monoid (Monoid, mconcat)+#endif import Data.Attoparsec.Internal.Types-import Data.Word (Word8)-import Foreign.ForeignPtr (withForeignPtr)-import Foreign.Ptr (castPtr, minusPtr, plusPtr)-import Foreign.Storable (Storable(peek, sizeOf))-import Prelude hiding (getChar, take, takeWhile)-import System.IO.Unsafe (unsafePerformIO)-import qualified Data.ByteString as B8-import qualified Data.ByteString.Char8 as B-import qualified Data.ByteString.Internal as B-import qualified Data.ByteString.Lazy as L-import qualified Data.ByteString.Unsafe as B+import Data.ByteString (ByteString)+import Data.Text (Text)+import Prelude hiding (succ) --- | If at least @n@ bytes of input are available, return the current--- input, otherwise fail.-ensure :: Int -> Parser B.ByteString-ensure !n = Parser $ \i0 a0 m0 kf ks ->- if B.length (unI i0) >= n- then ks i0 a0 m0 (unI i0)- else runParser (demandInput >> ensure n) i0 a0 m0 kf ks+-- | Compare two 'IResult' values for equality.+--+-- If both 'IResult's are 'Partial', the result will be 'Nothing', as+-- they are incomplete and hence their equality cannot be known.+-- (This is why there is no 'Eq' instance for 'IResult'.)+compareResults :: (Eq i, Eq r) => IResult i r -> IResult i r -> Maybe Bool+compareResults (Fail t0 ctxs0 msg0) (Fail t1 ctxs1 msg1) =+ Just (t0 == t1 && ctxs0 == ctxs1 && msg0 == msg1)+compareResults (Done t0 r0) (Done t1 r1) =+ Just (t0 == t1 && r0 == r1)+compareResults (Partial _) (Partial _) = Nothing+compareResults _ _ = Just False --- | Ask for input. If we receive any, pass it to a success--- continuation, otherwise to a failure continuation.-prompt :: Input -> Added -> More- -> (Input -> Added -> More -> Result r)- -> (Input -> Added -> More -> Result r)- -> Result r-prompt i0 a0 _m0 kf ks = Partial $ \s ->- if B.null s- then kf i0 a0 Complete- else ks (I (unI i0 +++ s)) (A (unA a0 +++ s)) Incomplete+-- | Ask for input. If we receive any, pass the augmented input to a+-- success continuation, otherwise to a failure continuation.+prompt :: Chunk t+ => State t -> Pos -> More+ -> (State t -> Pos -> More -> IResult t r)+ -> (State t -> Pos -> More -> IResult t r)+ -> IResult t r+prompt t pos _more lose succ = Partial $ \s ->+ if nullChunk s+ then lose t pos Complete+ else succ (pappendChunk t s) pos Incomplete+{-# SPECIALIZE prompt :: State ByteString -> Pos -> More+ -> (State ByteString -> Pos -> More+ -> IResult ByteString r)+ -> (State ByteString -> Pos -> More+ -> IResult ByteString r)+ -> IResult ByteString r #-}+{-# SPECIALIZE prompt :: State Text -> Pos -> More+ -> (State Text -> Pos -> More -> IResult Text r)+ -> (State Text -> Pos -> More -> IResult Text r)+ -> IResult Text r #-} -- | Immediately demand more input via a 'Partial' continuation -- result.-demandInput :: Parser ()-demandInput = Parser $ \i0 a0 m0 kf ks ->- if m0 == Complete- then kf i0 a0 m0 ["demandInput"] "not enough bytes"- else let kf' i a m = kf i a m ["demandInput"] "not enough bytes"- ks' i a m = ks i a m ()- in prompt i0 a0 m0 kf' ks'+demandInput :: Chunk t => Parser t ()+demandInput = Parser $ \t pos more lose succ ->+ case more of+ Complete -> lose t pos more [] "not enough input"+ _ -> let lose' _ pos' more' = lose t pos' more' [] "not enough input"+ succ' t' pos' more' = succ t' pos' more' ()+ in prompt t pos more lose' succ'+{-# SPECIALIZE demandInput :: Parser ByteString () #-}+{-# SPECIALIZE demandInput :: Parser Text () #-} +-- | Immediately demand more input via a 'Partial' continuation+-- result. Return the new input.+demandInput_ :: Chunk t => Parser t t+demandInput_ = Parser $ \t pos more lose succ ->+ case more of+ Complete -> lose t pos more [] "not enough input"+ _ -> Partial $ \s ->+ if nullChunk s+ then lose t pos Complete [] "not enough input"+ else succ (pappendChunk t s) pos more s+{-# SPECIALIZE demandInput_ :: Parser ByteString ByteString #-}+{-# SPECIALIZE demandInput_ :: Parser Text Text #-}+ -- | This parser always succeeds. It returns 'True' if any input is -- available either immediately or on demand, and 'False' if the end -- of all input has been reached.-wantInput :: Parser Bool-wantInput = Parser $ \i0 a0 m0 _kf ks ->+wantInput :: forall t . Chunk t => Parser t Bool+wantInput = Parser $ \t pos more _lose succ -> case () of- _ | not (B.null (unI i0)) -> ks i0 a0 m0 True- | m0 == Complete -> ks i0 a0 m0 False- | otherwise -> let kf' i a m = ks i a m False- ks' i a m = ks i a m True- in prompt i0 a0 m0 kf' ks'--get :: Parser B.ByteString-get = Parser $ \i0 a0 m0 _kf ks -> ks i0 a0 m0 (unI i0)--put :: B.ByteString -> Parser ()-put s = Parser $ \_i0 a0 m0 _kf ks -> ks (I s) a0 m0 ()---- | Attempt a parse, and if it fails, rewind the input so that no--- input appears to have been consumed.------ This combinator is useful in cases where a parser might consume--- some input before failing, i.e. the parser needs arbitrary--- lookahead. The downside to using this combinator is that it can--- retain input for longer than is desirable.-try :: Parser a -> Parser a-try p = Parser $ \i0 a0 m0 kf ks ->- noAdds i0 a0 m0 $ \i1 a1 m1 ->- let kf' i2 a2 m2 = addS i0 a0 m0 i2 a2 m2 kf- in runParser p i1 a1 m1 kf' ks---- | The parser @satisfy p@ succeeds for any byte for which the--- predicate @p@ returns 'True'. Returns the byte that is actually--- parsed.------ >digit = satisfy isDigit--- > where isDigit w = w >= 48 && w <= 57-satisfy :: (Word8 -> Bool) -> Parser Word8-satisfy p = do- s <- ensure 1- let w = B.unsafeHead s- if p w- then put (B.unsafeTail s) >> return w- else fail "satisfy"---- | The parser @skip p@ succeeds for any byte for which the predicate--- @p@ returns 'True'.------ >skipDigit = skip isDigit--- > where isDigit w = w >= 48 && w <= 57-skip :: (Word8 -> Bool) -> Parser ()-skip p = do- s <- ensure 1- if p (B.unsafeHead s)- then put (B.unsafeTail s)- else fail "skip"---- | The parser @satisfyWith f p@ transforms a byte, and succeeds if--- the predicate @p@ returns 'True' on the transformed value. The--- parser returns the transformed byte that was parsed.-satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a-satisfyWith f p = do- s <- ensure 1- let c = f (B.unsafeHead s)- if p c- then put (B.unsafeTail s) >> return c- else fail "satisfyWith"--storable :: Storable a => Parser a-storable = hack undefined- where- hack :: Storable b => b -> Parser b- hack dummy = do- (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy)- return . B.inlinePerformIO . withForeignPtr fp $ \p ->- peek (castPtr $ p `plusPtr` o)---- | Consume @n@ bytes of input, but succeed only if the predicate--- returns 'True'.-takeWith :: Int -> (B.ByteString -> Bool) -> Parser B.ByteString-takeWith n p = do- s <- ensure n- let h = B.unsafeTake n s- t = B.unsafeDrop n s- if p h- then put t >> return h- else fail "takeWith"---- | Consume exactly @n@ bytes of input.-take :: Int -> Parser B.ByteString-take n = takeWith n (const True)-{-# INLINE take #-}---- | @string s@ parses a sequence of bytes that identically match--- @s@. Returns the parsed string (i.e. @s@). This parser consumes no--- input if it fails (even if a partial match).------ /Note/: The behaviour of this parser is different to that of the--- similarly-named parser in Parsec, as this one is all-or-nothing.--- To illustrate the difference, the following parser will fail under--- Parsec given an input of @"for"@:------ >string "foo" <|> string "for"------ The reason for its failure is that that the first branch is a--- partial match, and will consume the letters @\'f\'@ and @\'o\'@--- before failing. In Attoparsec, the above parser will /succeed/ on--- that input, because the failed first branch will consume nothing.-string :: B.ByteString -> Parser B.ByteString-string s = takeWith (B.length s) (==s)-{-# INLINE string #-}--stringTransform :: (B.ByteString -> B.ByteString) -> B.ByteString- -> Parser B.ByteString-stringTransform f s = takeWith (B.length s) ((==f s) . f)-{-# INLINE stringTransform #-}---- | Skip past input for as long as the predicate returns 'True'.-skipWhile :: (Word8 -> Bool) -> Parser ()-skipWhile p = go- where- go = do- t <- B8.dropWhile p <$> get- put t- when (B.null t) $ do- input <- wantInput- when input go-{-# INLINE skipWhile #-}---- | Consume input as long as the predicate returns 'False'--- (i.e. until it returns 'True'), and return the consumed input.------ This parser does not fail. It will return an empty string if the--- predicate returns 'True' on the first byte of input.------ /Note/: Because this parser does not fail, do not use it with--- combinators such as 'many', because such parsers loop until a--- failure occurs. Careless use will thus result in an infinite loop.-takeTill :: (Word8 -> Bool) -> Parser B.ByteString-takeTill p = takeWhile (not . p)-{-# INLINE takeTill #-}---- | Consume input as long as the predicate returns 'True', and return--- the consumed input.------ This parser does not fail. It will return an empty string if the--- predicate returns 'False' on the first byte of input.------ /Note/: Because this parser does not fail, do not use it with--- combinators such as 'many', because such parsers loop until a--- failure occurs. Careless use will thus result in an infinite loop.-takeWhile :: (Word8 -> Bool) -> Parser B.ByteString-takeWhile p = (B.concat . reverse) `fmap` go []- where- go acc = do- (h,t) <- B8.span p <$> get- put t- if B.null t- then do- input <- wantInput- if input- then go (h:acc)- else return (h:acc)- else return (h:acc)--takeRest :: Parser [B.ByteString]-takeRest = go []- where- go acc = do- input <- wantInput- if input- then do- s <- get- put B.empty- go (s:acc)- else return (reverse acc)---- | Consume all remaining input and return it as a single string.-takeByteString :: Parser B.ByteString-takeByteString = B.concat `fmap` takeRest---- | Consume all remaining input and return it as a single string.-takeLazyByteString :: Parser L.ByteString-takeLazyByteString = L.fromChunks `fmap` takeRest--data T s = T {-# UNPACK #-} !Int s---- | A stateful scanner. The predicate consumes and transforms a--- state argument, and each transformed state is passed to successive--- invocations of the predicate on each byte of the input until one--- returns 'Nothing' or the input ends.------ This parser does not fail. It will return an empty string if the--- predicate returns 'Nothing' on the first byte of input.------ /Note/: Because this parser does not fail, do not use it with--- combinators such as 'many', because such parsers loop until a--- failure occurs. Careless use will thus result in an infinite loop.-scan :: s -> (s -> Word8 -> Maybe s) -> Parser B.ByteString-scan s0 p = do- chunks <- go [] s0- case chunks of- [x] -> return x- xs -> return . B.concat . reverse $ xs- where- go acc s1 = do- let scanner (B.PS fp off len) =- withForeignPtr fp $ \ptr0 -> do- let start = ptr0 `plusPtr` off- end = start `plusPtr` len- inner ptr !s- | ptr < end = do- w <- peek ptr- case p s w of- Just s' -> inner (ptr `plusPtr` 1) s'- _ -> done (ptr `minusPtr` start) s- | otherwise = done (ptr `minusPtr` start) s- done !i !s = return (T i s)- inner start s1- bs <- get- let T i s' = unsafePerformIO $ scanner bs- h = B.unsafeTake i bs- t = B.unsafeDrop i bs- put t- if B.null t- then do- input <- wantInput- if input- then go (h:acc) s'- else return (h:acc)- else return (h:acc)-{-# INLINE scan #-}---- | Consume input as long as the predicate returns 'True', and return--- the consumed input.------ This parser requires the predicate to succeed on at least one byte--- of input: it will fail if the predicate never returns 'True' or if--- there is no input left.-takeWhile1 :: (Word8 -> Bool) -> Parser B.ByteString-takeWhile1 p = do- (`when` demandInput) =<< B.null <$> get- (h,t) <- B8.span p <$> get- when (B.null h) $ fail "takeWhile1"- put t- if B.null t- then (h+++) `fmap` takeWhile p- else return h---- | Match any byte in a set.------ >vowel = inClass "aeiou"------ Range notation is supported.------ >halfAlphabet = inClass "a-nA-N"------ To add a literal @\'-\'@ to a set, place it at the beginning or end--- of the string.-inClass :: String -> Word8 -> Bool-inClass s = (`memberWord8` mySet)- where mySet = charClass s-{-# INLINE inClass #-}---- | Match any byte not in a set.-notInClass :: String -> Word8 -> Bool-notInClass s = not . inClass s-{-# INLINE notInClass #-}---- | Match any byte.-anyWord8 :: Parser Word8-anyWord8 = satisfy $ const True-{-# INLINE anyWord8 #-}---- | Match a specific byte.-word8 :: Word8 -> Parser Word8-word8 c = satisfy (== c) <?> show c-{-# INLINE word8 #-}---- | Match any byte except the given one.-notWord8 :: Word8 -> Parser Word8-notWord8 c = satisfy (/= c) <?> "not " ++ show c-{-# INLINE notWord8 #-}+ _ | pos < atBufferEnd (undefined :: t) t -> succ t pos more True+ | more == Complete -> succ t pos more False+ | otherwise -> let lose' t' pos' more' = succ t' pos' more' False+ succ' t' pos' more' = succ t' pos' more' True+ in prompt t pos more lose' succ'+{-# INLINE wantInput #-} -- | Match only if all input has been consumed.-endOfInput :: Parser ()-endOfInput = Parser $ \i0 a0 m0 kf ks ->- if B.null (unI i0)- then if m0 == Complete- then ks i0 a0 m0 ()- else let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $- \ i2 a2 m2 -> ks i2 a2 m2 ()- ks' i1 a1 m1 _ = addS i0 a0 m0 i1 a1 m1 $- \ i2 a2 m2 -> kf i2 a2 m2 []- "endOfInput"- in runParser demandInput i0 a0 m0 kf' ks'- else kf i0 a0 m0 [] "endOfInput"+endOfInput :: forall t . Chunk t => Parser t ()+endOfInput = Parser $ \t pos more lose succ ->+ case () of+ _| pos < atBufferEnd (undefined :: t) t -> lose t pos more [] "endOfInput"+ | more == Complete -> succ t pos more ()+ | otherwise ->+ let lose' t' pos' more' _ctx _msg = succ t' pos' more' ()+ succ' t' pos' more' _a = lose t' pos' more' [] "endOfInput"+ in runParser demandInput t pos more lose' succ'+{-# SPECIALIZE endOfInput :: Parser ByteString () #-}+{-# SPECIALIZE endOfInput :: Parser Text () #-} -- | Return an indication of whether the end of input has been -- reached.-atEnd :: Parser Bool+atEnd :: Chunk t => Parser t Bool atEnd = not <$> wantInput {-# INLINE atEnd #-} --- | Match either a single newline character @\'\\n\'@, or a carriage--- return followed by a newline character @\"\\r\\n\"@.-endOfLine :: Parser ()-endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ())----- | Name the parser, in case failure occurs.-(<?>) :: Parser a- -> String -- ^ the name to use if parsing fails- -> Parser a-p <?> msg0 = Parser $ \i0 a0 m0 kf ks ->- let kf' i a m strs msg = kf i a m (msg0:strs) msg- in runParser p i0 a0 m0 kf' ks-{-# INLINE (<?>) #-}-infix 0 <?>---- | Terminal failure continuation.-failK :: Failure a-failK i0 _a0 _m0 stack msg = Fail (unI i0) stack msg-{-# INLINE failK #-}---- | Terminal success continuation.-successK :: Success a a-successK i0 _a0 _m0 a = Done (unI i0) a-{-# INLINE successK #-}+satisfySuspended :: forall t r . Chunk t+ => (ChunkElem t -> Bool)+ -> State t -> Pos -> More+ -> Failure t (State t) r+ -> Success t (State t) (ChunkElem t) r+ -> IResult t r+satisfySuspended p t pos more lose succ =+ runParser (demandInput >> go) t pos more lose succ+ where go = Parser $ \t' pos' more' lose' succ' ->+ case bufferElemAt (undefined :: t) pos' t' of+ Just (e, l) | p e -> succ' t' (pos' + Pos l) more' e+ | otherwise -> lose' t' pos' more' [] "satisfyElem"+ Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'+{-# SPECIALIZE satisfySuspended :: (ChunkElem ByteString -> Bool)+ -> State ByteString -> Pos -> More+ -> Failure ByteString (State ByteString) r+ -> Success ByteString (State ByteString)+ (ChunkElem ByteString) r+ -> IResult ByteString r #-}+{-# SPECIALIZE satisfySuspended :: (ChunkElem Text -> Bool)+ -> State Text -> Pos -> More+ -> Failure Text (State Text) r+ -> Success Text (State Text)+ (ChunkElem Text) r+ -> IResult Text r #-} --- | Run a parser.-parse :: Parser a -> B.ByteString -> Result a-parse m s = runParser m (I s) (A B.empty) Incomplete failK successK-{-# INLINE parse #-}+-- | The parser @satisfyElem p@ succeeds for any chunk element for which the+-- predicate @p@ returns 'True'. Returns the element that is+-- actually parsed.+satisfyElem :: forall t . Chunk t+ => (ChunkElem t -> Bool) -> Parser t (ChunkElem t)+satisfyElem p = Parser $ \t pos more lose succ ->+ case bufferElemAt (undefined :: t) pos t of+ Just (e, l) | p e -> succ t (pos + Pos l) more e+ | otherwise -> lose t pos more [] "satisfyElem"+ Nothing -> satisfySuspended p t pos more lose succ+{-# INLINE satisfyElem #-} --- | Run a parser that cannot be resupplied via a 'Partial' result.-parseOnly :: Parser a -> B.ByteString -> Either String a-parseOnly m s = case runParser m (I s) (A B.empty) Complete failK successK of- Fail _ _ err -> Left err- Done _ a -> Right a- _ -> error "parseOnly: impossible error!"-{-# INLINE parseOnly #-}+-- | Concatenate a monoid after reversing its elements. Used to+-- glue together a series of textual chunks that have been accumulated+-- \"backwards\".+concatReverse :: Monoid m => [m] -> m+concatReverse [x] = x+concatReverse xs = mconcat (reverse xs)+{-# INLINE concatReverse #-}
Data/Attoparsec/Internal/Types.hs view
@@ -1,185 +1,266 @@-{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-}+{-# LANGUAGE CPP, BangPatterns, GeneralizedNewtypeDeriving, OverloadedStrings,+ Rank2Types, RecordWildCards, TypeFamilies #-} -- | -- Module : Data.Attoparsec.Internal.Types--- Copyright : Bryan O'Sullivan 2007-2011+-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown ----- Simple, efficient parser combinators for 'B.ByteString' strings,--- loosely based on the Parsec library.+-- Simple, efficient parser combinators, loosely based on the Parsec+-- library. module Data.Attoparsec.Internal.Types ( Parser(..)+ , State , Failure , Success- , Result(..)- , Input(..)- , Added(..)+ , Pos(..)+ , IResult(..) , More(..)- , addS- , noAdds- , (+++)+ , (<>)+ , Chunk(..) ) where -import Control.Applicative (Alternative(..), Applicative(..))+import Control.Applicative as App (Applicative(..), (<$>))+import Control.Applicative (Alternative(..)) import Control.DeepSeq (NFData(rnf)) import Control.Monad (MonadPlus(..))-import Data.Monoid (Monoid(..))-import Prelude hiding (getChar, take, takeWhile)-import qualified Data.ByteString.Char8 as B+import qualified Control.Monad.Fail as Fail (MonadFail(..))+import Data.Monoid as Mon (Monoid(..))+import Data.Semigroup (Semigroup(..))+import Data.Word (Word8)+import Data.ByteString (ByteString)+import qualified Data.ByteString as BS+import Data.ByteString.Internal (w2c)+import Data.Text (Text)+import qualified Data.Text as Text+import Data.Text.Unsafe (Iter(..))+import Prelude hiding (succ)+import qualified Data.Attoparsec.ByteString.Buffer as B+import qualified Data.Attoparsec.Text.Buffer as T --- | The result of a parse.-data Result r = Fail B.ByteString [String] String- -- ^ The parse failed. The 'B.ByteString' is the input- -- that had not yet been consumed when the failure- -- occurred. The @[@'String'@]@ is a list of contexts- -- in which the error occurred. The 'String' is the- -- message describing the error, if any.- | Partial (B.ByteString -> Result r)- -- ^ Supply this continuation with more input so that- -- the parser can resume. To indicate that no more- -- input is available, use an 'B.empty' string.- | Done B.ByteString r- -- ^ The parse succeeded. The 'B.ByteString' is the- -- input that had not yet been consumed (if any) when- -- the parse succeeded.+newtype Pos = Pos { fromPos :: Int }+ deriving (Eq, Ord, Show, Num) -instance Show r => Show (Result r) where- show (Fail bs stk msg) =- "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg- show (Partial _) = "Partial _"- show (Done bs r) = "Done " ++ show bs ++ " " ++ show r+-- | The result of a parse. This is parameterised over the type @i@+-- of string that was processed.+--+-- This type is an instance of 'Functor', where 'fmap' transforms the+-- value in a 'Done' result.+data IResult i r =+ Fail i [String] String+ -- ^ The parse failed. The @i@ parameter is the input that had+ -- not yet been consumed when the failure occurred. The+ -- @[@'String'@]@ is a list of contexts in which the error+ -- occurred. The 'String' is the message describing the error, if+ -- any.+ | Partial (i -> IResult i r)+ -- ^ Supply this continuation with more input so that the parser+ -- can resume. To indicate that no more input is available, pass+ -- an empty string to the continuation.+ --+ -- __Note__: if you get a 'Partial' result, do not call its+ -- continuation more than once.+ | Done i r+ -- ^ The parse succeeded. The @i@ parameter is the input that had+ -- not yet been consumed (if any) when the parse succeeded. -instance (NFData r) => NFData (Result r) where- rnf (Fail _ _ _) = ()+instance (Show i, Show r) => Show (IResult i r) where+ showsPrec d ir = showParen (d > 10) $+ case ir of+ (Fail t stk msg) -> showString "Fail" . f t . f stk . f msg+ (Partial _) -> showString "Partial _"+ (Done t r) -> showString "Done" . f t . f r+ where f :: Show a => a -> ShowS+ f x = showChar ' ' . showsPrec 11 x++instance (NFData i, NFData r) => NFData (IResult i r) where+ rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg rnf (Partial _) = ()- rnf (Done _ r) = rnf r+ rnf (Done t r) = rnf t `seq` rnf r {-# INLINE rnf #-} -fmapR :: (a -> b) -> Result a -> Result b-fmapR _ (Fail st stk msg) = Fail st stk msg-fmapR f (Partial k) = Partial (fmapR f . k)-fmapR f (Done bs r) = Done bs (f r)--instance Functor Result where- fmap = fmapR- {-# INLINE fmap #-}--newtype Input = I {unI :: B.ByteString}-newtype Added = A {unA :: B.ByteString}+instance Functor (IResult i) where+ fmap _ (Fail t stk msg) = Fail t stk msg+ fmap f (Partial k) = Partial (fmap f . k)+ fmap f (Done t r) = Done t (f r) --- | The 'Parser' type is a monad.-newtype Parser a = Parser {- runParser :: forall r. Input -> Added -> More- -> Failure r- -> Success a r- -> Result r+-- | The core parser type. This is parameterised over the type @i@+-- of string being processed.+--+-- This type is an instance of the following classes:+--+-- * 'Monad', where 'fail' throws an exception (i.e. fails) with an+-- error message.+--+-- * 'Functor' and 'Applicative', which follow the usual definitions.+--+-- * 'MonadPlus', where 'mzero' fails (with no error message) and+-- 'mplus' executes the right-hand parser if the left-hand one+-- fails. When the parser on the right executes, the input is reset+-- to the same state as the parser on the left started with. (In+-- other words, attoparsec is a backtracking parser that supports+-- arbitrary lookahead.)+--+-- * 'Alternative', which follows 'MonadPlus'.+newtype Parser i a = Parser {+ runParser :: forall r.+ State i -> Pos -> More+ -> Failure i (State i) r+ -> Success i (State i) a r+ -> IResult i r } -type Failure r = Input -> Added -> More -> [String] -> String -> Result r-type Success a r = Input -> Added -> More -> a -> Result r+type family State i+type instance State ByteString = B.Buffer+type instance State Text = T.Buffer +type Failure i t r = t -> Pos -> More -> [String] -> String+ -> IResult i r+type Success i t a r = t -> Pos -> More -> a -> IResult i r+ -- | Have we read all available input? data More = Complete | Incomplete deriving (Eq, Show) -addS :: Input -> Added -> More- -> Input -> Added -> More- -> (Input -> Added -> More -> r) -> r-addS i0 a0 m0 _i1 a1 m1 f =- let !i = I (unI i0 +++ unA a1)- a = A (unA a0 +++ unA a1)- !m = m0 <> m1- in f i a m- where- Complete <> _ = Complete- _ <> Complete = Complete- _ <> _ = Incomplete-{-# INLINE addS #-}+instance Semigroup More where+ c@Complete <> _ = c+ _ <> m = m -bindP :: Parser a -> (a -> Parser b) -> Parser b-bindP m g =- Parser $ \i0 a0 m0 kf ks -> runParser m i0 a0 m0 kf $- \i1 a1 m1 a -> runParser (g a) i1 a1 m1 kf ks-{-# INLINE bindP #-}+instance Mon.Monoid More where+ mappend = (<>)+ mempty = Incomplete -returnP :: a -> Parser a-returnP a = Parser (\i0 a0 m0 _kf ks -> ks i0 a0 m0 a)-{-# INLINE returnP #-}+instance Monad (Parser i) where+#if !(MIN_VERSION_base(4,13,0))+ fail = Fail.fail+ {-# INLINE fail #-}+#endif -instance Monad Parser where- return = returnP- (>>=) = bindP- fail = failDesc+ return = App.pure+ {-# INLINE return #-} -noAdds :: Input -> Added -> More- -> (Input -> Added -> More -> r) -> r-noAdds i0 _a0 m0 f = f i0 (A B.empty) m0-{-# INLINE noAdds #-}+ m >>= k = Parser $ \t !pos more lose succ ->+ let succ' t' !pos' more' a = runParser (k a) t' pos' more' lose succ+ in runParser m t pos more lose succ'+ {-# INLINE (>>=) #-} -plus :: Parser a -> Parser a -> Parser a-plus a b = Parser $ \i0 a0 m0 kf ks ->- let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $- \ i2 a2 m2 -> runParser b i2 a2 m2 kf ks- in noAdds i0 a0 m0 $ \i2 a2 m2 -> runParser a i2 a2 m2 kf' ks-{-# INLINE plus #-}+ (>>) = (*>)+ {-# INLINE (>>) #-} -instance MonadPlus Parser where- mzero = failDesc "mzero"++instance Fail.MonadFail (Parser i) where+ fail err = Parser $ \t pos more lose _succ -> lose t pos more [] msg+ where msg = "Failed reading: " ++ err+ {-# INLINE fail #-}++plus :: Parser i a -> Parser i a -> Parser i a+plus f g = Parser $ \t pos more lose succ ->+ let lose' t' _pos' more' _ctx _msg = runParser g t' pos more' lose succ+ in runParser f t pos more lose' succ++instance MonadPlus (Parser i) where+ mzero = fail "mzero" {-# INLINE mzero #-} mplus = plus -fmapP :: (a -> b) -> Parser a -> Parser b-fmapP p m = Parser $ \i0 a0 m0 f k ->- runParser m i0 a0 m0 f $ \i1 a1 s1 a -> k i1 a1 s1 (p a)-{-# INLINE fmapP #-}--instance Functor Parser where- fmap = fmapP+instance Functor (Parser i) where+ fmap f p = Parser $ \t pos more lose succ ->+ let succ' t' pos' more' a = succ t' pos' more' (f a)+ in runParser p t pos more lose succ' {-# INLINE fmap #-} -apP :: Parser (a -> b) -> Parser a -> Parser b+apP :: Parser i (a -> b) -> Parser i a -> Parser i b apP d e = do b <- d a <- e return (b a) {-# INLINE apP #-} -instance Applicative Parser where- pure = returnP+instance Applicative (Parser i) where+ pure v = Parser $ \t !pos more _lose succ -> succ t pos more v {-# INLINE pure #-} (<*>) = apP {-# INLINE (<*>) #-}-- -- These definitions are equal to the defaults, but this- -- way the optimizer doesn't have to work so hard to figure- -- that out.- (*>) = (>>)+ m *> k = m >>= \_ -> k {-# INLINE (*>) #-}- x <* y = x >>= \a -> y >> return a+ x <* y = x >>= \a -> y >> pure a {-# INLINE (<*) #-} -instance Monoid (Parser a) where- mempty = failDesc "mempty"+instance Semigroup (Parser i a) where+ (<>) = plus+ {-# INLINE (<>) #-}++instance Monoid (Parser i a) where+ mempty = fail "mempty" {-# INLINE mempty #-}- mappend = plus+ mappend = (<>) {-# INLINE mappend #-} -instance Alternative Parser where- empty = failDesc "empty"+instance Alternative (Parser i) where+ empty = fail "empty" {-# INLINE empty #-}+ (<|>) = plus {-# INLINE (<|>) #-} -failDesc :: String -> Parser a-failDesc err = Parser (\i0 a0 m0 kf _ks -> kf i0 a0 m0 [] msg)- where msg = "Failed reading: " ++ err-{-# INLINE failDesc #-}+ many v = many_v+ where+ many_v = some_v <|> pure []+ some_v = (:) <$> v <*> many_v+ {-# INLINE many #-} -(+++) :: B.ByteString -> B.ByteString -> B.ByteString-(+++) = B.append-{-# INLINE (+++) #-}+ some v = some_v+ where+ many_v = some_v <|> pure []+ some_v = (:) <$> v <*> many_v+ {-# INLINE some #-}++-- | A common interface for input chunks.+class Monoid c => Chunk c where+ type ChunkElem c+ -- | Test if the chunk is empty.+ nullChunk :: c -> Bool+ -- | Append chunk to a buffer.+ pappendChunk :: State c -> c -> State c+ -- | Position at the end of a buffer. The first argument is ignored.+ atBufferEnd :: c -> State c -> Pos+ -- | Return the buffer element at the given position along with its length.+ bufferElemAt :: c -> Pos -> State c -> Maybe (ChunkElem c, Int)+ -- | Map an element to the corresponding character.+ -- The first argument is ignored.+ chunkElemToChar :: c -> ChunkElem c -> Char++instance Chunk ByteString where+ type ChunkElem ByteString = Word8+ nullChunk = BS.null+ {-# INLINE nullChunk #-}+ pappendChunk = B.pappend+ {-# INLINE pappendChunk #-}+ atBufferEnd _ = Pos . B.length+ {-# INLINE atBufferEnd #-}+ bufferElemAt _ (Pos i) buf+ | i < B.length buf = Just (B.unsafeIndex buf i, 1)+ | otherwise = Nothing+ {-# INLINE bufferElemAt #-}+ chunkElemToChar _ = w2c+ {-# INLINE chunkElemToChar #-}++instance Chunk Text where+ type ChunkElem Text = Char+ nullChunk = Text.null+ {-# INLINE nullChunk #-}+ pappendChunk = T.pappend+ {-# INLINE pappendChunk #-}+ atBufferEnd _ = Pos . T.length+ {-# INLINE atBufferEnd #-}+ bufferElemAt _ (Pos i) buf+ | i < T.length buf = let Iter c l = T.iter buf i in Just (c, l)+ | otherwise = Nothing+ {-# INLINE bufferElemAt #-}+ chunkElemToChar _ = id+ {-# INLINE chunkElemToChar #-}
Data/Attoparsec/Lazy.hs view
@@ -1,8 +1,8 @@ -- | -- Module : Data.Attoparsec.Lazy--- Copyright : Bryan O'Sullivan 2010+-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3--- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown@@ -23,67 +23,7 @@ module Data.Attoparsec.Lazy (- Result(..)- , module Data.Attoparsec- -- * Running parsers- , parse- , parseTest- -- ** Result conversion- , maybeResult- , eitherResult+ module Data.Attoparsec.ByteString.Lazy ) where -import Data.ByteString.Lazy.Internal (ByteString(..), chunk)-import qualified Data.ByteString as B-import qualified Data.Attoparsec as A-import Data.Attoparsec hiding (Result(..), eitherResult, maybeResult,- parse, parseWith, parseTest)---- | The result of a parse.-data Result r = Fail ByteString [String] String- -- ^ The parse failed. The 'ByteString' is the input- -- that had not yet been consumed when the failure- -- occurred. The @[@'String'@]@ is a list of contexts- -- in which the error occurred. The 'String' is the- -- message describing the error, if any.- | Done ByteString r- -- ^ The parse succeeded. The 'ByteString' is the- -- input that had not yet been consumed (if any) when- -- the parse succeeded.--instance Show r => Show (Result r) where- show (Fail bs stk msg) =- "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg- show (Done bs r) = "Done " ++ show bs ++ " " ++ show r--fmapR :: (a -> b) -> Result a -> Result b-fmapR _ (Fail st stk msg) = Fail st stk msg-fmapR f (Done bs r) = Done bs (f r)--instance Functor Result where- fmap = fmapR---- | Run a parser and return its result.-parse :: A.Parser a -> ByteString -> Result a-parse p s = case s of- Chunk x xs -> go (A.parse p x) xs- empty -> go (A.parse p B.empty) empty- where- go (A.Fail x stk msg) ys = Fail (chunk x ys) stk msg- go (A.Done x r) ys = Done (chunk x ys) r- go (A.Partial k) (Chunk y ys) = go (k y) ys- go (A.Partial k) empty = go (k B.empty) empty---- | Run a parser and print its result to standard output.-parseTest :: (Show a) => A.Parser a -> ByteString -> IO ()-parseTest p s = print (parse p s)---- | Convert a 'Result' value to a 'Maybe' value.-maybeResult :: Result r -> Maybe r-maybeResult (Done _ r) = Just r-maybeResult _ = Nothing---- | Convert a 'Result' value to an 'Either' value.-eitherResult :: Result r -> Either String r-eitherResult (Done _ r) = Right r-eitherResult (Fail _ _ msg) = Left msg+import Data.Attoparsec.ByteString.Lazy
Data/Attoparsec/Number.hs view
@@ -1,16 +1,22 @@ {-# LANGUAGE DeriveDataTypeable #-} -- | -- Module : Data.Attoparsec.Number--- Copyright : Bryan O'Sullivan 2011+-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown --+-- This module is deprecated, and both the module and 'Number' type+-- will be removed in the next major release. Use the+-- <http://hackage.haskell.org/package/scientific scientific> package+-- and the 'Data.Scientific.Scientific' type instead.+-- -- A simple number type, useful for parsing both exact and inexact -- quantities without losing much precision. module Data.Attoparsec.Number+ {-# DEPRECATED "This module will be removed in the next major release." #-} ( Number(..) ) where@@ -22,9 +28,13 @@ -- | A numeric type that can represent integers accurately, and -- floating point numbers to the precision of a 'Double'.+--+-- /Note/: this type is deprecated, and will be removed in the next+-- major release. Use the 'Data.Scientific.Scientific' type instead. data Number = I !Integer | D {-# UNPACK #-} !Double deriving (Typeable, Data)+{-# DEPRECATED Number "Use Scientific instead." #-} instance Show Number where show (I a) = show a@@ -54,8 +64,17 @@ (<) = binop (<) (<) {-# INLINE (<) #-} + (<=) = binop (<=) (<=)+ {-# INLINE (<=) #-}+ (>) = binop (>) (>) {-# INLINE (>) #-}++ (>=) = binop (>=) (>=)+ {-# INLINE (>=) #-}++ compare = binop compare compare+ {-# INLINE compare #-} instance Num Number where (+) = binop (((I$!).) . (+)) (((D$!).) . (+))
+ Data/Attoparsec/Text.hs view
@@ -0,0 +1,502 @@+{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeSynonymInstances #-}+#if __GLASGOW_HASKELL__ >= 702+{-# LANGUAGE Trustworthy #-} -- Imports internal modules+#endif+{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}++-- |+-- Module : Data.Attoparsec.Text+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient combinator parsing for 'Text' strings,+-- loosely based on the Parsec library.++module Data.Attoparsec.Text+ (+ -- * Differences from Parsec+ -- $parsec++ -- * Incremental input+ -- $incremental++ -- * Performance considerations+ -- $performance++ -- * Parser types+ Parser+ , Result+ , T.IResult(..)+ , I.compareResults++ -- * Running parsers+ , parse+ , feed+ , I.parseOnly+ , parseWith+ , parseTest++ -- ** Result conversion+ , maybeResult+ , eitherResult++ -- * Parsing individual characters+ , I.char+ , I.anyChar+ , I.notChar+ , I.satisfy+ , I.satisfyWith+ , I.skip++ -- ** Lookahead+ , I.peekChar+ , I.peekChar'++ -- ** Special character parsers+ , digit+ , letter+ , space++ -- ** Character classes+ , I.inClass+ , I.notInClass++ -- * Efficient string handling+ , I.string+ , I.stringCI+ , I.asciiCI+ , skipSpace+ , I.skipWhile+ , I.scan+ , I.runScanner+ , I.take+ , I.takeWhile+ , I.takeWhile1+ , I.takeTill++ -- ** String combinators+ -- $specalt+ , (.*>)+ , (<*.)++ -- ** Consume all remaining input+ , I.takeText+ , I.takeLazyText++ -- * Text parsing+ , I.endOfLine+ , isEndOfLine+ , isHorizontalSpace++ -- * Numeric parsers+ , decimal+ , hexadecimal+ , signed+ , double+ , Number(..)+ , number+ , rational+ , scientific++ -- * Combinators+ , try+ , (<?>)+ , choice+ , count+ , option+ , many'+ , many1+ , many1'+ , manyTill+ , manyTill'+ , sepBy+ , sepBy'+ , sepBy1+ , sepBy1'+ , skipMany+ , skipMany1+ , eitherP+ , I.match+ -- * State observation and manipulation functions+ , I.endOfInput+ , I.atEnd+ ) where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative (pure, (*>), (<*), (<$>))+import Data.Word (Word)+#endif+import Control.Applicative ((<|>))+import Data.Attoparsec.Combinator+import Data.Attoparsec.Number (Number(..))+import Data.Scientific (Scientific)+import qualified Data.Scientific as Sci+import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1)+import Data.Bits (Bits, (.|.), shiftL)+import Data.Char (isAlpha, isDigit, isSpace, ord)+import Data.Int (Int8, Int16, Int32, Int64)+import Data.List (intercalate)+import Data.Text (Text)+import Data.Word (Word8, Word16, Word32, Word64)+import qualified Data.Attoparsec.Internal as I+import qualified Data.Attoparsec.Internal.Types as T+import qualified Data.Attoparsec.Text.Internal as I+import qualified Data.Text as T++-- $parsec+--+-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is+-- not intended for, or ideal for, all possible uses.+--+-- * While attoparsec can consume input incrementally, Parsec cannot.+-- Incremental input is a huge deal for efficient and secure network+-- and system programming, since it gives much more control to users+-- of the library over matters such as resource usage and the I/O+-- model to use.+--+-- * Much of the performance advantage of attoparsec is gained via+-- high-performance parsers such as 'I.takeWhile' and 'I.string'.+-- If you use complicated combinators that return lists of+-- characters, there is less performance difference between the two+-- libraries.+--+-- * Unlike Parsec 3, attoparsec does not support being used as a+-- monad transformer.+--+-- * attoparsec is specialised to deal only with strict 'Text'+-- input. Efficiency concerns rule out both lists and lazy text.+-- The usual use for lazy text would be to allow consumption of very+-- large input without a large footprint. For this need,+-- attoparsec's incremental input provides an excellent substitute,+-- with much more control over when input takes place. If you must+-- use lazy text, see the 'Lazy' module, which feeds lazy chunks to+-- a regular parser.+--+-- * Parsec parsers can produce more helpful error messages than+-- attoparsec parsers. This is a matter of focus: attoparsec avoids+-- the extra book-keeping in favour of higher performance.++-- $incremental+--+-- attoparsec supports incremental input, meaning that you can feed it+-- a 'Text' that represents only part of the expected total amount+-- of data to parse. If your parser reaches the end of a fragment of+-- input and could consume more input, it will suspend parsing and+-- return a 'T.Partial' continuation.+--+-- Supplying the 'T.Partial' continuation with another string will+-- resume parsing at the point where it was suspended, with the string+-- you supplied used as new input at the end of the existing+-- input. You must be prepared for the result of the resumed parse to+-- be another 'Partial' continuation.+--+-- To indicate that you have no more input, supply the 'Partial'+-- continuation with an 'T.empty' 'Text'.+--+-- Remember that some parsing combinators will not return a result+-- until they reach the end of input. They may thus cause 'T.Partial'+-- results to be returned.+--+-- If you do not need support for incremental input, consider using+-- the 'I.parseOnly' function to run your parser. It will never+-- prompt for more input.+--+-- /Note/: incremental input does /not/ imply that attoparsec will+-- release portions of its internal state for garbage collection as it+-- proceeds. Its internal representation is equivalent to a single+-- 'Text': if you feed incremental input to an a parser, it will+-- require memory proportional to the amount of input you supply.+-- (This is necessary to support arbitrary backtracking.)++-- $performance+--+-- If you write an attoparsec-based parser carefully, it can be+-- realistic to expect it to perform similarly to a hand-rolled C+-- parser (measuring megabytes parsed per second).+--+-- To actually achieve high performance, there are a few guidelines+-- that it is useful to follow.+--+-- Use the 'Text'-oriented parsers whenever possible,+-- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyChar'. There is+-- about a factor of 100 difference in performance between the two+-- kinds of parser.+--+-- For very simple character-testing predicates, write them by hand+-- instead of using 'I.inClass' or 'I.notInClass'. For instance, both+-- of these predicates test for an end-of-line character, but the+-- first is much faster than the second:+--+-- >endOfLine_fast c = c == '\r' || c == '\n'+-- >endOfLine_slow = inClass "\r\n"+--+-- Make active use of benchmarking and profiling tools to measure,+-- find the problems with, and improve the performance of your parser.++-- | Run a parser and print its result to standard output.+parseTest :: (Show a) => I.Parser a -> Text -> IO ()+parseTest p s = print (parse p s)++-- | Run a parser with an initial input string, and a monadic action+-- that can supply more input if needed.+parseWith :: Monad m =>+ (m Text)+ -- ^ An action that will be executed to provide the parser+ -- with more input, if necessary. The action must return an+ -- 'T.empty' string when there is no more input available.+ -> I.Parser a+ -> Text+ -- ^ Initial input for the parser.+ -> m (Result a)+parseWith refill p s = step $ parse p s+ where step (T.Partial k) = (step . k) =<< refill+ step r = return r+{-# INLINE parseWith #-}++-- | Convert a 'Result' value to a 'Maybe' value. A 'Partial' result+-- is treated as failure.+maybeResult :: Result r -> Maybe r+maybeResult (T.Done _ r) = Just r+maybeResult _ = Nothing++-- | Convert a 'Result' value to an 'Either' value. A 'Partial' result+-- is treated as failure.+eitherResult :: Result r -> Either String r+eitherResult (T.Done _ r) = Right r+eitherResult (T.Fail _ [] msg) = Left msg+eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)+eitherResult _ = Left "Result: incomplete input"++-- | A predicate that matches either a carriage return @\'\\r\'@ or+-- newline @\'\\n\'@ character.+isEndOfLine :: Char -> Bool+isEndOfLine c = c == '\n' || c == '\r'+{-# INLINE isEndOfLine #-}++-- | A predicate that matches either a space @\' \'@ or horizontal tab+-- @\'\\t\'@ character.+isHorizontalSpace :: Char -> Bool+isHorizontalSpace c = c == ' ' || c == '\t'+{-# INLINE isHorizontalSpace #-}++-- | Parse and decode an unsigned hexadecimal number. The hex digits+-- @\'a\'@ through @\'f\'@ may be upper or lower case.+--+-- This parser does not accept a leading @\"0x\"@ string.+hexadecimal :: (Integral a, Bits a) => Parser a+hexadecimal = T.foldl' step 0 `fmap` takeWhile1 isHexDigit+ where+ isHexDigit c = (c >= '0' && c <= '9') ||+ (c >= 'a' && c <= 'f') ||+ (c >= 'A' && c <= 'F')+ step a c | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48)+ | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87)+ | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55)+ where w = ord c+{-# SPECIALISE hexadecimal :: Parser Int #-}+{-# SPECIALISE hexadecimal :: Parser Int8 #-}+{-# SPECIALISE hexadecimal :: Parser Int16 #-}+{-# SPECIALISE hexadecimal :: Parser Int32 #-}+{-# SPECIALISE hexadecimal :: Parser Int64 #-}+{-# SPECIALISE hexadecimal :: Parser Integer #-}+{-# SPECIALISE hexadecimal :: Parser Word #-}+{-# SPECIALISE hexadecimal :: Parser Word8 #-}+{-# SPECIALISE hexadecimal :: Parser Word16 #-}+{-# SPECIALISE hexadecimal :: Parser Word32 #-}+{-# SPECIALISE hexadecimal :: Parser Word64 #-}++-- | Parse and decode an unsigned decimal number.+decimal :: Integral a => Parser a+decimal = T.foldl' step 0 `fmap` takeWhile1 isDecimal+ where step a c = a * 10 + fromIntegral (ord c - 48)+{-# SPECIALISE decimal :: Parser Int #-}+{-# SPECIALISE decimal :: Parser Int8 #-}+{-# SPECIALISE decimal :: Parser Int16 #-}+{-# SPECIALISE decimal :: Parser Int32 #-}+{-# SPECIALISE decimal :: Parser Int64 #-}+{-# SPECIALISE decimal :: Parser Integer #-}+{-# SPECIALISE decimal :: Parser Word #-}+{-# SPECIALISE decimal :: Parser Word8 #-}+{-# SPECIALISE decimal :: Parser Word16 #-}+{-# SPECIALISE decimal :: Parser Word32 #-}+{-# SPECIALISE decimal :: Parser Word64 #-}++isDecimal :: Char -> Bool+isDecimal c = c >= '0' && c <= '9'+{-# INLINE isDecimal #-}++-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign+-- character.+signed :: Num a => Parser a -> Parser a+{-# SPECIALISE signed :: Parser Int -> Parser Int #-}+{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-}+{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-}+{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-}+{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-}+{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-}+signed p = (negate <$> (I.char '-' *> p))+ <|> (I.char '+' *> p)+ <|> p++-- | Parse a rational number.+--+-- The syntax accepted by this parser is the same as for 'double'.+--+-- /Note/: this parser is not safe for use with inputs from untrusted+-- sources. An input with a suitably large exponent such as+-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated,+-- resulting in what is effectively a denial-of-service attack.+--+-- In most cases, it is better to use 'double' or 'scientific'+-- instead.+rational :: Fractional a => Parser a+{-# SPECIALIZE rational :: Parser Double #-}+{-# SPECIALIZE rational :: Parser Float #-}+{-# SPECIALIZE rational :: Parser Rational #-}+{-# SPECIALIZE rational :: Parser Scientific #-}+rational = scientifically realToFrac++-- | Parse a 'Double'.+--+-- This parser accepts an optional leading sign character, followed by+-- at most one decimal digit. The syntax is similar to that accepted by+-- the 'read' function, with the exception that a trailing @\'.\'@ is+-- consumed.+--+-- === Examples+--+-- These examples use this helper:+--+-- @+-- r :: 'Parser' a -> 'Data.Text.Text' -> 'Data.Attoparsec.Text.Result' a+-- r p s = 'feed' ('Data.Attoparsec.parse' p s) 'mempty'+-- @+--+-- Examples with behaviour identical to 'read', if you feed an empty+-- continuation to the first result:+--+-- > r double "3" == Done "" 3.0+-- > r double "3.1" == Done "" 3.1+-- > r double "3e4" == Done "" 30000.0+-- > r double "3.1e4" == Done "" 31000.0+-- > r double "3e" == Done "e" 3.0+--+-- Examples with behaviour identical to 'read':+--+-- > r double ".3" == Fail ".3" _ _+-- > r double "e3" == Fail "e3" _ _+--+-- Example of difference from 'read':+--+-- > r double "3.foo" == Done "foo" 3.0+--+-- This function does not accept string representations of \"NaN\" or+-- \"Infinity\".+double :: Parser Double+double = scientifically Sci.toRealFloat++-- | Parse a number, attempting to preserve both speed and precision.+--+-- The syntax accepted by this parser is the same as for 'double'.+--+-- This function does not accept string representations of \"NaN\" or+-- \"Infinity\".+number :: Parser Number+number = scientifically $ \s ->+ let e = Sci.base10Exponent s+ c = Sci.coefficient s+ in if e >= 0+ then I (c * 10 ^ e)+ else D (Sci.toRealFloat s)+{-# DEPRECATED number "Use 'scientific' instead." #-}++-- | Parse a scientific number.+--+-- The syntax accepted by this parser is the same as for 'double'.+scientific :: Parser Scientific+scientific = scientifically id++-- A strict pair+data SP = SP !Integer {-# UNPACK #-}!Int++{-# INLINE scientifically #-}+scientifically :: (Scientific -> a) -> Parser a+scientifically h = do+ !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|>+ pure True++ n <- decimal++ let f fracDigits = SP (T.foldl' step n fracDigits)+ (negate $ T.length fracDigits)+ step a c = a * 10 + fromIntegral (ord c - 48)++ SP c e <- (I.satisfy (=='.') *> (f <$> I.takeWhile isDigit)) <|>+ pure (SP n 0)++ let !signedCoeff | positive = c+ | otherwise = -c++ (I.satisfy (\w -> w == 'e' || w == 'E') *>+ fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|>+ return (h $ Sci.scientific signedCoeff e)++-- | Parse a single digit, as recognised by 'isDigit'.+digit :: Parser Char+digit = I.satisfy isDigit <?> "digit"+{-# INLINE digit #-}++-- | Parse a letter, as recognised by 'isAlpha'.+letter :: Parser Char+letter = I.satisfy isAlpha <?> "letter"+{-# INLINE letter #-}++-- | Parse a space character, as recognised by 'isSpace'.+space :: Parser Char+space = I.satisfy isSpace <?> "space"+{-# INLINE space #-}++-- | Skip over white space.+skipSpace :: Parser ()+skipSpace = I.skipWhile isSpace+{-# INLINE skipSpace #-}++-- $specalt+--+-- If you enable the @OverloadedStrings@ language extension, you can+-- use the '*>' and '<*' combinators to simplify the common task of+-- matching a statically known string, then immediately parsing+-- something else.+--+-- Instead of writing something like this:+--+-- @+--'I.string' \"foo\" '*>' wibble+-- @+--+-- Using @OverloadedStrings@, you can omit the explicit use of+-- 'I.string', and write a more compact version:+--+-- @+-- \"foo\" '*>' wibble+-- @+--+-- (Note: the '.*>' and '<*.' combinators that were originally+-- provided for this purpose are obsolete and unnecessary, and will be+-- removed in the next major version.)++-- | /Obsolete/. A type-specialized version of '*>' for 'Text'. Use+-- '*>' instead.+(.*>) :: Text -> Parser a -> Parser a+s .*> f = I.string s *> f+{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-}++-- | /Obsolete/. A type-specialized version of '<*' for 'Text'. Use+-- '*>' instead.+(<*.) :: Parser a -> Text -> Parser a+f <*. s = f <* I.string s+{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-}
+ Data/Attoparsec/Text/Internal.hs view
@@ -0,0 +1,549 @@+{-# LANGUAGE BangPatterns, FlexibleInstances, GADTs, OverloadedStrings,+ Rank2Types, RecordWildCards, TypeFamilies, TypeSynonymInstances #-}+{-# OPTIONS_GHC -fno-warn-orphans #-}+-- |+-- Module : Data.Attoparsec.Text.Internal+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient parser combinators for 'Text' strings, loosely+-- based on the Parsec library.++module Data.Attoparsec.Text.Internal+ (+ -- * Parser types+ Parser+ , Result++ -- * Running parsers+ , parse+ , parseOnly++ -- * Combinators+ , module Data.Attoparsec.Combinator++ -- * Parsing individual characters+ , satisfy+ , satisfyWith+ , anyChar+ , skip+ , char+ , notChar++ -- ** Lookahead+ , peekChar+ , peekChar'++ -- ** Character classes+ , inClass+ , notInClass++ -- * Efficient string handling+ , skipWhile+ , string+ , stringCI+ , asciiCI+ , take+ , scan+ , runScanner+ , takeWhile+ , takeWhile1+ , takeTill++ -- ** Consume all remaining input+ , takeText+ , takeLazyText++ -- * Utilities+ , endOfLine+ , endOfInput+ , match+ , atEnd+ ) where++import Control.Applicative ((<|>), (<$>), pure, (*>))+import Control.Monad (when)+import Data.Attoparsec.Combinator ((<?>))+import Data.Attoparsec.Internal+import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)+import qualified Data.Attoparsec.Text.Buffer as Buf+import Data.Attoparsec.Text.Buffer (Buffer, buffer)+import Data.Char (isAsciiUpper, isAsciiLower, toUpper, toLower)+import Data.List (intercalate)+import Data.String (IsString(..))+import Data.Text.Internal (Text(..))+import Prelude hiding (getChar, succ, take, takeWhile)+import qualified Data.Attoparsec.Internal.Types as T+import qualified Data.Attoparsec.Text.FastSet as Set+import qualified Data.Text as T+import qualified Data.Text.Lazy as L+import qualified Data.Text.Unsafe as T++type Parser = T.Parser Text+type Result = IResult Text+type Failure r = T.Failure Text Buffer r+type Success a r = T.Success Text Buffer a r++instance (a ~ Text) => IsString (Parser a) where+ fromString = string . T.pack++-- | The parser @satisfy p@ succeeds for any character for which the+-- predicate @p@ returns 'True'. Returns the character that is+-- actually parsed.+--+-- >digit = satisfy isDigit+-- > where isDigit c = c >= '0' && c <= '9'+satisfy :: (Char -> Bool) -> Parser Char+satisfy p = do+ (k,c) <- ensure 1+ let !h = T.unsafeHead c+ if p h+ then advance k >> return h+ else fail "satisfy"+{-# INLINE satisfy #-}++-- | The parser @skip p@ succeeds for any character for which the+-- predicate @p@ returns 'True'.+--+-- >skipDigit = skip isDigit+-- > where isDigit c = c >= '0' && c <= '9'+skip :: (Char -> Bool) -> Parser ()+skip p = do+ (k,s) <- ensure 1+ if p (T.unsafeHead s)+ then advance k+ else fail "skip"++-- | The parser @satisfyWith f p@ transforms a character, and succeeds+-- if the predicate @p@ returns 'True' on the transformed value. The+-- parser returns the transformed character that was parsed.+satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a+satisfyWith f p = do+ (k,s) <- ensure 1+ let c = f $! T.unsafeHead s+ if p c+ then advance k >> return c+ else fail "satisfyWith"+{-# INLINE satisfyWith #-}++-- | Consume @n@ characters of input, but succeed only if the+-- predicate returns 'True'.+takeWith :: Int -> (Text -> Bool) -> Parser Text+takeWith n p = do+ (k,s) <- ensure n+ if p s+ then advance k >> return s+ else fail "takeWith"++-- | Consume exactly @n@ characters of input.+take :: Int -> Parser Text+take n = takeWith (max n 0) (const True)+{-# INLINE take #-}++-- | @string s@ parses a sequence of characters that identically match+-- @s@. Returns the parsed string (i.e. @s@). This parser consumes no+-- input if it fails (even if a partial match).+--+-- /Note/: The behaviour of this parser is different to that of the+-- similarly-named parser in Parsec, as this one is all-or-nothing.+-- To illustrate the difference, the following parser will fail under+-- Parsec given an input of @\"for\"@:+--+-- >string "foo" <|> string "for"+--+-- The reason for its failure is that the first branch is a+-- partial match, and will consume the letters @\'f\'@ and @\'o\'@+-- before failing. In attoparsec, the above parser will /succeed/ on+-- that input, because the failed first branch will consume nothing.+string :: Text -> Parser Text+string s = string_ (stringSuspended id) id s+{-# INLINE string #-}++string_ :: (forall r. Text -> Text -> Buffer -> Pos -> More+ -> Failure r -> Success Text r -> Result r)+ -> (Text -> Text)+ -> Text -> Parser Text+string_ suspended f s0 = T.Parser $ \t pos more lose succ ->+ let s = f s0+ ft = f (Buf.unbufferAt (fromPos pos) t)+ in case T.commonPrefixes s ft of+ Nothing+ | T.null s -> succ t pos more T.empty+ | T.null ft -> suspended s s t pos more lose succ+ | otherwise -> lose t pos more [] "string"+ Just (pfx,ssfx,tsfx)+ | T.null ssfx -> let l = Pos (Buf.lengthCodeUnits pfx)+ in succ t (pos + l) more (substring pos l t)+ | not (T.null tsfx) -> lose t pos more [] "string"+ | otherwise -> suspended s ssfx t pos more lose succ+{-# INLINE string_ #-}++stringSuspended :: (Text -> Text)+ -> Text -> Text -> Buffer -> Pos -> More+ -> Failure r+ -> Success Text r+ -> Result r+stringSuspended f s000 s0 t0 pos0 more0 lose0 succ0 =+ runParser (demandInput_ >>= go) t0 pos0 more0 lose0 succ0+ where+ go s' = T.Parser $ \t pos more lose succ ->+ let s = f s'+ in case T.commonPrefixes s0 s of+ Nothing -> lose t pos more [] "string"+ Just (_pfx,ssfx,tsfx)+ | T.null ssfx -> let l = Pos (Buf.lengthCodeUnits s000)+ in succ t (pos + l) more (substring pos l t)+ | T.null tsfx -> stringSuspended f s000 ssfx t pos more lose succ+ | otherwise -> lose t pos more [] "string"++-- | Satisfy a literal string, ignoring case.+--+-- Note: this function is currently quite inefficient. Unicode case+-- folding can change the length of a string (\"ß\" becomes+-- "ss"), which makes a simple, efficient implementation tricky. We+-- have (for now) chosen simplicity over efficiency.+stringCI :: Text -> Parser Text+stringCI s = go 0+ where+ go !n+ | n > T.length fs = fail "stringCI"+ | otherwise = do+ (k,t) <- ensure n+ if T.toCaseFold t == fs+ then advance k >> return t+ else go (n+1)+ fs = T.toCaseFold s+{-# INLINE stringCI #-}+{-# DEPRECATED stringCI "this is very inefficient, use asciiCI instead" #-}++-- | Satisfy a literal string, ignoring case for characters in the ASCII range.+asciiCI :: Text -> Parser Text+asciiCI s = fmap fst $ match $ T.foldr ((*>) . asciiCharCI) (pure ()) s+{-# INLINE asciiCI #-}++asciiCharCI :: Char -> Parser Char+asciiCharCI c+ | isAsciiUpper c = char c <|> char (toLower c)+ | isAsciiLower c = char c <|> char (toUpper c)+ | otherwise = char c+{-# INLINE asciiCharCI #-}++-- | Skip past input for as long as the predicate returns 'True'.+skipWhile :: (Char -> Bool) -> Parser ()+skipWhile p = go+ where+ go = do+ t <- T.takeWhile p <$> get+ continue <- inputSpansChunks (size t)+ when continue go+{-# INLINE skipWhile #-}++-- | Consume input as long as the predicate returns 'False'+-- (i.e. until it returns 'True'), and return the consumed input.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'True' on the first character of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+takeTill :: (Char -> Bool) -> Parser Text+takeTill p = takeWhile (not . p)+{-# INLINE takeTill #-}++-- | Consume input as long as the predicate returns 'True', and return+-- the consumed input.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'False' on the first character of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+takeWhile :: (Char -> Bool) -> Parser Text+takeWhile p = do+ h <- T.takeWhile p <$> get+ continue <- inputSpansChunks (size h)+ -- only use slow concat path if necessary+ if continue+ then takeWhileAcc p [h]+ else return h+{-# INLINE takeWhile #-}++takeWhileAcc :: (Char -> Bool) -> [Text] -> Parser Text+takeWhileAcc p = go+ where+ go acc = do+ h <- T.takeWhile p <$> get+ continue <- inputSpansChunks (size h)+ if continue+ then go (h:acc)+ else return $ concatReverse (h:acc)+{-# INLINE takeWhileAcc #-}++takeRest :: Parser [Text]+takeRest = go []+ where+ go acc = do+ input <- wantInput+ if input+ then do+ s <- get+ advance (size s)+ go (s:acc)+ else return (reverse acc)++-- | Consume all remaining input and return it as a single string.+takeText :: Parser Text+takeText = T.concat `fmap` takeRest++-- | Consume all remaining input and return it as a single string.+takeLazyText :: Parser L.Text+takeLazyText = L.fromChunks `fmap` takeRest++data Scan s = Continue s+ | Finished s {-# UNPACK #-} !Int Text++scan_ :: (s -> [Text] -> Parser r) -> s -> (s -> Char -> Maybe s) -> Parser r+scan_ f s0 p = go [] s0+ where+ scanner s !n t =+ case T.uncons t of+ Just (c,t') -> case p s c of+ Just s' -> scanner s' (n+1) t'+ Nothing -> Finished s n t+ Nothing -> Continue s+ go acc s = do+ input <- get+ case scanner s 0 input of+ Continue s' -> do continue <- inputSpansChunks (size input)+ if continue+ then go (input : acc) s'+ else f s' (input : acc)+ Finished s' n t -> do advance (size input - size t)+ f s' (T.take n input : acc)+{-# INLINE scan_ #-}++-- | A stateful scanner. The predicate consumes and transforms a+-- state argument, and each transformed state is passed to successive+-- invocations of the predicate on each character of the input until one+-- returns 'Nothing' or the input ends.+--+-- This parser does not fail. It will return an empty string if the+-- predicate returns 'Nothing' on the first character of input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+scan :: s -> (s -> Char -> Maybe s) -> Parser Text+scan = scan_ $ \_ chunks -> return $! concatReverse chunks+{-# INLINE scan #-}++-- | Like 'scan', but generalized to return the final state of the+-- scanner.+runScanner :: s -> (s -> Char -> Maybe s) -> Parser (Text, s)+runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s)+{-# INLINE runScanner #-}++-- | Consume input as long as the predicate returns 'True', and return+-- the consumed input.+--+-- This parser requires the predicate to succeed on at least one+-- character of input: it will fail if the predicate never returns+-- 'True' or if there is no input left.+takeWhile1 :: (Char -> Bool) -> Parser Text+takeWhile1 p = do+ (`when` demandInput) =<< endOfChunk+ h <- T.takeWhile p <$> get+ let size' = size h+ when (size' == 0) $ fail "takeWhile1"+ advance size'+ eoc <- endOfChunk+ if eoc+ then takeWhileAcc p [h]+ else return h+{-# INLINE takeWhile1 #-}++-- | Match any character in a set.+--+-- >vowel = inClass "aeiou"+--+-- Range notation is supported.+--+-- >halfAlphabet = inClass "a-nA-N"+--+-- To add a literal @\'-\'@ to a set, place it at the beginning or end+-- of the string.+inClass :: String -> Char -> Bool+inClass s = (`Set.member` mySet)+ where mySet = Set.charClass s+ {-# NOINLINE mySet #-}+{-# INLINE inClass #-}++-- | Match any character not in a set.+notInClass :: String -> Char -> Bool+notInClass s = not . inClass s+{-# INLINE notInClass #-}++-- | Match any character.+anyChar :: Parser Char+anyChar = satisfy $ const True+{-# INLINE anyChar #-}++-- | Match a specific character.+char :: Char -> Parser Char+char c = satisfy (== c) <?> show c+{-# INLINE char #-}++-- | Match any character except the given one.+notChar :: Char -> Parser Char+notChar c = satisfy (/= c) <?> "not " ++ show c+{-# INLINE notChar #-}++-- | Match any character, to perform lookahead. Returns 'Nothing' if+-- end of input has been reached. Does not consume any input.+--+-- /Note/: Because this parser does not fail, do not use it with+-- combinators such as 'Control.Applicative.many', because such+-- parsers loop until a failure occurs. Careless use will thus result+-- in an infinite loop.+peekChar :: Parser (Maybe Char)+peekChar = T.Parser $ \t pos more _lose succ ->+ case () of+ _| pos < lengthOf t ->+ let T.Iter !c _ = Buf.iter t (fromPos pos)+ in succ t pos more (Just c)+ | more == Complete ->+ succ t pos more Nothing+ | otherwise ->+ let succ' t' pos' more' =+ let T.Iter !c _ = Buf.iter t' (fromPos pos')+ in succ t' pos' more' (Just c)+ lose' t' pos' more' = succ t' pos' more' Nothing+ in prompt t pos more lose' succ'+{-# INLINE peekChar #-}++-- | Match any character, to perform lookahead. Does not consume any+-- input, but will fail if end of input has been reached.+peekChar' :: Parser Char+peekChar' = do+ (_,s) <- ensure 1+ return $! T.unsafeHead s+{-# INLINE peekChar' #-}++-- | Match either a single newline character @\'\\n\'@, or a carriage+-- return followed by a newline character @\"\\r\\n\"@.+endOfLine :: Parser ()+endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ())++-- | Terminal failure continuation.+failK :: Failure a+failK t (Pos pos) _more stack msg = Fail (Buf.dropCodeUnits pos t) stack msg+{-# INLINE failK #-}++-- | Terminal success continuation.+successK :: Success a a+successK t (Pos pos) _more a = Done (Buf.dropCodeUnits pos t) a+{-# INLINE successK #-}++-- | Run a parser.+parse :: Parser a -> Text -> Result a+parse m s = runParser m (buffer s) 0 Incomplete failK successK+{-# INLINE parse #-}++-- | Run a parser that cannot be resupplied via a 'Partial' result.+--+-- This function does not force a parser to consume all of its input.+-- Instead, any residual input will be discarded. To force a parser+-- to consume all of its input, use something like this:+--+-- @+--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')+-- @+parseOnly :: Parser a -> Text -> Either String a+parseOnly m s = case runParser m (buffer s) 0 Complete failK successK of+ Fail _ [] err -> Left err+ Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)+ Done _ a -> Right a+ _ -> error "parseOnly: impossible error!"+{-# INLINE parseOnly #-}++get :: Parser Text+get = T.Parser $ \t pos more _lose succ ->+ succ t pos more (Buf.dropCodeUnits (fromPos pos) t)+{-# INLINE get #-}++endOfChunk :: Parser Bool+endOfChunk = T.Parser $ \t pos more _lose succ ->+ succ t pos more (pos == lengthOf t)+{-# INLINE endOfChunk #-}++inputSpansChunks :: Pos -> Parser Bool+inputSpansChunks i = T.Parser $ \t pos_ more _lose succ ->+ let pos = pos_ + i+ in if pos < lengthOf t || more == Complete+ then succ t pos more False+ else let lose' t' pos' more' = succ t' pos' more' False+ succ' t' pos' more' = succ t' pos' more' True+ in prompt t pos more lose' succ'+{-# INLINE inputSpansChunks #-}++advance :: Pos -> Parser ()+advance n = T.Parser $ \t pos more _lose succ -> succ t (pos+n) more ()+{-# INLINE advance #-}++ensureSuspended :: Int -> Buffer -> Pos -> More+ -> Failure r -> Success (Pos, Text) r+ -> Result r+ensureSuspended n t pos more lose succ =+ runParser (demandInput >> go) t pos more lose succ+ where go = T.Parser $ \t' pos' more' lose' succ' ->+ case lengthAtLeast pos' n t' of+ Just n' -> succ' t' pos' more' (n', substring pos n' t')+ Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ'++-- | If at least @n@ elements of input are available, return the+-- current input, otherwise fail.+ensure :: Int -> Parser (Pos, Text)+ensure n = T.Parser $ \t pos more lose succ ->+ case lengthAtLeast pos n t of+ Just n' -> succ t pos more (n', substring pos n' t)+ -- The uncommon case is kept out-of-line to reduce code size:+ Nothing -> ensureSuspended n t pos more lose succ+{-# INLINE ensure #-}++-- | Return both the result of a parse and the portion of the input+-- that was consumed while it was being parsed.+match :: Parser a -> Parser (Text, a)+match p = T.Parser $ \t pos more lose succ ->+ let succ' t' pos' more' a = succ t' pos' more'+ (substring pos (pos'-pos) t', a)+ in runParser p t pos more lose succ'++-- | Ensure that at least @n@ code points of input are available.+-- Returns the number of words consumed while traversing.+lengthAtLeast :: Pos -> Int -> Buffer -> Maybe Pos+lengthAtLeast pos n t = go 0 (fromPos pos)+ where go i !p+ | i == n = Just (Pos p - pos)+ | p == len = Nothing+ | otherwise = go (i+1) (p + Buf.iter_ t p)+ Pos len = lengthOf t+{-# INLINE lengthAtLeast #-}++substring :: Pos -> Pos -> Buffer -> Text+substring (Pos pos) (Pos n) = Buf.substring pos n+{-# INLINE substring #-}++lengthOf :: Buffer -> Pos+lengthOf = Pos . Buf.length++size :: Text -> Pos+size (Text _ _ l) = Pos l
+ Data/Attoparsec/Text/Lazy.hs view
@@ -0,0 +1,115 @@+{-# LANGUAGE CPP #-}+#if __GLASGOW_HASKELL__ >= 702+{-# LANGUAGE Trustworthy #-} -- Imports internal modules+#endif++{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}+-- |+-- Module : Data.Attoparsec.Text.Lazy+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient combinator parsing that can consume lazy 'Text'+-- strings, loosely based on the Parsec library.+--+-- This is essentially the same code as in the 'Data.Attoparsec.Text'+-- module, only with a 'parse' function that can consume a lazy+-- 'Text' incrementally, and a 'Result' type that does not allow+-- more input to be fed in. Think of this as suitable for use with a+-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'.+--+-- /Note:/ The various parser functions and combinators such as+-- 'string' still expect /strict/ 'T.Text' parameters, and return+-- strict 'T.Text' results. Behind the scenes, strict 'T.Text' values+-- are still used internally to store parser input and manipulate it+-- efficiently.++module Data.Attoparsec.Text.Lazy+ (+ Result(..)+ , module Data.Attoparsec.Text+ -- * Running parsers+ , parse+ , parseOnly+ , parseTest+ -- ** Result conversion+ , maybeResult+ , eitherResult+ ) where++import Control.DeepSeq (NFData(rnf))+import Data.List (intercalate)+import Data.Text.Lazy.Internal (Text(..), chunk)+import qualified Data.Attoparsec.Internal.Types as T+import qualified Data.Attoparsec.Text as A+import qualified Data.Text as T+import Data.Attoparsec.Text hiding (IResult(..), Result, eitherResult,+ maybeResult, parse, parseOnly, parseWith, parseTest)++-- | The result of a parse.+data Result r = Fail Text [String] String+ -- ^ The parse failed. The 'Text' is the input+ -- that had not yet been consumed when the failure+ -- occurred. The @[@'String'@]@ is a list of contexts+ -- in which the error occurred. The 'String' is the+ -- message describing the error, if any.+ | Done Text r+ -- ^ The parse succeeded. The 'Text' is the+ -- input that had not yet been consumed (if any) when+ -- the parse succeeded.+ deriving (Show)++instance NFData r => NFData (Result r) where+ rnf (Fail bs ctxs msg) = rnf bs `seq` rnf ctxs `seq` rnf msg+ rnf (Done bs r) = rnf bs `seq` rnf r+ {-# INLINE rnf #-}++fmapR :: (a -> b) -> Result a -> Result b+fmapR _ (Fail st stk msg) = Fail st stk msg+fmapR f (Done bs r) = Done bs (f r)++instance Functor Result where+ fmap = fmapR++-- | Run a parser and return its result.+parse :: A.Parser a -> Text -> Result a+parse p s = case s of+ Chunk x xs -> go (A.parse p x) xs+ empty -> go (A.parse p T.empty) empty+ where+ go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg+ go (T.Done x r) ys = Done (chunk x ys) r+ go (T.Partial k) (Chunk y ys) = go (k y) ys+ go (T.Partial k) empty = go (k T.empty) empty++-- | Run a parser and print its result to standard output.+parseTest :: (Show a) => A.Parser a -> Text -> IO ()+parseTest p s = print (parse p s)++-- | Convert a 'Result' value to a 'Maybe' value.+maybeResult :: Result r -> Maybe r+maybeResult (Done _ r) = Just r+maybeResult _ = Nothing++-- | Convert a 'Result' value to an 'Either' value.+eitherResult :: Result r -> Either String r+eitherResult (Done _ r) = Right r+eitherResult (Fail _ [] msg) = Left msg+eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)++-- | Run a parser that cannot be resupplied via a 'T.Partial' result.+--+-- This function does not force a parser to consume all of its input.+-- Instead, any residual input will be discarded. To force a parser+-- to consume all of its input, use something like this:+--+-- @+--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput')+-- @+parseOnly :: A.Parser a -> Text -> Either String a+parseOnly p = eitherResult . parse p+{-# INLINE parseOnly #-}
+ Data/Attoparsec/Types.hs view
@@ -0,0 +1,20 @@+-- |+-- Module : Data.Attoparsec.Types+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Simple, efficient parser combinators for strings, loosely based on+-- the Parsec library.++module Data.Attoparsec.Types+ (+ Parser+ , IResult(..)+ , Chunk(chunkElemToChar)+ ) where++import Data.Attoparsec.Internal.Types (Parser(..), IResult(..), Chunk(..))
Data/Attoparsec/Zepto.hs view
@@ -1,10 +1,14 @@-{-# LANGUAGE BangPatterns, MagicHash, UnboxedTuples #-}+{-# LANGUAGE CPP #-}+#if __GLASGOW_HASKELL__ >= 702+{-# LANGUAGE Trustworthy #-} -- Data.ByteString.Unsafe+#endif+{-# LANGUAGE BangPatterns #-} -- | -- Module : Data.Attoparsec.Zepto--- Copyright : Bryan O'Sullivan 2011+-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3--- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown@@ -12,112 +16,150 @@ -- A tiny, highly specialized combinator parser for 'B.ByteString' -- strings. ----- While the main Attoparsec module generally performs well, this+-- While the main attoparsec module generally performs well, this -- module is particularly fast for simple non-recursive loops that -- should not normally result in failed parses. -- -- /Warning/: on more complex inputs involving recursion or failure, -- parsers based on this module may be as much as /ten times slower/--- than regular Attoparsec! You should /only/ use this module when you+-- than regular attoparsec! You should /only/ use this module when you -- have benchmarks that prove that its use speeds your code up. module Data.Attoparsec.Zepto ( Parser+ , ZeptoT , parse+ , parseT , atEnd , string , take , takeWhile ) where -import Data.Word (Word8) import Control.Applicative-import Control.Monad-import Data.Monoid-import qualified Data.ByteString as B-import qualified Data.ByteString.Unsafe as B+import Control.Monad (MonadPlus(..), ap)+import qualified Control.Monad.Fail as Fail+import Control.Monad.IO.Class (MonadIO(..)) import Data.ByteString (ByteString)+import Data.Functor.Identity (Identity(runIdentity))+import Data.Monoid as Mon (Monoid(..))+import Data.Semigroup (Semigroup(..))+import Data.Word (Word8) import Prelude hiding (take, takeWhile)+import qualified Data.ByteString as B+import qualified Data.ByteString.Unsafe as B newtype S = S { input :: ByteString } data Result a = Fail String- | OK !a+ | OK !a S -- | A simple parser. -- -- This monad is strict in its state, and the monadic bind operator -- ('>>=') evaluates each result to weak head normal form before -- passing it along.-newtype Parser a = Parser {- runParser :: S -> (# Result a, S #)+newtype ZeptoT m a = Parser {+ runParser :: S -> m (Result a) } -instance Functor Parser where- fmap f m = Parser $ \s -> case runParser m s of- (# OK a, s' #) -> (# OK (f a), s' #)- (# Fail err, s' #) -> (# Fail err, s' #)+type Parser a = ZeptoT Identity a++instance Monad m => Functor (ZeptoT m) where+ fmap f m = Parser $ \s -> do+ result <- runParser m s+ case result of+ OK a s' -> return (OK (f a) s')+ Fail err -> return (Fail err) {-# INLINE fmap #-} -instance Monad Parser where- return a = Parser $ \s -> (# OK a, s #)+instance MonadIO m => MonadIO (ZeptoT m) where+ liftIO act = Parser $ \s -> do+ result <- liftIO act+ return (OK result s)+ {-# INLINE liftIO #-}++instance Monad m => Monad (ZeptoT m) where+ return = pure {-# INLINE return #-} - m >>= k = Parser $ \s -> case runParser m s of- (# OK a, s' #) -> runParser (k a) s'- (# Fail err, s' #) -> (# Fail err, s' #)+ m >>= k = Parser $ \s -> do+ result <- runParser m s+ case result of+ OK a s' -> runParser (k a) s'+ Fail err -> return (Fail err) {-# INLINE (>>=) #-} - fail msg = Parser $ \s -> (# Fail msg, s #)+#if !(MIN_VERSION_base(4,13,0))+ fail = Fail.fail+ {-# INLINE fail #-}+#endif -instance MonadPlus Parser where+instance Monad m => Fail.MonadFail (ZeptoT m) where+ fail msg = Parser $ \_ -> return (Fail msg)+ {-# INLINE fail #-}++instance Monad m => MonadPlus (ZeptoT m) where mzero = fail "mzero" {-# INLINE mzero #-} - mplus a b = Parser $ \s ->- case runParser a s of- (# ok@(OK _), s' #) -> (# ok, s' #)- (# _, _ #) -> case runParser b s of- (# ok@(OK _), s'' #) -> (# ok, s'' #)- (# err, s'' #) -> (# err, s'' #)+ mplus a b = Parser $ \s -> do+ result <- runParser a s+ case result of+ ok@(OK _ _) -> return ok+ _ -> runParser b s {-# INLINE mplus #-} -instance Applicative Parser where- pure = return+instance (Monad m) => Applicative (ZeptoT m) where+ pure a = Parser $ \s -> return (OK a s) {-# INLINE pure #-} (<*>) = ap {-# INLINE (<*>) #-} -gets :: (S -> a) -> Parser a-gets f = Parser $ \s -> (# OK (f s), s #)+gets :: Monad m => (S -> a) -> ZeptoT m a+gets f = Parser $ \s -> return (OK (f s) s) {-# INLINE gets #-} -put :: S -> Parser ()-put s = Parser $ \_ -> (# OK (), s #)+put :: Monad m => S -> ZeptoT m ()+put s = Parser $ \_ -> return (OK () s) {-# INLINE put #-} -- | Run a parser. parse :: Parser a -> ByteString -> Either String a-parse p bs = case runParser p (S bs) of- (# OK a, _ #) -> Right a- (# Fail err, _ #) -> Left err+parse p bs = case runIdentity (runParser p (S bs)) of+ (OK a _) -> Right a+ (Fail err) -> Left err+{-# INLINE parse #-} -instance Monoid (Parser a) where+-- | Run a parser on top of the given base monad.+parseT :: Monad m => ZeptoT m a -> ByteString -> m (Either String a)+parseT p bs = do+ result <- runParser p (S bs)+ case result of+ OK a _ -> return (Right a)+ Fail err -> return (Left err)+{-# INLINE parseT #-}++instance Monad m => Semigroup (ZeptoT m a) where+ (<>) = mplus+ {-# INLINE (<>) #-}++instance Monad m => Mon.Monoid (ZeptoT m a) where mempty = fail "mempty" {-# INLINE mempty #-}- mappend = mplus+ mappend = (<>) {-# INLINE mappend #-} -instance Alternative Parser where+instance Monad m => Alternative (ZeptoT m) where empty = fail "empty" {-# INLINE empty #-} (<|>) = mplus {-# INLINE (<|>) #-} -- | Consume input while the predicate returns 'True'.-takeWhile :: (Word8 -> Bool) -> Parser ByteString+takeWhile :: Monad m => (Word8 -> Bool) -> ZeptoT m ByteString takeWhile p = do (h,t) <- gets (B.span p . input) put (S t)@@ -125,7 +167,7 @@ {-# INLINE takeWhile #-} -- | Consume @n@ bytes of input.-take :: Int -> Parser ByteString+take :: Monad m => Int -> ZeptoT m ByteString take !n = do s <- gets input if B.length s >= n@@ -134,7 +176,7 @@ {-# INLINE take #-} -- | Match a string exactly.-string :: ByteString -> Parser ()+string :: Monad m => ByteString -> ZeptoT m () string s = do i <- gets input if s `B.isPrefixOf` i@@ -143,7 +185,7 @@ {-# INLINE string #-} -- | Indicate whether the end of the input has been reached.-atEnd :: Parser Bool+atEnd :: Monad m => ZeptoT m Bool atEnd = do i <- gets input return $! B.null i
README.markdown view
@@ -10,17 +10,11 @@ and other improvements. Please report bugs via the-[bitbucket issue tracker](http://bitbucket.org/bos/attoparsec/issues).--Master [Mercurial repository](http://bitbucket.org/bos/attoparsec):--* `hg clone http://bitbucket.org/bos/attoparsec`+[github issue tracker](https://github.com/bos/attoparsec/issues). -There's also a [git mirror](http://github.com/bos/attoparsec):+Master [git repository](https://github.com/bos/attoparsec): * `git clone git://github.com/bos/attoparsec.git`--(You can create and contribute changes using either Mercurial or git.) Authors -------
attoparsec.cabal view
@@ -1,16 +1,16 @@ name: attoparsec-version: 0.8.6.1+version: 0.14.4 license: BSD3 license-file: LICENSE category: Text, Parsing author: Bryan O'Sullivan <bos@serpentine.com>-maintainer: Bryan O'Sullivan <bos@serpentine.com>+maintainer: Bryan O'Sullivan <bos@serpentine.com>, Ben Gamari <ben@smart-cactus.org> stability: experimental-tested-with: GHC == 6.10.4, GHC == 6.12.3, GHC == 7.0.3-synopsis: Fast combinator parsing for bytestrings-cabal-version: >= 1.6-homepage: https://bitbucket.org/bos/attoparsec-bug-reports: https://bitbucket.org/bos/attoparsec/issues+tested-with: GHC == 7.4.2, GHC ==7.6.3, GHC ==7.8.4, GHC ==7.10.3, GHC ==8.0.2, GHC ==8.2.2, GHC==8.4.4, GHC==8.6.5, GHC==8.8.4, GHC==8.10.7, GHC ==9.0.2, GHC ==9.2.1+synopsis: Fast combinator parsing for bytestrings and text+cabal-version: 2.0+homepage: https://github.com/bgamari/attoparsec+bug-reports: https://github.com/bgamari/attoparsec/issues build-type: Simple description: A fast parser combinator library, aimed particularly at dealing@@ -18,61 +18,180 @@ file formats. extra-source-files: README.markdown+ benchmarks/*.txt+ benchmarks/json-data/*.json benchmarks/Makefile- benchmarks/Tiny.hs benchmarks/med.txt.bz2- tests/Makefile- tests/QC.hs- tests/QCSupport.hs- tests/TestFastSet.hs+ changelog.md+ examples/*.c+ examples/*.hs examples/Makefile- examples/Parsec_RFC2616.hs- examples/RFC2616.hs- examples/TestRFC2616.hs- examples/rfc2616.c Flag developer Description: Whether to build the library in development mode Default: False+ Manual: True -flag split-base-flag applicative-in-base+-- We need to test and benchmark these modules,+-- but do not want to expose them to end users+library attoparsec-internal+ hs-source-dirs: internal+ build-depends: array,+ base >= 4.3 && < 5,+ bytestring <0.12,+ text >= 1.1.1.3+ if !impl(ghc >= 8.0)+ build-depends: semigroups >=0.16.1 && <0.21+ exposed-modules: Data.Attoparsec.ByteString.Buffer+ Data.Attoparsec.ByteString.FastSet+ Data.Attoparsec.Internal.Compat+ Data.Attoparsec.Internal.Fhthagn+ Data.Attoparsec.Text.Buffer+ Data.Attoparsec.Text.FastSet+ ghc-options: -O2 -Wall+ default-language: Haskell2010 library- if flag(split-base)- -- bytestring was in base-2.0 and 2.1.1- build-depends: base >= 2.0 && < 2.2- else- -- in base 1.0 and >= 3.0 bytestring is a separate package- build-depends: base < 2.0 || >= 3, bytestring >= 0.9, containers >= 0.1.0.1-- if flag(applicative-in-base)- build-depends: base >= 2.0 && < 5.0- cpp-options: -DAPPLICATIVE_IN_BASE- else- build-depends: base < 2.0+ build-depends: array,+ base >= 4.3 && < 5,+ bytestring <0.12,+ containers,+ deepseq,+ scientific >= 0.3.1 && < 0.4,+ transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.7,+ text >= 1.1.1.3,+ ghc-prim <0.9,+ attoparsec-internal+ if impl(ghc < 7.4)+ build-depends:+ bytestring < 0.10.4.0 - build-depends: deepseq+ if !impl(ghc >= 8.0)+ -- Data.Semigroup && Control.Monad.Fail are available in base-4.9++ build-depends: fail == 4.9.*,+ semigroups >=0.16.1 && <0.21 - extensions: CPP exposed-modules: Data.Attoparsec+ Data.Attoparsec.ByteString+ Data.Attoparsec.ByteString.Char8+ Data.Attoparsec.ByteString.Lazy Data.Attoparsec.Char8 Data.Attoparsec.Combinator- Data.Attoparsec.FastSet+ Data.Attoparsec.Internal+ Data.Attoparsec.Internal.Types Data.Attoparsec.Lazy Data.Attoparsec.Number+ Data.Attoparsec.Text+ Data.Attoparsec.Text.Lazy+ Data.Attoparsec.Types Data.Attoparsec.Zepto- other-modules: Data.Attoparsec.Internal- Data.Attoparsec.Internal.Types- ghc-options: -Wall+ other-modules: Data.Attoparsec.ByteString.Internal+ Data.Attoparsec.Text.Internal+ ghc-options: -O2 -Wall + default-language: Haskell2010+ if flag(developer) ghc-prof-options: -auto-all+ ghc-options: -Werror -source-repository head- type: mercurial- location: https://bitbucket.org/bos/attoparsec+test-suite attoparsec-tests+ type: exitcode-stdio-1.0+ hs-source-dirs: tests+ main-is: QC.hs+ other-modules: QC.Buffer+ QC.ByteString+ QC.Combinator+ QC.Common+ QC.IPv6.Internal+ QC.IPv6.Types+ QC.Rechunked+ QC.Simple+ QC.Text+ QC.Text.FastSet+ QC.Text.Regressions + ghc-options:+ -Wall -threaded -rtsopts++ if flag(developer)+ ghc-options: -Werror++ build-depends:+ array,+ attoparsec,+ attoparsec-internal,+ base,+ bytestring,+ deepseq >= 1.1,+ QuickCheck >= 2.13.2 && < 2.15,+ quickcheck-unicode,+ scientific,+ tasty >= 0.11,+ tasty-quickcheck >= 0.8,+ text,+ transformers,+ vector++ default-language: Haskell2010++ if !impl(ghc >= 8.0)+ -- Data.Semigroup && Control.Monad.Fail are available in base-4.9++ build-depends: fail == 4.9.*,+ semigroups >=0.16.1 && <0.19++benchmark attoparsec-benchmarks+ type: exitcode-stdio-1.0+ hs-source-dirs: benchmarks benchmarks/warp-3.0.1.1+ ghc-options: -O2 -Wall -rtsopts+ main-is: Benchmarks.hs+ other-modules:+ Aeson+ Common+ Genome+ HeadersByteString+ HeadersByteString.Atto+ HeadersText+ Links+ Network.Wai.Handler.Warp.ReadInt+ Network.Wai.Handler.Warp.RequestHeader+ Numbers+ Sets+ TextFastSet+ Warp+ ghc-options: -O2 -Wall++ if flag(developer)+ ghc-options: -Werror++ build-depends:+ array,+ attoparsec,+ attoparsec-internal,+ base == 4.*,+ bytestring >= 0.10.4.0,+ case-insensitive,+ containers,+ deepseq >= 1.1,+ directory,+ filepath,+ ghc-prim,+ http-types,+ parsec >= 3.1.2,+ scientific,+ tasty-bench >= 0.3,+ text >= 1.1.1.0,+ transformers,+ unordered-containers,+ vector++ default-language: Haskell2010++ if !impl(ghc >= 8.0)+ -- Data.Semigroup && Control.Monad.Fail are available in base-4.9++ build-depends: fail == 4.9.*,+ semigroups >=0.16.1 && <0.19+ source-repository head type: git- location: https://github.com/bos/attoparsec+ location: https://github.com/bgamari/attoparsec
+ benchmarks/Aeson.hs view
@@ -0,0 +1,353 @@+{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}+{-# OPTIONS_GHC -fno-warn-unused-binds #-}++module Aeson+ (+ aeson+ , value'+ ) where++import Data.ByteString.Builder+ (Builder, byteString, toLazyByteString, charUtf8, word8)++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((*>), (<$>), (<*), pure)+import Data.Monoid (mappend, mempty)+#endif++import Common (pathTo)+import Control.Applicative (liftA2)+import Control.DeepSeq (NFData(..))+import Control.Monad (forM)+import Data.Attoparsec.ByteString.Char8 (Parser, char, endOfInput, scientific,+ skipSpace, string)+import Data.Bits ((.|.), shiftL)+import Data.ByteString (ByteString)+import Data.Char (chr)+import Data.List (sort)+import Data.Scientific (Scientific)+import Data.Text (Text)+import Data.Text.Encoding (decodeUtf8')+import Data.Vector as Vector (Vector, foldl', fromList)+import Data.Word (Word8)+import System.Directory (getDirectoryContents)+import System.FilePath ((</>), dropExtension)+import qualified Data.Attoparsec.ByteString as A+import qualified Data.Attoparsec.Lazy as L+import qualified Data.Attoparsec.Zepto as Z+import qualified Data.ByteString as B+import qualified Data.ByteString.Lazy as L+import qualified Data.ByteString.Unsafe as B+import qualified Data.HashMap.Strict as H+import Test.Tasty.Bench++#define BACKSLASH 92+#define CLOSE_CURLY 125+#define CLOSE_SQUARE 93+#define COMMA 44+#define DOUBLE_QUOTE 34+#define OPEN_CURLY 123+#define OPEN_SQUARE 91+#define C_0 48+#define C_9 57+#define C_A 65+#define C_F 70+#define C_a 97+#define C_f 102+#define C_n 110+#define C_t 116++data Result a = Error String+ | Success a+ deriving (Eq, Show)+++-- | A JSON \"object\" (key\/value map).+type Object = H.HashMap Text Value++-- | A JSON \"array\" (sequence).+type Array = Vector Value++-- | A JSON value represented as a Haskell value.+data Value = Object !Object+ | Array !Array+ | String !Text+ | Number !Scientific+ | Bool !Bool+ | Null+ deriving (Eq, Show)++instance NFData Value where+ rnf (Object o) = rnf o+ rnf (Array a) = Vector.foldl' (\x y -> rnf y `seq` x) () a+ rnf (String s) = rnf s+ rnf (Number n) = rnf n+ rnf (Bool b) = rnf b+ rnf Null = ()++-- | Parse a top-level JSON value. This must be either an object or+-- an array, per RFC 4627.+--+-- The conversion of a parsed value to a Haskell value is deferred+-- until the Haskell value is needed. This may improve performance if+-- only a subset of the results of conversions are needed, but at a+-- cost in thunk allocation.+json :: Parser Value+json = json_ object_ array_++-- | Parse a top-level JSON value. This must be either an object or+-- an array, per RFC 4627.+--+-- This is a strict version of 'json' which avoids building up thunks+-- during parsing; it performs all conversions immediately. Prefer+-- this version if most of the JSON data needs to be accessed.+json' :: Parser Value+json' = json_ object_' array_'++json_ :: Parser Value -> Parser Value -> Parser Value+json_ obj ary = do+ w <- skipSpace *> A.satisfy (\w -> w == OPEN_CURLY || w == OPEN_SQUARE)+ if w == OPEN_CURLY+ then obj+ else ary+{-# INLINE json_ #-}++object_ :: Parser Value+object_ = {-# SCC "object_" #-} Object <$> objectValues jstring value++object_' :: Parser Value+object_' = {-# SCC "object_'" #-} do+ !vals <- objectValues jstring' value'+ return (Object vals)+ where+ jstring' = do+ !s <- jstring+ return s++objectValues :: Parser Text -> Parser Value -> Parser (H.HashMap Text Value)+objectValues str val = do+ skipSpace+ let pair = liftA2 (,) (str <* skipSpace) (char ':' *> skipSpace *> val)+ H.fromList <$> commaSeparated pair CLOSE_CURLY+{-# INLINE objectValues #-}++array_ :: Parser Value+array_ = {-# SCC "array_" #-} Array <$> arrayValues value++array_' :: Parser Value+array_' = {-# SCC "array_'" #-} do+ !vals <- arrayValues value'+ return (Array vals)++commaSeparated :: Parser a -> Word8 -> Parser [a]+commaSeparated item endByte = do+ w <- A.peekWord8'+ if w == endByte+ then A.anyWord8 >> return []+ else loop+ where+ loop = do+ v <- item <* skipSpace+ ch <- A.satisfy $ \w -> w == COMMA || w == endByte+ if ch == COMMA+ then skipSpace >> (v:) <$> loop+ else return [v]+{-# INLINE commaSeparated #-}++arrayValues :: Parser Value -> Parser (Vector Value)+arrayValues val = do+ skipSpace+ Vector.fromList <$> commaSeparated val CLOSE_SQUARE+{-# INLINE arrayValues #-}++-- | Parse any JSON value. You should usually 'json' in preference to+-- this function, as this function relaxes the object-or-array+-- requirement of RFC 4627.+--+-- In particular, be careful in using this function if you think your+-- code might interoperate with Javascript. A naïve Javascript+-- library that parses JSON data using @eval@ is vulnerable to attack+-- unless the encoded data represents an object or an array. JSON+-- implementations in other languages conform to that same restriction+-- to preserve interoperability and security.+value :: Parser Value+value = do+ w <- A.peekWord8'+ case w of+ DOUBLE_QUOTE -> A.anyWord8 *> (String <$> jstring_)+ OPEN_CURLY -> A.anyWord8 *> object_+ OPEN_SQUARE -> A.anyWord8 *> array_+ C_f -> string "false" *> pure (Bool False)+ C_t -> string "true" *> pure (Bool True)+ C_n -> string "null" *> pure Null+ _ | w >= 48 && w <= 57 || w == 45+ -> Number <$> scientific+ | otherwise -> fail "not a valid json value"++-- | Strict version of 'value'. See also 'json''.+value' :: Parser Value+value' = do+ w <- A.peekWord8'+ case w of+ DOUBLE_QUOTE -> do+ !s <- A.anyWord8 *> jstring_+ return (String s)+ OPEN_CURLY -> A.anyWord8 *> object_'+ OPEN_SQUARE -> A.anyWord8 *> array_'+ C_f -> string "false" *> pure (Bool False)+ C_t -> string "true" *> pure (Bool True)+ C_n -> string "null" *> pure Null+ _ | w >= 48 && w <= 57 || w == 45+ -> do+ !n <- scientific+ return (Number n)+ | otherwise -> fail "not a valid json value"++-- | Parse a quoted JSON string.+jstring :: Parser Text+jstring = A.word8 DOUBLE_QUOTE *> jstring_++-- | Parse a string without a leading quote.+jstring_ :: Parser Text+jstring_ = {-# SCC "jstring_" #-} do+ s <- A.scan False $ \s c -> if s then Just False+ else if c == DOUBLE_QUOTE+ then Nothing+ else Just (c == BACKSLASH)+ _ <- A.word8 DOUBLE_QUOTE+ s1 <- if BACKSLASH `B.elem` s+ then case Z.parse unescape s of+ Right r -> return r+ Left err -> fail err+ else return s++ case decodeUtf8' s1 of+ Right r -> return r+ Left err -> fail $ show err++{-# INLINE jstring_ #-}++unescape :: Z.Parser ByteString+unescape = toByteString <$> go mempty where+ go acc = do+ h <- Z.takeWhile (/=BACKSLASH)+ let rest = do+ start <- Z.take 2+ let !slash = B.unsafeHead start+ !t = B.unsafeIndex start 1+ escape = case B.findIndex (==t) "\"\\/ntbrfu" of+ Just i -> i+ _ -> 255+ if slash /= BACKSLASH || escape == 255+ then fail "invalid JSON escape sequence"+ else do+ let cont m = go (acc `mappend` byteString h `mappend` m)+ {-# INLINE cont #-}+ if t /= 117 -- 'u'+ then cont (word8 (B.unsafeIndex mapping escape))+ else do+ a <- hexQuad+ if a < 0xd800 || a > 0xdfff+ then cont (charUtf8 (chr a))+ else do+ b <- Z.string "\\u" *> hexQuad+ if a <= 0xdbff && b >= 0xdc00 && b <= 0xdfff+ then let !c = ((a - 0xd800) `shiftL` 10) ++ (b - 0xdc00) + 0x10000+ in cont (charUtf8 (chr c))+ else fail "invalid UTF-16 surrogates"+ done <- Z.atEnd+ if done+ then return (acc `mappend` byteString h)+ else rest+ mapping = "\"\\/\n\t\b\r\f"++hexQuad :: Z.Parser Int+hexQuad = do+ s <- Z.take 4+ let hex n | w >= C_0 && w <= C_9 = w - C_0+ | w >= C_a && w <= C_f = w - 87+ | w >= C_A && w <= C_F = w - 55+ | otherwise = 255+ where w = fromIntegral $ B.unsafeIndex s n+ a = hex 0; b = hex 1; c = hex 2; d = hex 3+ if (a .|. b .|. c .|. d) /= 255+ then return $! d .|. (c `shiftL` 4) .|. (b `shiftL` 8) .|. (a `shiftL` 12)+ else fail "invalid hex escape"++decodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString -> Maybe a+decodeWith p to s =+ case L.parse p s of+ L.Done _ v -> case to v of+ Success a -> Just a+ _ -> Nothing+ _ -> Nothing+{-# INLINE decodeWith #-}++decodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString+ -> Maybe a+decodeStrictWith p to s =+ case either Error to (A.parseOnly p s) of+ Success a -> Just a+ Error _ -> Nothing+{-# INLINE decodeStrictWith #-}++eitherDecodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString+ -> Either String a+eitherDecodeWith p to s =+ case L.parse p s of+ L.Done _ v -> case to v of+ Success a -> Right a+ Error msg -> Left msg+ L.Fail _ _ msg -> Left msg+{-# INLINE eitherDecodeWith #-}++eitherDecodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString+ -> Either String a+eitherDecodeStrictWith p to s =+ case either Error to (A.parseOnly p s) of+ Success a -> Right a+ Error msg -> Left msg+{-# INLINE eitherDecodeStrictWith #-}++-- $lazy+--+-- The 'json' and 'value' parsers decouple identification from+-- conversion. Identification occurs immediately (so that an invalid+-- JSON document can be rejected as early as possible), but conversion+-- to a Haskell value is deferred until that value is needed.+--+-- This decoupling can be time-efficient if only a smallish subset of+-- elements in a JSON value need to be inspected, since the cost of+-- conversion is zero for uninspected elements. The trade off is an+-- increase in memory usage, due to allocation of thunks for values+-- that have not yet been converted.++-- $strict+--+-- The 'json'' and 'value'' parsers combine identification with+-- conversion. They consume more CPU cycles up front, but have a+-- smaller memory footprint.++-- | Parse a top-level JSON value followed by optional whitespace and+-- end-of-input. See also: 'json'.+jsonEOF :: Parser Value+jsonEOF = json <* skipSpace <* endOfInput++-- | Parse a top-level JSON value followed by optional whitespace and+-- end-of-input. See also: 'json''.+jsonEOF' :: Parser Value+jsonEOF' = json' <* skipSpace <* endOfInput++toByteString :: Builder -> ByteString+toByteString = L.toStrict . toLazyByteString+{-# INLINE toByteString #-}++aeson :: IO Benchmark+aeson = do+ path <- pathTo "json-data"+ names <- sort . filter (`notElem` [".", ".."]) <$> getDirectoryContents path+ benches <- forM names $ \name -> do+ bs <- B.readFile (path </> name)+ return . bench (dropExtension name) $ nf (A.parseOnly jsonEOF') bs+ return $ bgroup "aeson" benches
+ benchmarks/Benchmarks.hs view
@@ -0,0 +1,126 @@+{-# LANGUAGE BangPatterns, CPP #-}++import Common ()+import Control.Applicative (many)+import Test.Tasty.Bench (bench, bgroup, defaultMain, nf)+import Data.Bits+import Data.Char (isAlpha)+import Data.Word (Word32)+import Data.Word (Word8)+import Numbers (numbers)+import Common (chunksOf)+import Text.Parsec.Text ()+import Text.Parsec.Text.Lazy ()+import qualified Warp+import qualified Aeson+import qualified Genome+import qualified Data.Attoparsec.ByteString as AB+import qualified Data.Attoparsec.ByteString.Char8 as AC+import qualified Data.Attoparsec.ByteString.Lazy as ABL+import qualified Data.Attoparsec.Text as AT+import qualified Data.Attoparsec.Text.Lazy as ATL+import qualified Data.ByteString as B+import qualified Data.ByteString.Char8 as BC+import qualified Data.ByteString.Lazy as BL+import qualified Data.Text as T+import qualified Data.Text.Lazy as TL+import qualified HeadersByteString+import qualified HeadersText+import qualified Links+import qualified Text.Parsec as P+import qualified Sets++main :: IO ()+main = do+ let s = take 1024 . cycle $ ['a'..'z'] ++ ['A'..'Z']+ !b = BC.pack s+ !bl = BL.fromChunks . map BC.pack . chunksOf 4 $ s+ !t = T.pack s+ !tl = TL.fromChunks . map T.pack . chunksOf 4 $ s+ aeson <- Aeson.aeson+ headersBS <- HeadersByteString.headers+ headersT <- HeadersText.headers+ defaultMain [+ bgroup "many" [+ bgroup "attoparsec" [+ bench "B" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b+ , bench "BL" $ nf (ABL.parse (many (AC.satisfy AC.isAlpha_ascii))) bl+ , bench "T" $ nf (AT.parse (many (AT.satisfy AC.isAlpha_ascii))) t+ , bench "TL" $ nf (ATL.parse (many (AT.satisfy AC.isAlpha_ascii))) tl+ ]+ , bgroup "parsec" [+ bench "S" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") s+ , bench "B" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") b+ , bench "BL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") bl+ , bench "T" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") t+ , bench "TL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") tl+ ]+ ]+ , bgroup "comparison" [+ bgroup "many-vs-takeWhile" [+ bench "many" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b+ , bench "takeWhile" $ nf (AB.parse (AC.takeWhile AC.isAlpha_ascii)) b+ ]+ , bgroup "letter-vs-isAlpha" [+ bench "letter" $ nf (AB.parse (many AC.letter_ascii)) b+ , bench "isAlpha" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b+ ]+ ]+ , bgroup "takeWhile" [+ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile isAlpha)) bl+ , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_ascii)) bl+ , bench "isAlpha_iso8859_15" $+ nf (ABL.parse (AC.takeWhile AC.isAlpha_iso8859_15)) bl+ , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile isAlpha)) t+ , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile isAlpha)) tl+ ]+ , bgroup "takeWhile1" [+ bench "isAlpha" $ nf (ABL.parse (AC.takeWhile1 isAlpha)) bl+ , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile1 AC.isAlpha_ascii)) bl+ , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile1 isAlpha)) t+ , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile1 isAlpha)) tl+ ]+ , bench "word32LE" $ nf (AB.parse word32LE) b+ , bgroup "scan" [+ bench "short" $ nf (AB.parse quotedString) (BC.pack "abcdefghijk\"")+ , bench "long" $ nf (AB.parse quotedString) b+ ]+ , aeson+ , Genome.genome+ , headersBS+ , headersT+ , Links.links+ , numbers+ , Sets.benchmarks+ , Warp.benchmarks+ ]++-- Benchmarks bind and (potential) bounds-check merging.+word32LE :: AB.Parser Word32+word32LE = do+ w1 <- AB.anyWord8+ w2 <- AB.anyWord8+ w3 <- AB.anyWord8+ w4 <- AB.anyWord8+ return $! (fromIntegral w1 :: Word32) ++ fromIntegral w2 `unsafeShiftL` 8 ++ fromIntegral w3 `unsafeShiftL` 16 ++ fromIntegral w4 `unsafeShiftL` 32++doubleQuote, backslash :: Word8+doubleQuote = 34+backslash = 92+{-# INLINE backslash #-}+{-# INLINE doubleQuote #-}++-- | Parse a string without a leading quote.+quotedString :: AB.Parser B.ByteString+quotedString = AB.scan False $ \s c -> if s then Just False+ else if c == doubleQuote+ then Nothing+ else Just (c == backslash)++#if !MIN_VERSION_base(4,5,0)+unsafeShiftL :: Bits a => a -> Int -> a+unsafeShiftL = shiftL+#endif
+ benchmarks/Common.hs view
@@ -0,0 +1,47 @@+{-# LANGUAGE CPP #-}+{-# OPTIONS_GHC -fno-warn-orphans #-}++module Common (+ chunksOf+ , pathTo+ , rechunkBS+ , rechunkT+ ) where++import Control.DeepSeq (NFData(rnf))+import System.Directory (doesDirectoryExist)+import System.FilePath ((</>))+import Text.Parsec (ParseError)+import qualified Data.ByteString as B+import qualified Data.ByteString.Lazy as BL+import qualified Data.Text as T+import qualified Data.Text.Lazy as TL++#if !MIN_VERSION_bytestring(0,10,0)+import Data.ByteString.Internal (ByteString(..))++instance NFData ByteString where+ rnf (PS _ _ _) = ()+#endif++instance NFData ParseError where+ rnf = rnf . show++chunksOf :: Int -> [a] -> [[a]]+chunksOf k = go+ where go xs = case splitAt k xs of+ ([],_) -> []+ (y, ys) -> y : go ys++rechunkBS :: Int -> B.ByteString -> BL.ByteString+rechunkBS n = BL.fromChunks . map B.pack . chunksOf n . B.unpack++rechunkT :: Int -> T.Text -> TL.Text+rechunkT n = TL.fromChunks . map T.pack . chunksOf n . T.unpack++pathTo :: String -> IO FilePath+pathTo wat = do+ exists <- doesDirectoryExist "benchmarks"+ return $ if exists+ then "benchmarks" </> wat+ else wat
+ benchmarks/Genome.hs view
@@ -0,0 +1,75 @@+{-# LANGUAGE OverloadedStrings #-}++module Genome+ (+ genome+ ) where++import Control.Applicative+import Test.Tasty.Bench+import Data.ByteString (ByteString)+import qualified Data.ByteString.Char8 as B8+import qualified Data.ByteString.Lazy.Char8 as L8+import Data.Attoparsec.ByteString.Char8 as B+import qualified Data.Attoparsec.ByteString.Lazy as BL+import Data.Text (Text)+import qualified Data.Text as T+import qualified Data.Text.Lazy as TL+import Data.Attoparsec.Text as T+import qualified Data.Attoparsec.Text.Lazy as TL+import Common (rechunkBS, rechunkT)++genome :: Benchmark+genome = bgroup "genome" [+ bgroup "bytestring" [+ bench "s" $ nf (map (B.parse searchBS)) (B8.tails geneB)+ , bench "l" $ nf (map (BL.parse searchBS)) (L8.tails geneBL)+ , bgroup "CI" [+ bench "s" $ nf (map (B.parse searchBSCI)) (B8.tails geneB)+ , bench "l" $ nf (map (BL.parse searchBSCI)) (L8.tails geneBL)+ ]+ ]+ , bgroup "text" [+ bench "s" $ nf (map (T.parse searchT)) (T.tails geneT)+ , bench "l" $ nf (map (TL.parse searchT)) (TL.tails geneTL)+ , bgroup "CI" [+ bench "s" $ nf (map (T.parse searchTCI)) (T.tails geneT)+ , bench "l" $ nf (map (TL.parse searchTCI)) (TL.tails geneTL)+ ]+ ]+ ]+ where geneB = B8.pack gene+ geneBL = rechunkBS 4 geneB+ geneT = T.pack gene+ geneTL = rechunkT 4 geneT++searchBS :: B.Parser ByteString+searchBS = "caac" *> ("aaca" <|> "aact")++searchBSCI :: B.Parser ByteString+searchBSCI = B.stringCI "CAAC" *> (B.stringCI "AACA" <|> B.stringCI "AACT")++searchT :: T.Parser Text+searchT = "caac" *> ("aaca" <|> "aact")++searchTCI :: T.Parser Text+searchTCI = T.asciiCI "CAAC" *> (T.asciiCI "AACA" <|> T.asciiCI "AACT")++-- Dictyostelium discoideum developmental protein DG1094 (gacT) gene,+-- partial cds. http://www.ncbi.nlm.nih.gov/nuccore/AF081586.1++gene :: String+gene = "atcgatttagaaagatacaaagatagaaccatcaataataaacaagagaagagagcaagt\+ \agagatattaataaagagattgaaagagagattgaaaagaagagattatcaccaagagaa\+ \agattaaatttatttggtctttcttcctcatcttcatcagtgaattcaacattaacaaga\+ \tctacagcaaatattatctctacaatagacggtagtggaggtagtaatcgtaatagtaaa\+ \aattatggtaatggctcatcctcctcctcaaatagaagatatagtaatactattaatcaa\+ \caattacaaatgcaattacaacaacttcaaatccaacaacaacaatatcaacaaactcaa\+ \caatctcaaataccattacaatatcaacaacaacaacagcaacaacaacaacaaaccact\+ \acaactacaactacatcaagtggtagtaatagattctcttcaaatagatataaaccagtt\+ \gatcttacacaatcatcttcaaactttcgttattcacgtgaaatttatgatgatgattat\+ \tattcaaataataatttaatgatgtttggtaatgagcaaccaaatcaaacaccaatttct\+ \gtatcatcttcatctgcattcacacgtcaaagatctcaaagttgctttgaaccagagaat\+ \cttgtattgctacaacaacaatatcaacaatatcaacaacaacaacaacaacaacaacaa\+ \attccattccaagcaaatccacaatatagtaatgctgttattgaacaaaaattggatcaa\+ \attagagataccattaataatttacatagagataaccgagtctctaga"
+ benchmarks/HeadersByteString.hs view
@@ -0,0 +1,36 @@+module HeadersByteString (headers) where++import Common (pathTo, rechunkBS)+import Test.Tasty.Bench (Benchmark, bench, bgroup, nf, nfIO)+import HeadersByteString.Atto (request, response)+import Network.Wai.Handler.Warp.RequestHeader (parseHeaderLines)+import qualified Data.Attoparsec.ByteString.Char8 as B+import qualified Data.Attoparsec.ByteString.Lazy as BL+import qualified Data.ByteString.Char8 as B++-- Note: In the benchmarks for parsing an http request+-- from a strict bytestring, we consider warp's implementation,+-- which has highly optimized code for handling the first+-- line in particular. It's treatment of the headers+-- is more relaxed from the treatment they are given by the+-- attoparsec parser benchmarked here. Consequently, it+-- is should not be possible to match its performance since+-- it accepts header names with disallowed characters.++headers :: IO Benchmark+headers = do+ req <- B.readFile =<< pathTo "http-request.txt"+ resp <- B.readFile =<< pathTo "http-response.txt"+ let reql = rechunkBS 4 req+ respl = rechunkBS 4 resp+ return $ bgroup "headers" [+ bgroup "B" [+ bench "request" $ nf (B.parseOnly request) req+ , bench "warp" $ nfIO (parseHeaderLines (B.split '\n' req))+ , bench "response" $ nf (B.parseOnly response) resp+ ]+ , bgroup "BL" [+ bench "request" $ nf (BL.parse request) reql+ , bench "response" $ nf (BL.parse response) respl+ ]+ ]
+ benchmarks/HeadersByteString/Atto.hs view
@@ -0,0 +1,57 @@+{-# LANGUAGE BangPatterns, OverloadedStrings #-}+{-# OPTIONS_GHC -fno-warn-missing-signatures -fno-warn-orphans #-}+module HeadersByteString.Atto+ (+ request+ , response+ ) where++import Control.Applicative+import Control.DeepSeq (NFData(..))+import Network.HTTP.Types.Version (HttpVersion, http11)+import qualified Data.Attoparsec.ByteString.Char8 as B+import qualified Data.ByteString.Char8 as B++instance NFData HttpVersion where+ rnf !_ = ()++isHeaderChar :: Char -> Bool+isHeaderChar c =+ (c >= 'a' && c <= 'z') ||+ (c >= 'A' && c <= 'Z') ||+ (c >= '0' && c <= '9') ||+ (c == '_') ||+ (c == '-')++header = do+ name <- B.takeWhile1 isHeaderChar <* B.char ':' <* B.skipSpace+ body <- bodyLine+ return (name, body)++bodyLine = B.takeTill (\c -> c == '\r' || c == '\n') <* B.endOfLine++requestLine = do+ m <- (B.takeTill B.isSpace <* B.char ' ')+ (p,q) <- B.break (=='?') <$> (B.takeTill B.isSpace <* B.char ' ')+ v <- httpVersion+ return (m,p,q,v)++httpVersion = http11 <$ "HTTP/1.1"++responseLine = (,,) <$>+ (httpVersion <* B.skipSpace) <*>+ (int <* B.skipSpace) <*>+ bodyLine++int :: B.Parser Int+int = B.decimal++request = (,) <$> (requestLine <* B.endOfLine) <*> manyheader++response = (,) <$> responseLine <*> many header++manyheader = do+ c <- B.peekChar'+ if c == '\r' || c == '\n'+ then return []+ else (:) <$> header <*> manyheader
+ benchmarks/HeadersText.hs view
@@ -0,0 +1,56 @@+{-# LANGUAGE OverloadedStrings #-}+{-# OPTIONS_GHC -fno-warn-missing-signatures #-}+module HeadersText (headers) where++import Common (pathTo, rechunkT)+import Control.Applicative+import Test.Tasty.Bench (Benchmark, bench, bgroup, nf)+import Data.Char (isSpace)+import qualified Data.Attoparsec.Text as T+import qualified Data.Attoparsec.Text.Lazy as TL+import qualified Data.Text.IO as T++header = do+ name <- T.takeWhile1 (T.inClass "a-zA-Z0-9_-") <* T.char ':' <* T.skipSpace+ body <- (:) <$> bodyLine <*> many (T.takeWhile1 isSpace *> bodyLine)+ return (name, body)++bodyLine = T.takeTill (\c -> c == '\r' || c == '\n') <* T.endOfLine++requestLine =+ (,,) <$>+ (method <* T.skipSpace) <*>+ (T.takeTill isSpace <* T.skipSpace) <*>+ httpVersion+ where method = "GET" <|> "POST"++httpVersion = "HTTP/" *> ((,) <$> (int <* T.char '.') <*> int)++responseLine = (,,) <$>+ (httpVersion <* T.skipSpace) <*>+ (int <* T.skipSpace) <*>+ bodyLine++int :: T.Parser Int+int = T.decimal++request = (,) <$> (requestLine <* T.endOfLine) <*> many header++response = (,) <$> responseLine <*> many header++headers :: IO Benchmark+headers = do+ req <- T.readFile =<< pathTo "http-request.txt"+ resp <- T.readFile =<< pathTo "http-response.txt"+ let reql = rechunkT 4 req+ respl = rechunkT 4 resp+ return $ bgroup "headers" [+ bgroup "T" [+ bench "request" $ nf (T.parseOnly request) req+ , bench "response" $ nf (T.parseOnly response) resp+ ]+ , bgroup "TL" [+ bench "request" $ nf (TL.parse request) reql+ , bench "response" $ nf (TL.parse response) respl+ ]+ ]
+ benchmarks/Links.hs view
@@ -0,0 +1,63 @@+{-# LANGUAGE OverloadedStrings #-}++module Links (links) where++import Control.Applicative+import Control.DeepSeq (NFData(..))+import Test.Tasty.Bench (Benchmark, bench, nf)+import Data.Attoparsec.ByteString as A+import Data.Attoparsec.ByteString.Char8 as A8+import Data.ByteString.Char8 as B8++data Link = Link {+ linkURL :: ByteString+ , linkParams :: [(ByteString, ByteString)]+ } deriving (Eq, Show)++instance NFData Link where+ rnf l = rnf (linkURL l) `seq` rnf (linkParams l)++link :: Parser Link+link = Link <$> url <*> many (char8 ';' *> skipSpace *> param)+ where url = char8 '<' *> A8.takeTill (=='>') <* char8 '>' <* skipSpace++param :: Parser (ByteString, ByteString)+param = do+ name <- paramName+ skipSpace *> "=" *> skipSpace+ c <- peekChar'+ let isTokenChar = A.inClass "!#$%&'()*+./0-9:<=>?@a-zA-Z[]^_`{|}~-"+ val <- case c of+ '"' -> quotedString+ _ -> A.takeWhile isTokenChar+ skipSpace+ return (name, val)++data Quot = Literal | Backslash++quotedString :: Parser ByteString+quotedString = char '"' *> (fixup <$> body) <* char '"'+ where body = A8.scan Literal $ \s c ->+ case (s,c) of+ (Literal, '\\') -> backslash+ (Literal, '"') -> Nothing+ _ -> literal+ literal = Just Literal+ backslash = Just Backslash+ fixup = B8.pack . go . B8.unpack+ where go ('\\' : x@'\\' : xs) = x : go xs+ go ('\\' : x@'"' : xs) = x : go xs+ go (x : xs) = x : go xs+ go xs = xs++paramName :: Parser ByteString+paramName = do+ name <- A.takeWhile1 $ A.inClass "a-zA-Z0-9!#$&+-.^_`|~"+ c <- peekChar+ return $ case c of+ Just '*' -> B8.snoc name '*'+ _ -> name++links :: Benchmark+links = bench "links" $ nf (A.parseOnly link) lnk+ where lnk = "<https://api.github.com/search/code?q=addClass+user%3Amozilla&page=2>; rel=\"next\", <https://api.github.com/search/code?q=addClass+user%3Amozilla&page=34>; rel=\"last\""
+ benchmarks/Numbers.hs view
@@ -0,0 +1,81 @@+{-# LANGUAGE BangPatterns #-}+{-# OPTIONS_GHC -fno-warn-deprecations #-}++module Numbers (numbers) where++import Test.Tasty.Bench (Benchmark, bench, bgroup, nf)+import Data.Scientific (Scientific(..))+import Text.Parsec.Text ()+import Text.Parsec.Text.Lazy ()+import qualified Data.Attoparsec.ByteString.Char8 as AC+import qualified Data.Attoparsec.Text as AT+import qualified Data.ByteString.Char8 as BC+import qualified Data.Text as T++strN, strNePos, strNeNeg :: String+strN = "1234.56789"+strNePos = "1234.56789e3"+strNeNeg = "1234.56789e-3"++numbers :: Benchmark+numbers = bgroup "numbers" [+ let !tN = T.pack strN+ !tNePos = T.pack strNePos+ !tNeNeg = T.pack strNeNeg+ in bgroup "Text"+ [+ bgroup "no power"+ [ bench "double" $ nf (AT.parseOnly AT.double) tN+ , bench "number" $ nf (AT.parseOnly AT.number) tN+ , bench "rational" $+ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tN+ , bench "scientific" $+ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tN+ ]+ , bgroup "positive power"+ [ bench "double" $ nf (AT.parseOnly AT.double) tNePos+ , bench "number" $ nf (AT.parseOnly AT.number) tNePos+ , bench "rational" $+ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNePos+ , bench "scientific" $+ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNePos+ ]+ , bgroup "negative power"+ [ bench "double" $ nf (AT.parseOnly AT.double) tNeNeg+ , bench "number" $ nf (AT.parseOnly AT.number) tNeNeg+ , bench "rational" $+ nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNeNeg+ , bench "scientific" $+ nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNeNeg+ ]+ ]+ , let !bN = BC.pack strN+ !bNePos = BC.pack strNePos+ !bNeNeg = BC.pack strNeNeg+ in bgroup "ByteString"+ [ bgroup "no power"+ [ bench "double" $ nf (AC.parseOnly AC.double) bN+ , bench "number" $ nf (AC.parseOnly AC.number) bN+ , bench "rational" $+ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bN+ , bench "scientific" $+ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bN+ ]+ , bgroup "positive power"+ [ bench "double" $ nf (AC.parseOnly AC.double) bNePos+ , bench "number" $ nf (AC.parseOnly AC.number) bNePos+ , bench "rational" $+ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNePos+ , bench "scientific" $+ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNePos+ ]+ , bgroup "negative power"+ [ bench "double" $ nf (AC.parseOnly AC.double) bNeNeg+ , bench "number" $ nf (AC.parseOnly AC.number) bNeNeg+ , bench "rational" $+ nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNeNeg+ , bench "scientific" $+ nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNeNeg+ ]+ ]+ ]
+ benchmarks/Sets.hs view
@@ -0,0 +1,21 @@+module Sets (benchmarks) where++import Test.Tasty.Bench+import Data.Char (ord)+import qualified Data.Attoparsec.Text.FastSet as FastSet+import qualified TextFastSet+import qualified Data.HashSet as HashSet+import qualified Data.IntSet as IntSet++smallSet :: String+smallSet = ['a'..'z'] ++ ['A'..'Z'] ++ ['0'..'9']++benchmarks :: Benchmark+benchmarks = bgroup "sets" [+ bench "Fast" $ whnf (FastSet.member '*') (FastSet.fromList smallSet)+ , bench "Hash" $ whnf (HashSet.member '*') (HashSet.fromList smallSet)+ , bench "Int" $ whnf (IntSet.member (ord '*'))+ (IntSet.fromList (map ord smallSet))+ , bench "TextFast" $ whnf (TextFastSet.member '*')+ (TextFastSet.fromList smallSet)+ ]
+ benchmarks/TextFastSet.hs view
@@ -0,0 +1,121 @@+{-# LANGUAGE BangPatterns #-}++------------------------------------------------------------------------------+-- |+-- Module : Data.Attoparsec.FastSet+-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : felipe.lessa@gmail.com+-- Stability : experimental+-- Portability : unknown+--+-- Fast set membership tests for 'Char' values. We test for+-- membership using a hashtable implemented with Robin Hood+-- collision resolution. The set representation is unboxed,+-- and the characters and hashes interleaved, for efficiency.+--+--+-----------------------------------------------------------------------------+module TextFastSet+ (+ -- * Data type+ FastSet+ -- * Construction+ , fromList+ , set+ -- * Lookup+ , member+ -- * Handy interface+ , charClass+ ) where++import Data.Bits ((.|.), (.&.), shiftR)+import Data.Function (on)+import Data.List (sort, sortBy)+import qualified Data.Array.Base as AB+import qualified Data.Array.Unboxed as A+import qualified Data.Text as T++data FastSet = FastSet {+ table :: {-# UNPACK #-} !(A.UArray Int Int)+ , mask :: {-# UNPACK #-} !Int+ }++data Entry = Entry {+ key :: {-# UNPACK #-} !Char+ , initialIndex :: {-# UNPACK #-} !Int+ , index :: {-# UNPACK #-} !Int+ }++offset :: Entry -> Int+offset e = index e - initialIndex e++resolveCollisions :: [Entry] -> [Entry]+resolveCollisions [] = []+resolveCollisions [e] = [e]+resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)+ where (a', b')+ | index a < index b = (a, b)+ | offset a < offset b = (b { index=index a }, a { index=index a + 1 })+ | otherwise = (a, b { index=index a + 1 })++pad :: Int -> [Entry] -> [Entry]+pad = go 0+ where -- ensure that we pad enough so that lookups beyond the+ -- last hash in the table fall within the array+ go !_ !m [] = replicate (max 1 m + 1) empty+ go k m (e:entries) = map (const empty) [k..i - 1] ++ e :+ go (i + 1) (m + i - k - 1) entries+ where i = index e+ empty = Entry '\0' maxBound 0++nextPowerOf2 :: Int -> Int+nextPowerOf2 0 = 1+nextPowerOf2 x = go (x - 1) 1+ where go y 32 = y + 1+ go y k = go (y .|. (y `shiftR` k)) $ k * 2++fastHash :: Char -> Int+fastHash = fromEnum++fromList :: String -> FastSet+fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)+ mask'+ where s' = ordNub (sort s)+ l = length s'+ mask' = nextPowerOf2 ((5 * l) `div` 4) - 1+ entries = pad mask' .+ resolveCollisions .+ sortBy (compare `on` initialIndex) .+ zipWith (\c i -> Entry c i i) s' .+ map ((.&. mask') . fastHash) $ s'+ interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])+ entries++ordNub :: Eq a => [a] -> [a]+ordNub [] = []+ordNub (y:ys) = go y ys+ where go x (z:zs)+ | x == z = go x zs+ | otherwise = x : go z zs+ go x [] = [x]++set :: T.Text -> FastSet+set = fromList . T.unpack++-- | Check the set for membership.+member :: Char -> FastSet -> Bool+member c a = go (2 * i)+ where i = fastHash c .&. mask a+ lookupAt j b = (i' <= i) && (c == c' || b)+ where c' = toEnum $ AB.unsafeAt (table a) j+ i' = AB.unsafeAt (table a) $ j + 1+ go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .+ lookupAt (j + 6) . go $ j + 8++charClass :: String -> FastSet+charClass = fromList . go+ where go (a:'-':b:xs) = [a..b] ++ go xs+ go (x:xs) = x : go xs+ go _ = ""
− benchmarks/Tiny.hs
@@ -1,31 +0,0 @@-import Control.Applicative ((<|>))-import Control.Monad (forM_)-import System.Environment (getArgs)-import qualified Data.Attoparsec.Char8 as A-import qualified Data.ByteString.Char8 as B-import qualified Text.Parsec as P-import qualified Text.Parsec.ByteString as P--attoparsec = do- args <- getArgs- forM_ args $ \arg -> do- input <- B.readFile arg- case A.parse p input `A.feed` B.empty of- A.Done _ xs -> print (length xs)- what -> print what- where- slow = A.many (A.many1 A.letter_ascii <|> A.many1 A.digit)- fast = A.many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit)- isDigit c = c >= '0' && c <= '9'- isLetter c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z')- p = fast--parsec = do- args <- getArgs- forM_ args $ \arg -> do- input <- readFile arg- case P.parse (P.many (P.many1 P.letter P.<|> P.many1 P.digit)) "" input of- Left err -> print err- Right xs -> print (length xs)--main = attoparsec
+ benchmarks/Warp.hs view
@@ -0,0 +1,16 @@+{-# LANGUAGE OverloadedStrings #-}++module Warp (benchmarks) where++import Test.Tasty.Bench (Benchmark, bench, bgroup, nf)+import Data.ByteString (ByteString)+import Network.Wai.Handler.Warp.ReadInt (readInt)+import qualified Data.Attoparsec.ByteString.Char8 as B++benchmarks :: Benchmark+benchmarks = bgroup "warp" [+ bgroup "decimal" [+ bench "warp" $ nf (readInt :: ByteString -> Int) "31337"+ , bench "atto" $ nf (B.parse (B.decimal :: B.Parser Int)) "31337"+ ]+ ]
+ benchmarks/http-request.txt view
@@ -0,0 +1,9 @@+GET / HTTP/1.1+Host: twitter.com+Accept: text/html, application/xhtml+xml, application/xml; q=0.9, image/webp, */*; q=0.8+Accept-Encoding: gzip,deflate,sdch+Accept-Language: en-GB,en-US;q=0.8,en;q=0.6+Cache-Control: max-age=0+Cookie: guest_id=v1%3A139; _twitter_sess=BAh7CSIKZmxhc2hJQz-e1e1; __utma=43838368.452555194.1399611824.1; __utmb=43838368; __utmc=43838368; __utmz=1399611824.1.1.utmcsr=(direct)|utmcmd=(none)+User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10_8_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/35.0.1916.86 Safari/537.36+
+ benchmarks/http-response.txt view
@@ -0,0 +1,14 @@+HTTP/1.1 200 OK+Date: Fri, 09 May 2014 04:24:57 GMT+Expires: -1+Cache-Control: private, max-age=0+Content-Type: text/html; charset=ISO-8859-1+Set-Cookie: PREF=ID=1a871afc4240db5e:FF:LM=1399609497:S=e5MZ0itEekjVwNcU; expires=Sun, 08-May-2016 04:24:57 GMT; path=/; domain=.google.com+Set-Cookie: NID=67=-WlfaDG6VSEPk7abAjrK98HBSoCD2ID6JKkUR95tEumzDmg7Fc8pSQ8; expires=Sat, 08-Nov-2014 04:24:57 GMT; path=/; domain=.google.com; HttpOnly+P3P: CP="This is not a P3P policy! See http://www.google.com/support/accounts/bin/answer.py?hl=en&answer=151657 for more info."+Server: gws+X-XSS-Protection: 1; mode=block+X-Frame-Options: SAMEORIGIN+Alternate-Protocol: 80:quic+Transfer-Encoding: chunked+
+ benchmarks/json-data/example.json view
@@ -0,0 +1,88 @@+{"web-app": {+ "servlet": [ + {+ "servlet-name": "cofaxCDS",+ "servlet-class": "org.cofax.cds.CDSServlet",+ "init-param": {+ "configGlossary:installationAt": "Philadelphia, PA",+ "configGlossary:adminEmail": "ksm@pobox.com",+ "configGlossary:poweredBy": "Cofax",+ "configGlossary:poweredByIcon": "/images/cofax.gif",+ "configGlossary:staticPath": "/content/static",+ "templateProcessorClass": "org.cofax.WysiwygTemplate",+ "templateLoaderClass": "org.cofax.FilesTemplateLoader",+ "templatePath": "templates",+ "templateOverridePath": "",+ "defaultListTemplate": "listTemplate.htm",+ "defaultFileTemplate": "articleTemplate.htm",+ "useJSP": false,+ "jspListTemplate": "listTemplate.jsp",+ "jspFileTemplate": "articleTemplate.jsp",+ "cachePackageTagsTrack": 200,+ "cachePackageTagsStore": 200,+ "cachePackageTagsRefresh": 60,+ "cacheTemplatesTrack": 100,+ "cacheTemplatesStore": 50,+ "cacheTemplatesRefresh": 15,+ "cachePagesTrack": 200,+ "cachePagesStore": 100,+ "cachePagesRefresh": 10,+ "cachePagesDirtyRead": 10,+ "searchEngineListTemplate": "forSearchEnginesList.htm",+ "searchEngineFileTemplate": "forSearchEngines.htm",+ "searchEngineRobotsDb": "WEB-INF/robots.db",+ "useDataStore": true,+ "dataStoreClass": "org.cofax.SqlDataStore",+ "redirectionClass": "org.cofax.SqlRedirection",+ "dataStoreName": "cofax",+ "dataStoreDriver": "com.microsoft.jdbc.sqlserver.SQLServerDriver",+ "dataStoreUrl": "jdbc:microsoft:sqlserver://LOCALHOST:1433;DatabaseName=goon",+ "dataStoreUser": "sa",+ "dataStorePassword": "dataStoreTestQuery",+ "dataStoreTestQuery": "SET NOCOUNT ON;select test='test';",+ "dataStoreLogFile": "/usr/local/tomcat/logs/datastore.log",+ "dataStoreInitConns": 10,+ "dataStoreMaxConns": 100,+ "dataStoreConnUsageLimit": 100,+ "dataStoreLogLevel": "debug",+ "maxUrlLength": 500}},+ {+ "servlet-name": "cofaxEmail",+ "servlet-class": "org.cofax.cds.EmailServlet",+ "init-param": {+ "mailHost": "mail1",+ "mailHostOverride": "mail2"}},+ {+ "servlet-name": "cofaxAdmin",+ "servlet-class": "org.cofax.cds.AdminServlet"},+ + {+ "servlet-name": "fileServlet",+ "servlet-class": "org.cofax.cds.FileServlet"},+ {+ "servlet-name": "cofaxTools",+ "servlet-class": "org.cofax.cms.CofaxToolsServlet",+ "init-param": {+ "templatePath": "toolstemplates/",+ "log": 1,+ "logLocation": "/usr/local/tomcat/logs/CofaxTools.log",+ "logMaxSize": "",+ "dataLog": 1,+ "dataLogLocation": "/usr/local/tomcat/logs/dataLog.log",+ "dataLogMaxSize": "",+ "removePageCache": "/content/admin/remove?cache=pages&id=",+ "removeTemplateCache": "/content/admin/remove?cache=templates&id=",+ "fileTransferFolder": "/usr/local/tomcat/webapps/content/fileTransferFolder",+ "lookInContext": 1,+ "adminGroupID": 4,+ "betaServer": true}}],+ "servlet-mapping": {+ "cofaxCDS": "/",+ "cofaxEmail": "/cofaxutil/aemail/*",+ "cofaxAdmin": "/admin/*",+ "fileServlet": "/static/*",+ "cofaxTools": "/tools/*"},+ + "taglib": {+ "taglib-uri": "cofax.tld",+ "taglib-location": "/WEB-INF/tlds/cofax.tld"}}}
+ benchmarks/json-data/geometry.json view
@@ -0,0 +1,1 @@+{"geometry": {"type": "Polygon", "coordinates": [[[-0.939359853061118, 51.57401065198471], [-0.939440892477492, 51.57431080772057], [-0.939543636564569, 51.57460846194951], [-0.939564627628489, 51.574822653966265], [-0.939763179055758, 51.575406210178826], [-0.939787182642249, 51.575552991614], [-0.939819571231525, 51.57564949527348], [-0.939851290904264, 51.57571272360808], [-0.939975682132949, 51.57588648747347], [-0.940036822193859, 51.57598774653439], [-0.940072640734852, 51.57606090267849], [-0.940109693338918, 51.576205104339515], [-0.940125502187331, 51.57645611534466], [-0.940118623499009, 51.57662779459441], [-0.94008851367835, 51.57680555827417], [-0.939998015208524, 51.57709787034017], [-0.939928028667517, 51.577252794653916], [-0.939830628174189, 51.57740747134858], [-0.939796941313687, 51.57749078985784], [-0.939785586773343, 51.57754463746666], [-0.939770656147318, 51.57769016804059], [-0.939658154074368, 51.57824573765943], [-0.939485738834128, 51.57883313597966], [-0.93945717030888, 51.579192545519916], [-0.939524336079755, 51.57928306919007], [-0.939540939284811, 51.57931379092206], [-0.939553921057406, 51.579748206813974], [-0.939549110634237, 51.57983088690364], [-0.939520940649101, 51.58004913048237], [-0.93951863934971, 51.58014801827346], [-0.939525037302583, 51.580245186310094], [-0.939540364690294, 51.58033074581249], [-0.939561798495469, 51.58040197377017], [-0.939594984852117, 51.58046431619436], [-0.939708262827559, 51.580619996404984], [-0.939729069878358, 51.58065615108302], [-0.939759224390201, 51.58072476025555], [-0.939813615319267, 51.58093026195459], [-0.939900523550716, 51.58172321441459], [-0.939894144544868, 51.581997403240464], [-0.939910832471369, 51.58208657162566], [-0.940114353648015, 51.582457967531546], [-0.94022333049887, 51.58267475179605], [-0.940267247821581, 51.58277225843995], [-0.94038427828014, 51.583077233742756], [-0.940493362377966, 51.583289522851196], [-0.940571515796737, 51.58340442254201], [-0.940725857371931, 51.58359464061899], [-0.941198340240742, 51.584069167875626], [-0.941335307610427, 51.584261925920295], [-0.941372786463165, 51.5843261048293], [-0.941416540699353, 51.58443080287741], [-0.941461326187118, 51.584739621364996], [-0.941517445876004, 51.5849954910945], [-0.941575869597484, 51.58533860085252], [-0.941574762730556, 51.58538624677686], [-0.941565185406358, 51.58542572382202], [-0.941550002863301, 51.58545795698674], [-0.941515976834126, 51.58549361692739], [-0.941470510606583, 51.585524677868065], [-0.941423872780384, 51.585544039043356], [-0.94131509921043, 51.585566436558274], [-0.941075026707647, 51.58558675057684], [-0.940953181611661, 51.58561262652464], [-0.940734943851404, 51.58568708689612], [-0.940229533088359, 51.585883040066975], [-0.940067635923264, 51.58595531027499], [-0.939917220191166, 51.58603038143916], [-0.939797255285709, 51.586099433232604], [-0.939675637701456, 51.586177461657186], [-0.939611074554604, 51.58622273608784], [-0.939340396866166, 51.586441486256], [-0.93912244296424, 51.58662744303347], [-0.938817233975319, 51.58671729893312], [-0.938661522913105, 51.586771639765516], [-0.938087678078033, 51.586992141762096], [-0.937332636663603, 51.5873072119485], [-0.93492634290483, 51.58836081134952], [-0.934774110277819, 51.58845114531925], [-0.934663126573178, 51.588505886685766], [-0.934565467487243, 51.588546362183585], [-0.934462140700832, 51.588582290320545], [-0.934337145222589, 51.58861892084846], [-0.934213782000904, 51.588647473549656], [-0.934055887760941, 51.588671216763295], [-0.933259701136762, 51.58864510257983], [-0.933213278816969, 51.588716614209304], [-0.932681740160827, 51.588792708227174], [-0.931992471253759, 51.58900853446031], [-0.930629113767652, 51.58946908647644], [-0.928525036745892, 51.59005953842682], [-0.928533690860491, 51.59024394687689], [-0.928456010745829, 51.59047792078815], [-0.928256501298223, 51.5906748158337], [-0.927916132025856, 51.59066181734799], [-0.927671608556404, 51.590624516635486], [-0.927319567022116, 51.59061680481465], [-0.926850285435352, 51.59062240702726], [-0.926313746570405, 51.59066425819173], [-0.925516790702947, 51.59079184232522], [-0.925387133168341, 51.59078076476673], [-0.925293323156809, 51.59077990606886], [-0.925202187496562, 51.59078806346173], [-0.925112304116411, 51.59080432476366], [-0.925036768134577, 51.59082431403807], [-0.924968299737815, 51.59085066215826], [-0.924899640304234, 51.59088510100373], [-0.924851228495836, 51.590917926896914], [-0.924734051019008, 51.59105082982951], [-0.924694255912291, 51.59108553291224], [-0.924446018071168, 51.59126668934789], [-0.924204972773907, 51.59150995377465], [-0.923492520665307, 51.59215352189589], [-0.922775141969353, 51.59288246146081], [-0.922298613651092, 51.59343737077436], [-0.922101568270595, 51.59365046303728], [-0.92149319027045, 51.59422483935332], [-0.921029930136652, 51.59464499018023], [-0.919455791303858, 51.595519790418045], [-0.919908472816787, 51.59560757835559], [-0.919902358174605, 51.595621908790214], [-0.919721503870405, 51.59588190272939], [-0.919513222918683, 51.59614164398608], [-0.919057326435374, 51.59661490568889], [-0.918991959815932, 51.59669253146064], [-0.918853979663433, 51.59690975873926], [-0.91882720841051, 51.59694278142396], [-0.918711889332325, 51.597056812913756], [-0.918614808732714, 51.59713234806153], [-0.918297245740306, 51.59749448485627], [-0.918073703114389, 51.59778825130676], [-0.917853804369843, 51.59811082427763], [-0.917772408698363, 51.59831598343439], [-0.917709563771812, 51.59853030520902], [-0.917692745480418, 51.59856971355161], [-0.917634249201942, 51.59866178857289], [-0.917443039919903, 51.59887043094418], [-0.917335250471836, 51.598971042984616], [-0.916888284039272, 51.599309503426845], [-0.916921110547038, 51.59938623548714], [-0.916942485633783, 51.5995195094582], [-0.916937652924948, 51.599601289122916], [-0.916945811778801, 51.599683188627004], [-0.916964246289877, 51.599757989575366], [-0.917049297107238, 51.59994580090974], [-0.917089705367533, 51.60000731699611], [-0.917171120773417, 51.60010517795964], [-0.91752823274465, 51.60044925531009], [-0.917834023417531, 51.600765883511485], [-0.917913079603466, 51.600902386385464], [-0.918033251654948, 51.60107073894696], [-0.91851090277833, 51.601507638962644], [-0.918694916056997, 51.601663091331545], [-0.919167224655989, 51.60214309940451], [-0.919302231291783, 51.6024167896932], [-0.919552009673002, 51.60266096432073], [-0.919812571846437, 51.60293760761218], [-0.920091738726093, 51.60358667644501], [-0.920208566517809, 51.603592246724574], [-0.920644522919282, 51.60359715428394], [-0.921093152621479, 51.6036156641763], [-0.921168285587618, 51.603613657034074], [-0.921469264587163, 51.6035867495928], [-0.921584776688781, 51.603586911416876], [-0.921718864440287, 51.603595336217005], [-0.921999521996191, 51.60363387995426], [-0.922136050325758, 51.603661209181794], [-0.922248015684399, 51.60368921195661], [-0.922346882036963, 51.60372159023333], [-0.922478548042792, 51.60377135359644], [-0.922605777045377, 51.603825571929555], [-0.92269948345521, 51.60389297005248], [-0.922855181916126, 51.60396453348124], [-0.922908065211369, 51.60398749776935], [-0.923525984356841, 51.604174796116844], [-0.923689774691443, 51.6042095667925], [-0.923842334751645, 51.60423074681459], [-0.924020987014581, 51.604247669912816], [-0.924152253615336, 51.604253368572344], [-0.924379056519158, 51.60424915231234], [-0.924491916632975, 51.60423939614583], [-0.925129396784027, 51.604149022807746], [-0.925308707040747, 51.60413807581467], [-0.925396812395019, 51.604137083863186], [-0.925816640142735, 51.60415261457396], [-0.926339243350925, 51.604157394450915], [-0.926627592983669, 51.60417621577326], [-0.928219342008724, 51.60433911850777], [-0.928540897883304, 51.60435823822504], [-0.928666454251138, 51.6043611822271], [-0.928925123731038, 51.60435275210506], [-0.929272427371303, 51.60432085222454], [-0.929350681081097, 51.604308977474346], [-0.929525019586135, 51.60426381040009], [-0.929730308556221, 51.60419195021111], [-0.929806393059037, 51.60414948374236], [-0.929854111423592, 51.60408517871234], [-0.929877477717563, 51.604012559228565], [-0.929880189120251, 51.60395863398061], [-0.930157001898001, 51.603362311928585], [-0.930233415197893, 51.60324431822904], [-0.930397156019029, 51.60303540508514], [-0.93058677482955, 51.602831223239896], [-0.930747612253953, 51.60268432562219], [-0.931065151604954, 51.602443542878724], [-0.931358556224333, 51.60224659876122], [-0.931494751600125, 51.602165114969594], [-0.931807666849096, 51.601998019766675], [-0.932115553298882, 51.60186055047904], [-0.932344261944379, 51.601774512081256], [-0.932581062209752, 51.601712824287226], [-0.932837650566022, 51.60166929919289], [-0.93304760157037, 51.60164423223924], [-0.933247236692325, 51.60162806284857], [-0.933524572231589, 51.601623388892406], [-0.93367307135076, 51.60163283011416], [-0.933854562367985, 51.601651562386515], [-0.934222940436163, 51.60170526005669], [-0.934582321335698, 51.60177326158339], [-0.935176916778695, 51.60190903449902], [-0.935323237909383, 51.60194992468383], [-0.935449328012611, 51.60199153042619], [-0.935555166022244, 51.60203475076641], [-0.935754957696255, 51.60213547009268], [-0.935920944220561, 51.60219991608389], [-0.936105992086264, 51.60225194623237], [-0.936251123590137, 51.60228203448254], [-0.9362553703842, 51.602285669620606], [-0.935954861941404, 51.603034649313756], [-0.936025513047831, 51.60328615677915], [-0.937604653681525, 51.60374194595848], [-0.937842729718605, 51.6037494948452], [-0.937998245297976, 51.60376798569096], [-0.938149157504488, 51.60379812385097], [-0.938282536474463, 51.60383709493093], [-0.938398403200176, 51.60388400001471], [-0.938549544157173, 51.60396629131982], [-0.938542113846477, 51.60403725821696], [-0.938540670189083, 51.60403724516617], [-0.938690470772444, 51.60417707075241], [-0.93885671831091, 51.60429276731543], [-0.938949655717409, 51.60433227129961], [-0.939171393952754, 51.60435945147724], [-0.939491406642938, 51.60438302306183], [-0.939580914110842, 51.60438383145672], [-0.939698081584302, 51.604374998744255], [-0.939860253923854, 51.60435578228165], [-0.940131370864495, 51.60430877574863], [-0.940224037565311, 51.60429792302206], [-0.941065905352937, 51.604358569226044], [-0.941456261791824, 51.60439985396626], [-0.94172260946072, 51.604433725629356], [-0.942065117075164, 51.604483568721975], [-0.942405972956444, 51.60454238758566], [-0.942542307804962, 51.60457868292929], [-0.942668453620936, 51.60461848302318], [-0.942754322773386, 51.60465162617505], [-0.942930037674105, 51.6047332338937], [-0.94300827141212, 51.60478429141865], [-0.943050642772121, 51.60482513526179], [-0.943095505071305, 51.604883085645305], [-0.943175837511794, 51.60503037259752], [-0.943199044776033, 51.60508812802956], [-0.943264927978451, 51.605360268787045], [-0.94328295289835, 51.6055168856955], [-0.943285556153251, 51.605653582182974], [-0.94327790338372, 51.60573443814757], [-0.943262026480571, 51.60579633763445], [-0.943228365851772, 51.605877858692274], [-0.943092212068021, 51.60614458434088], [-0.943074097962666, 51.60624063192375], [-0.943061365824471, 51.606415854446915], [-0.943044862244347, 51.60650472320056], [-0.943017897594943, 51.606608783583646], [-0.942979591589439, 51.606703750216774], [-0.942905884027612, 51.60683076806164], [-0.942741267849139, 51.60707925374213], [-0.942655006715899, 51.607249318295594], [-0.942630361430127, 51.60731563455148], [-0.942616263944651, 51.607425205688976], [-0.942621958529523, 51.60749089598715], [-0.942636336634899, 51.60755576531453], [-0.942660904708633, 51.607617129739225], [-0.942696981288364, 51.607680396114986], [-0.942747433102709, 51.60774648940761], [-0.942856244975984, 51.6078490746924], [-0.94299552290573, 51.60794563997599], [-0.943040847342192, 51.60798381288104], [-0.943186973159248, 51.608158666884215], [-0.943285889122319, 51.60825217104693], [-0.943509689787491, 51.60844031193307], [-0.94379690141149, 51.609007570967925], [-0.943824004868445, 51.60908424372538], [-0.943831400135399, 51.609201201602104], [-0.943839541642426, 51.60922375393887], [-0.943852077204152, 51.6092436483043], [-0.943874740412961, 51.60926273459518], [-0.943900416430683, 51.60927645299323], [-0.944008015202393, 51.60930709311221], [-0.944074894993692, 51.60934995527111], [-0.944126815315737, 51.60941516198104], [-0.944143328071964, 51.60945037786937], [-0.944150844233183, 51.609499899486615], [-0.944148608042361, 51.60953404761941], [-0.944074023202655, 51.60969882315075], [-0.94403415265091, 51.60986121332522], [-0.944017357658548, 51.60996266784037], [-0.943992023164905, 51.61030771903426], [-0.943965568458423, 51.61051428886229], [-0.943938629028152, 51.61067949277199], [-0.943919488028492, 51.61075754789674], [-0.943885949921455, 51.61083367520212], [-0.943827406881077, 51.61092935920088], [-0.943739589608875, 51.61104186395993], [-0.943638735204063, 51.61115604969767], [-0.943533757272514, 51.611261206608894], [-0.942952360107171, 51.61179457356613], [-0.942768364001955, 51.61194397664764], [-0.942436714102017, 51.61217027698273], [-0.942010518369458, 51.61248743929258], [-0.941742162181165, 51.61266215641604], [-0.941369087685306, 51.61286829880399], [-0.941218061678922, 51.612965845186196], [-0.941055044244821, 51.613082165678385], [-0.940962318642569, 51.61315685920963], [-0.940802313735133, 51.613329853845215], [-0.940532273923746, 51.613638528438315], [-0.940201080800705, 51.61403027273604], [-0.940058816377521, 51.614185443187054], [-0.939985695447699, 51.614286388653916], [-0.939953592073967, 51.614362527773245], [-0.939906859457064, 51.614508669589505], [-0.939802341993177, 51.61490335803689], [-0.939554942446072, 51.615603370947234], [-0.939452722231603, 51.61596121406953], [-0.939421935085161, 51.61604275989804], [-0.939387192811998, 51.616108085051245], [-0.939207265482904, 51.61639149465681], [-0.939036585027605, 51.61671185322904], [-0.938852844916865, 51.61697274874371], [-0.938765881571911, 51.61710953487875], [-0.938636321443754, 51.617400592062225], [-0.93858227703968, 51.617550263869646], [-0.938563060896774, 51.61763101488344], [-0.938557821588965, 51.617793716095726], [-0.938568952285691, 51.6178738422429], [-0.938586194898738, 51.61793963701825], [-0.93864824402059, 51.61806608070808], [-0.938712639101221, 51.61815388154161], [-0.938801458484915, 51.61824729803767], [-0.938902019778203, 51.61833272809444], [-0.939001577491258, 51.61839926656718], [-0.939080060597956, 51.6184404379885], [-0.939144458958051, 51.618466196342986], [-0.93924483456823, 51.61849767462955], [-0.939389936057716, 51.61853135511866], [-0.939533886937889, 51.618552436752374], [-0.939605967169062, 51.618558482633226], [-0.939704125343146, 51.618561167280205], [-0.940011869234288, 51.61855765138392], [-0.940970156479417, 51.61846828865034], [-0.942814559287174, 51.61834913395653], [-0.9433943585448, 51.61832378069166], [-0.943791844341078, 51.61831207069643], [-0.944095316626396, 51.61830580819228], [-0.944345189840605, 51.61830625638639], [-0.944633949874169, 51.618311549349706], [-0.944866264500346, 51.618321729423634], [-0.945069571918896, 51.61833704343469], [-0.945259736594118, 51.618358533188456], [-0.945405071369022, 51.6183823175338], [-0.945538707551366, 51.61841229079249], [-0.945670733169093, 51.618449442740584], [-0.945789657802543, 51.61849097274293], [-0.945898390514756, 51.618536007789324], [-0.946002624502939, 51.61858819565799], [-0.946144975691139, 51.61867849034559], [-0.946290660655923, 51.61881197458077], [-0.946424293873759, 51.618966930407886], [-0.94648587943588, 51.619052004215185], [-0.946597289998464, 51.61923103785771], [-0.946748500992991, 51.619500344620654], [-0.946865282768134, 51.619759451627154], [-0.94692090631825, 51.619852564183816], [-0.946986743272162, 51.619941272483025], [-0.947121992710119, 51.62008904866086], [-0.947221067183078, 51.620177155655796], [-0.947357337089385, 51.62028088174252], [-0.947636341593443, 51.62045871900467], [-0.947732020809812, 51.62050633282523], [-0.947832261440868, 51.62054409665008], [-0.948024909405708, 51.6205835873772], [-0.948272727755043, 51.62061098363029], [-0.94903310890345, 51.62064836261257], [-0.949342820854191, 51.62068530212313], [-0.949548509996597, 51.62072310869445], [-0.949603327033706, 51.620726296510135], [-0.94966121922192, 51.62072141934501], [-0.949725095662238, 51.62070760405018], [-0.949813979767225, 51.620674230793945], [-0.949850856696741, 51.620766275113425], [-0.949938127431095, 51.62092800552347], [-0.95012170684362, 51.62142328688538], [-0.950137689181391, 51.621481875301626], [-0.950144591409982, 51.621558365780544], [-0.950143525838059, 51.62166715485939], [-0.950086848280287, 51.62218276713024], [-0.950081566444785, 51.62234906486587], [-0.950091380322934, 51.6227375905417], [-0.950012857804674, 51.623198158520914], [-0.949963053357781, 51.62366617649237], [-0.94993621019599, 51.62382778558582], [-0.949887611273865, 51.62405573809743], [-0.94981748429385, 51.62434014525264], [-0.949698012983878, 51.6246969431444], [-0.949601071539472, 51.62520410239216], [-0.949519655994856, 51.62547671925938], [-0.949509640700394, 51.62553507516918], [-0.949509569744091, 51.62560071332227], [-0.949517625184728, 51.6256898023632], [-0.949539397678852, 51.62581048474923], [-0.949602831958219, 51.626066413978656], [-0.949622600072634, 51.6262113557699], [-0.949625807500304, 51.62644786389373], [-0.949588359660548, 51.62688092470566], [-0.949587162842075, 51.62718303218221], [-0.949593421398238, 51.627287390862], [-0.949641886384285, 51.62762860642186], [-0.949677564559904, 51.627772791296934], [-0.949732061930258, 51.62791534613564], [-0.949847071945823, 51.62812767746571], [-0.95005020451512, 51.62890367131774], [-0.949860358893705, 51.62924185674224], [-0.949849459019953, 51.62927592739189], [-0.949848649628705, 51.62931098742953], [-0.949857806222275, 51.62935243070728], [-0.949882540677514, 51.62940750068883], [-0.949782851646605, 51.62940750843079], [-0.949684104107472, 51.6296170289926], [-0.949619670293909, 51.62984214210067], [-0.949589348281571, 51.62990391300069], [-0.949478823262764, 51.63006027755304], [-0.949419643728549, 51.63018293320961], [-0.949378577882241, 51.63033452402259], [-0.949364251310331, 51.63051692549393], [-0.949339228920643, 51.63059942443184], [-0.949248633732607, 51.63076855530058], [-0.949181283974238, 51.630869557872636], [-0.949044504574139, 51.63103647701982], [-0.948893935504611, 51.63136242402941], [-0.948761069414249, 51.631297394415576], [-0.948669492362367, 51.63125880992652], [-0.948537801268757, 51.63120547966423], [-0.948447461288637, 51.63117589768262], [-0.948353982967507, 51.63115707745748], [-0.948302104865814, 51.63115121794117], [-0.948079606840815, 51.63115102360314], [-0.947964190602531, 51.63114369566099], [-0.94782149485015, 51.63112892992514], [-0.947725107052886, 51.63111098229264], [-0.947684910040859, 51.63109983219839], [-0.947483021604023, 51.63102069524269], [-0.947447137482345, 51.63101048287877], [-0.947306094892948, 51.630986739722026], [-0.947000710620611, 51.63094713644845], [-0.946674033898238, 51.6308911565172], [-0.946364247153943, 51.63079216747898], [-0.946230490849763, 51.63076579091048], [-0.946172752135344, 51.63076347450912], [-0.94612066649297, 51.630766603772976], [-0.945914796224295, 51.63079712600587], [-0.94583241748209, 51.63079818492752], [-0.945382953779145, 51.63067905708907], [-0.945085984219956, 51.63058827220451], [-0.944883205963743, 51.630547786680644], [-0.944304065189339, 51.630538086402446], [-0.94394898927073, 51.630523204990325], [-0.943611477254356, 51.63049858971805], [-0.943603681926519, 51.6307098224617], [-0.943277115569317, 51.63102249010073], [-0.943359247728321, 51.63109426279834], [-0.942862682241593, 51.631385618132356], [-0.942777562378065, 51.63144239822567], [-0.942532313252267, 51.63161282917167], [-0.942337892928893, 51.63177202827151], [-0.94226606523137, 51.631816339444626], [-0.942197377359527, 51.63184988892168], [-0.942115813951467, 51.631877927416205], [-0.941937005967162, 51.631924871353945], [-0.941512981586086, 51.63201636159427], [-0.94144898217334, 51.6320346671529], [-0.94125937051438, 51.632111184999914], [-0.940790185204025, 51.6323425346351], [-0.940501042462563, 51.632535943664614], [-0.940243238615803, 51.63268647504363], [-0.940131608045529, 51.632764593869275], [-0.939328651391563, 51.63361514453957], [-0.939011405652477, 51.634145481445906], [-0.93882930544315, 51.63451878632893], [-0.93850479164515, 51.63486472819315], [-0.93841585373771, 51.63483694950617], [-0.938308667759282, 51.63503379600045], [-0.938237520065274, 51.63511048065125], [-0.938174497877949, 51.635148574806536], [-0.938097155068085, 51.63518114448376], [-0.938014243480848, 51.63520467214815], [-0.937885103100742, 51.635227781700706], [-0.937899482630853, 51.63529265131639], [-0.937852791962712, 51.635312010611116], [-0.937756752174709, 51.63534081433219], [-0.93768849662133, 51.635355482713884], [-0.937445207164159, 51.63537845841074], [-0.937282775985471, 51.6354039635962], [-0.936848828519967, 51.635485456519916], [-0.935951432459366, 51.63561220386278], [-0.935719677036262, 51.635636179646525], [-0.935420148631615, 51.63565414571281], [-0.935249454884316, 51.63560044703531], [-0.935077590540852, 51.635535048401415], [-0.934717727795324, 51.63535285185533], [-0.934413155884105, 51.635216113905294], [-0.934240481559584, 51.635123731852076], [-0.934130824273522, 51.63505529964683], [-0.934018404467151, 51.63498144729724], [-0.93379675026591, 51.63482118293064], [-0.933679892303923, 51.6347517857655], [-0.933595523374065, 51.63471415412531], [-0.933350473747258, 51.63462740768713], [-0.933261876876166, 51.63458524160035], [-0.933052343088727, 51.63446285066096], [-0.932887751506176, 51.63439571653097], [-0.932638117941304, 51.63431971687678], [-0.932307197466639, 51.63419801967628], [-0.931343887912331, 51.63380981222079], [-0.931071830619705, 51.63376597498289], [-0.930956833347264, 51.63374065092008], [-0.930823331188951, 51.63370346918478], [-0.930701576222194, 51.633658301797674], [-0.930601553796263, 51.63361063468632], [-0.930506119022842, 51.63355221932683], [-0.930386739592999, 51.633467510133144], [-0.930286034494439, 51.633387466714524], [-0.930225334024314, 51.63332666999925], [-0.930188937852857, 51.633276884582266], [-0.930114567680391, 51.63312155131756], [-0.92999324620862, 51.63293521875163], [-0.929900400330813, 51.63282827174111], [-0.929602366751531, 51.6325378240622], [-0.929499431873266, 51.632429885607195], [-0.929341000864788, 51.63222433167361], [-0.929059923028374, 51.631889079042224], [-0.928963213558906, 51.63176231446386], [-0.928896162303318, 51.6316645934755], [-0.928844852932023, 51.631573310156845], [-0.928688841592085, 51.63126527289447], [-0.928672375509884, 51.6312282570475], [-0.928615004479859, 51.631026321392014], [-0.928599834825331, 51.63099561149414], [-0.928552267379979, 51.63092953870757], [-0.928477466267079, 51.630854225808044], [-0.928389580173335, 51.630782390113474], [-0.928294323595921, 51.6307167812279], [-0.928190294396403, 51.63065558801307], [-0.928078937075949, 51.630598823630024], [-0.927494137115659, 51.630339021667446], [-0.927177150281751, 51.63017967221046], [-0.927053070740772, 51.63011110151437], [-0.926922044883713, 51.63003077810591], [-0.926774152423019, 51.6299305188448], [-0.926569924361936, 51.62976860145066], [-0.926465515994788, 51.62966244509719], [-0.926222881099496, 51.62935271335746], [-0.925807083215573, 51.62885077488713], [-0.925685153671251, 51.62869140695483], [-0.925627779063265, 51.628612654944924], [-0.925107975398826, 51.62780494620014], [-0.925039238852947, 51.627717997425265], [-0.924853081975605, 51.627525670804864], [-0.924566287633664, 51.62725149768458], [-0.924018135317732, 51.62666651663998], [-0.9236755124427, 51.62631000590676], [-0.923506463123086, 51.62618886774415], [-0.92325024557972, 51.62602736696645], [-0.923179326155173, 51.62597186775246], [-0.923151247824846, 51.62593744208942], [-0.923025917353845, 51.62573937605691], [-0.922746731858051, 51.625388839233764], [-0.922647729925315, 51.625421200084226], [-0.922438316532782, 51.62517470633975], [-0.922266691774008, 51.62491866820555], [-0.922176577184834, 51.624819832363215], [-0.921722712186069, 51.62440384906751], [-0.921324388846087, 51.624082786314446], [-0.921078577970903, 51.623909687134365], [-0.920860652296657, 51.62377910436709], [-0.920574889783577, 51.623646099345635], [-0.920239048968319, 51.623492851580735], [-0.920014292502202, 51.62371107994427], [-0.919774493442185, 51.623954346092496], [-0.9196346398006, 51.62406455586703], [-0.919395541436808, 51.62427815528515], [-0.919291601043514, 51.624396787581134], [-0.919216417933559, 51.6245210794288], [-0.919153464283899, 51.62467785367513], [-0.919134125069682, 51.624762197061855], [-0.919115026043568, 51.62495803894169], [-0.919049238753011, 51.62517323267518], [-0.919009465019033, 51.625266379578875], [-0.918926652164549, 51.625407685106715], [-0.91889138185638, 51.62549368011671], [-0.918887531877765, 51.62553410703284], [-0.918896749679156, 51.62569334383204], [-0.918892707420934, 51.62574186144837], [-0.918872585162246, 51.62579832350382], [-0.918836276012485, 51.62586722482348], [-0.918763089019947, 51.62596815648993], [-0.918486277330256, 51.626309088016214], [-0.918317614737411, 51.62653682130949], [-0.917905561785174, 51.626975413689514], [-0.917718470441796, 51.62724883363936], [-0.917588198962995, 51.627380709193844], [-0.917518986462533, 51.627435819379606], [-0.917391270738013, 51.627520961779815], [-0.916852199941663, 51.62783249660931], [-0.916708494011591, 51.62822500463541], [-0.916564194300437, 51.62882431452802], [-0.91642514281193, 51.62950639562586], [-0.916399138398425, 51.62974892972319], [-0.916394191477189, 51.62995659074321], [-0.917260413231125, 51.62992321851857], [-0.917422640699178, 51.63166639247214], [-0.91745600722272, 51.63232848375385], [-0.917204699151121, 51.632324368705305], [-0.916787813832452, 51.632356490901394], [-0.916473041038736, 51.63240843616508], [-0.91615824611563, 51.63246127954521], [-0.916096846672852, 51.632491284427324], [-0.916000979824314, 51.632573122584574], [-0.916035541448316, 51.63300234215989], [-0.916058746179642, 51.633180590521675], [-0.916070697537387, 51.63322475979131], [-0.916098260729099, 51.63328076225654], [-0.916287121367376, 51.6334803208717], [-0.916556537933578, 51.63369500893812], [-0.916833436931067, 51.63389897542989], [-0.916980624704717, 51.63396776999687], [-0.917236275570907, 51.634093312450645], [-0.91746761535009, 51.63414759643489], [-0.917599467742121, 51.63382870989293], [-0.917652284973834, 51.63367364156546], [-0.917677934007693, 51.63362802065708], [-0.917745133700401, 51.63359716923921], [-0.917749446066394, 51.633598108140106], [-0.917778102484095, 51.633608262991594], [-0.918084580428658, 51.633662338963], [-0.918258883815884, 51.633684625273325], [-0.918506861448772, 51.63370758977881], [-0.918953829589691, 51.63374767133924], [-0.919245145699076, 51.633771033193085], [-0.919300707852053, 51.63386505735126], [-0.919518444759651, 51.63449197843591], [-0.919277685382965, 51.63446908250848], [-0.919031520477806, 51.63467362436313], [-0.918786199566619, 51.63490335001199], [-0.918632752044247, 51.63503681158531], [-0.918623327237537, 51.63512933850577], [-0.918590569006466, 51.635413172104], [-0.918679820058316, 51.63554886817429], [-0.918329488250497, 51.63557621368664], [-0.918276435808259, 51.635741170885815], [-0.918247752304029, 51.6360358318421], [-0.918226764712395, 51.6364321689642], [-0.918316733144818, 51.63702374696847], [-0.918287332378286, 51.63783452012518], [-0.918306713699577, 51.63835621240955], [-0.918316674296085, 51.639213205140855], [-0.918347519668651, 51.639799742499974], [-0.918322169732004, 51.63995416480466], [-0.918318885834364, 51.64003146244247], [-0.91832686087795, 51.64012145202931], [-0.91837911416845, 51.640354816042915], [-0.918418495846573, 51.64070405330022], [-0.918530296534871, 51.64128953760163], [-0.918512952473936, 51.64147190762244], [-0.918367217757134, 51.64200916315153], [-0.917905817511154, 51.6420255938785], [-0.917874522823857, 51.64200462484983], [-0.9178264462409, 51.64196012300076], [-0.917792775459127, 51.641917552189355], [-0.917773553228143, 51.64187511449974], [-0.917765526057023, 51.64184806570082], [-0.917757894232724, 51.6417436926823], [-0.917749532884981, 51.64142711089125], [-0.917739557627689, 51.64136048104305], [-0.917720785029217, 51.641299165096676], [-0.917688816437575, 51.64124581999865], [-0.917649452591449, 51.641199600032465], [-0.917568381483579, 51.64114490323613], [-0.917433423830488, 51.64098630616572], [-0.917315173490429, 51.64079369481265], [-0.916601390868836, 51.640243120219885], [-0.916329281834837, 51.640018517003504], [-0.916001068304932, 51.63966211774633], [-0.915790319174844, 51.63947044935813], [-0.915502073944432, 51.63913509831614], [-0.915393357554307, 51.63902799332443], [-0.915169439572157, 51.63884339546647], [-0.914312592230519, 51.638234837864296], [-0.913969150495335, 51.63797270396478], [-0.913808719070197, 51.63773204326735], [-0.913709021859032, 51.63761063348384], [-0.913238840648949, 51.637814889395024], [-0.912211197236081, 51.63818662075986], [-0.912057780107923, 51.6382571327065], [-0.911911629192503, 51.63832591344631], [-0.911683066608314, 51.6384568717294], [-0.911571655864317, 51.638583520328496], [-0.910821072629623, 51.63897039510019], [-0.910799442348496, 51.63890815232427], [-0.910457034748542, 51.63884473254883], [-0.90959863753988, 51.63872527019996], [-0.909397970101408, 51.639078576087414], [-0.909048252097236, 51.63925965643008], [-0.909362542404515, 51.63959166868019], [-0.90780907162756, 51.64013291512084], [-0.906217399025103, 51.640939038154336], [-0.905898125060113, 51.64111499768922], [-0.905490384709512, 51.641363863281036], [-0.905329841704473, 51.64154939281248], [-0.905189541321435, 51.641794455508446], [-0.90489098319803, 51.64194992468491], [-0.904781623731163, 51.641990266433346], [-0.904676706895303, 51.64202615370086], [-0.904609919053975, 51.64203901826923], [-0.904237228330216, 51.64209218907456], [-0.90337364044862, 51.64224597828853], [-0.902975191138407, 51.642348358507896], [-0.90292303291413, 51.6422939216028], [-0.902563354675933, 51.64240655335107], [-0.902346768622897, 51.642458479170756], [-0.900824166346957, 51.64291090498388], [-0.900831401206159, 51.64297031739377], [-0.900456613238591, 51.64299018760407], [-0.900019098619797, 51.64297440185565], [-0.899740380937974, 51.64290615240652], [-0.899740489711103, 51.64290165761423], [-0.899316872364163, 51.642849133775655], [-0.899203336991784, 51.642822893203494], [-0.898949902655656, 51.64272520647125], [-0.898783095909619, 51.642631028913314], [-0.898613530793898, 51.64253143027416], [-0.898274969154989, 51.64230885935864], [-0.898003026265053, 51.642080618381755], [-0.897815191816853, 51.641840577798526], [-0.897681652652772, 51.6416262230417], [-0.897327401428262, 51.64091885338664], [-0.896908641882592, 51.6401308512027], [-0.896689777704333, 51.63985994571793], [-0.896199107519928, 51.639356299928586], [-0.896147069948886, 51.63929736526477], [-0.896071667668875, 51.63912941223961], [-0.896034388155249, 51.63881974973283], [-0.89604243255033, 51.63866696761571], [-0.896079873457203, 51.63849378104931], [-0.896158355572289, 51.63829670279626], [-0.896345617779906, 51.63796397393339], [-0.896436991088377, 51.637771512438086], [-0.896627579786388, 51.63748017587825], [-0.896853716275347, 51.63721255114492], [-0.896930541034958, 51.63714313797598], [-0.897052325259386, 51.63706695367484], [-0.897622203318074, 51.636806151704704], [-0.897875248140837, 51.636679946210485], [-0.898045509693898, 51.63657094674504], [-0.898161794997489, 51.63648302058021], [-0.898300490282884, 51.636364732965696], [-0.898761753797595, 51.63587451909389], [-0.898944791614438, 51.635595696246455], [-0.899167964890093, 51.63497197055003], [-0.899296205851425, 51.63450920414348], [-0.899574174378538, 51.633591065468096], [-0.89965934952667, 51.63323579470252], [-0.899745200652967, 51.632733067337156], [-0.89977291429982, 51.632065248259224], [-0.899749317297925, 51.63190587518938], [-0.899730833669311, 51.631833768913715], [-0.899698165870897, 51.631750739777836], [-0.89965967663145, 51.63166945441679], [-0.899415121605884, 51.63126703489972], [-0.899342021743563, 51.6311233827535], [-0.899274678557411, 51.630980683675816], [-0.899221406706553, 51.63067446858268], [-0.899099405183406, 51.63046202142283], [-0.899036514315775, 51.63037421293725], [-0.898969246754073, 51.63028816171176], [-0.898790586842518, 51.63008867047265], [-0.898592010806669, 51.62987640386868], [-0.898497321924236, 51.62978919602221], [-0.898330098469121, 51.62965455114822], [-0.898092642525963, 51.62949676796704], [-0.897090362270362, 51.62894426419184], [-0.896737033461809, 51.62879887742956], [-0.896347312922056, 51.6286648367393], [-0.895633444660858, 51.62837398981453], [-0.895432402381131, 51.628264199314984], [-0.895328663542796, 51.62819308870188], [-0.895257753282041, 51.62813847178444], [-0.895144755729953, 51.62803220648194], [-0.894948239644532, 51.627795675481295], [-0.894944118635818, 51.62766795529761], [-0.894659948504904, 51.62723368184], [-0.894597856997988, 51.62711350846984], [-0.894557343909314, 51.62699713484451], [-0.894469809950127, 51.62655661915932], [-0.894297931114171, 51.625960652861906], [-0.894027819576293, 51.62530531541029], [-0.893931965007508, 51.62514795788166], [-0.893770350871199, 51.62496210671055], [-0.893637995566781, 51.62476124514902], [-0.893507481839104, 51.62466290563429], [-0.892108104715385, 51.62369479825078], [-0.891788795844237, 51.623459800649094], [-0.891922368328922, 51.62337294285213], [-0.891402229815371, 51.62296161084893], [-0.891224922435199, 51.622768414566416], [-0.890089770742591, 51.621276764770215], [-0.890188416566163, 51.62120036880181], [-0.889947380146256, 51.62101466068101], [-0.889727152716072, 51.62086421627997], [-0.889328903798693, 51.62066892786315], [-0.889153387824523, 51.620758083474584], [-0.888409981594066, 51.6201459098237], [-0.888016456293258, 51.619876030785385], [-0.887588982852847, 51.619754191291285], [-0.887143566599165, 51.61965735685454], [-0.88701981132148, 51.61963820065132], [-0.886790744842007, 51.619613550199404], [-0.886603228328527, 51.619602780759124], [-0.886388075513318, 51.619599841439666], [-0.886090409498186, 51.61960421155123], [-0.8851368584814, 51.61967159165818], [-0.883828125903616, 51.61979133688442], [-0.883515973065361, 51.619797361107345], [-0.883424375160774, 51.6198216668555], [-0.883259776293847, 51.619877648328995], [-0.883163867754863, 51.61990101371408], [-0.883044634749604, 51.619815357981636], [-0.881854770311083, 51.61956485587701], [-0.881704286246311, 51.61951666620604], [-0.881635675440863, 51.619487239450166], [-0.881560131370525, 51.619446057447796], [-0.881477720403852, 51.619390423316226], [-0.881374708667671, 51.619291432867335], [-0.880834298239682, 51.61853547912722], [-0.880617549323506, 51.618127888748454], [-0.880388345702594, 51.61816796449318], [-0.879226788544387, 51.6185884841998], [-0.878534686661489, 51.61883184500677], [-0.878385021629543, 51.61898507235025], [-0.878148819949825, 51.61913297697072], [-0.878102165244257, 51.61915051459153], [-0.87804120240859, 51.61916252048532], [-0.877967464227806, 51.619165412606506], [-0.877896924603018, 51.61915574690363], [-0.877839648002824, 51.61913541789456], [-0.877812586845032, 51.61911987344738], [-0.877382402665225, 51.61869944717381], [-0.877261875140598, 51.61866682400238], [-0.877087293116294, 51.618600414623565], [-0.876592344555959, 51.61846350297477], [-0.876408990128558, 51.61845995037962], [-0.876374465270622, 51.61845422502283], [-0.876347205240439, 51.61844677083749], [-0.87630299358364, 51.61842386858449], [-0.876241963569583, 51.618380124514495], [-0.876216636094276, 51.618352907107045], [-0.876152781748704, 51.618131100785114], [-0.876106882196741, 51.61811807314475], [-0.876305643178539, 51.617614643124426], [-0.875030363348109, 51.6174927341714], [-0.874705473526163, 51.61748872204597], [-0.874564111923802, 51.6174810731233], [-0.874279482039409, 51.61730930128958], [-0.874259717266618, 51.61699889890464], [-0.874416434195306, 51.61673604585861], [-0.874423036602998, 51.61652750219062], [-0.870144618410033, 51.61769939147719], [-0.870074692270606, 51.617607003497994], [-0.869665459226217, 51.61768399010514], [-0.869137937974611, 51.617812887107476], [-0.868711126950696, 51.61789959196275], [-0.868460959800069, 51.617969115035805], [-0.866874516019656, 51.61827841686334], [-0.866642434191741, 51.6183175388698], [-0.866517885416195, 51.61833072340073], [-0.866392071649004, 51.61833670224208], [-0.865776872894858, 51.61833166083683], [-0.865633662902087, 51.618340168339564], [-0.865493072065054, 51.618359490991885], [-0.864874419821269, 51.618492883413026], [-0.864829070270363, 51.61851582340227], [-0.8648101986804, 51.61846169086974], [-0.864778464993556, 51.618402038980314], [-0.864733824417545, 51.61833866562683], [-0.864681918741689, 51.61827702035103], [-0.864649512487616, 51.61824433697217], [-0.864492159027339, 51.61812502442397], [-0.864510219622979, 51.618037979732996], [-0.864490008258273, 51.61792179156664], [-0.863791866117017, 51.616668790850674], [-0.863578496430752, 51.61619016667409], [-0.863939572338851, 51.6160749702936], [-0.864141702322916, 51.61602027805823], [-0.864343742093738, 51.615969181278444], [-0.864684853799959, 51.61590144547291], [-0.864287415633653, 51.61573755014447], [-0.864114344880943, 51.615611790807684], [-0.86394143216696, 51.615479738556914], [-0.863424226660599, 51.6150224515856], [-0.863108525016747, 51.61470918210108], [-0.862999136822108, 51.61463618943345], [-0.862947760773663, 51.614611414387845], [-0.862827479233939, 51.614569786988696], [-0.862764327092327, 51.6145538895073], [-0.862690954996651, 51.614542388851355], [-0.862422671693898, 51.614528100870835], [-0.862278208948609, 51.61452939875511], [-0.862025067586916, 51.614544929155834], [-0.861633333855888, 51.61461576315295], [-0.861195617216796, 51.61467715820802], [-0.860991546767721, 51.61469406144679], [-0.860819513274215, 51.61470048511226], [-0.860591345418716, 51.61469917048917], [-0.860366335624517, 51.61468709604235], [-0.860199196800327, 51.61467108707321], [-0.860140174693704, 51.6146633207896], [-0.859842784619867, 51.61460018922178], [-0.85969929013584, 51.61456282905675], [-0.859501466379857, 51.61450336097874], [-0.859306643699259, 51.614439425872085], [-0.859175017225196, 51.614389591981386], [-0.858977780895874, 51.61430675031806], [-0.858172868778381, 51.61392127488393], [-0.856305510909038, 51.61299763777437], [-0.855879431428414, 51.61282624136621], [-0.855413827571698, 51.612676038205095], [-0.855073660630441, 51.61259179657028], [-0.854915624510577, 51.612558784566126], [-0.854688372582268, 51.61252150056368], [-0.854459541396129, 51.6124895957323], [-0.854208848612115, 51.61246556965946], [-0.853413812340721, 51.612436228916096], [-0.851724243907319, 51.61242871018406], [-0.851450292115, 51.612410744947404], [-0.850998615679464, 51.61233888823236], [-0.850653274334699, 51.61223120468302], [-0.850372939737194, 51.61235164666859], [-0.850315593337778, 51.61233490012849], [-0.850193999216673, 51.612288751000705], [-0.850146601119627, 51.612278395984944], [-0.849926028861458, 51.61226274823948], [-0.849854084982468, 51.61225215268858], [-0.849714847013531, 51.612218418620564], [-0.849473435162227, 51.61217019573735], [-0.849372523204365, 51.61216291272777], [-0.849235958321253, 51.61219484371945], [-0.849170915863905, 51.6121969037703], [-0.849112126238191, 51.61218014249445], [-0.8487984760956, 51.61201881385575], [-0.848813983178796, 51.61186251023449], [-0.848805967905994, 51.611779707971536], [-0.848777693193183, 51.61169850541887], [-0.848751669639592, 51.61164250170296], [-0.848740414389996, 51.61163070213332], [-0.848685616135578, 51.61162746733029], [-0.848598109857592, 51.61148993537107], [-0.848561752293423, 51.61144282198033], [-0.848420551583887, 51.61131555337684], [-0.848346143135118, 51.61123120073643], [-0.848017978126262, 51.61073074025961], [-0.84803240586268, 51.61067423405594], [-0.848009203184881, 51.61062095534751], [-0.848010806265629, 51.61061467688053], [-0.848360723390725, 51.61054078070849], [-0.848731046077576, 51.61040234328455], [-0.848814480324059, 51.61035820278237], [-0.848820437461021, 51.610351067821576], [-0.848690278305866, 51.610072847084595], [-0.847947554822518, 51.60900543974003], [-0.847435103308081, 51.6083125448088], [-0.847167998407497, 51.60796823756615], [-0.846186886755928, 51.60662333116728], [-0.845549998419521, 51.605828497430636], [-0.845383680959569, 51.60566770865375], [-0.844840468159951, 51.60522267062485], [-0.84443530295085, 51.60497141150611], [-0.844232696249957, 51.60481835643492], [-0.843486943931864, 51.60416181103064], [-0.84332558359401, 51.60420428093958], [-0.842908147301968, 51.603868373383044], [-0.842663709069561, 51.603714004109015], [-0.842310199280505, 51.603533382087996], [-0.841471682375652, 51.60311958453644], [-0.841215384127901, 51.602977683579475], [-0.840873068217364, 51.60281155440105], [-0.840467421086961, 51.602637605395635], [-0.840268344470896, 51.602516948405764], [-0.840203154295604, 51.60246864832527], [-0.838474883614574, 51.601841924417336], [-0.838334815858368, 51.60178568911777], [-0.838125139250388, 51.60168470536249], [-0.837520083534699, 51.60134782062488], [-0.837365310402971, 51.60124558073874], [-0.837143016970701, 51.6010734356079], [-0.83702163004049, 51.600964332538595], [-0.836879440722268, 51.60082175386177], [-0.836733036616179, 51.60067463738169], [-0.836105420124444, 51.59992210370809], [-0.836001567218505, 51.59980508080317], [-0.835894758960057, 51.59969072601903], [-0.835646409012494, 51.5994652683849], [-0.835572705263831, 51.59941148620318], [-0.835355212679077, 51.599278049641256], [-0.835001490423373, 51.59910819321327], [-0.834666328550124, 51.59894661249016], [-0.834023851532118, 51.59860753956394], [-0.833813699592692, 51.59846967713012], [-0.832219972267628, 51.59727861587006], [-0.831975375091702, 51.59713321406168], [-0.83180286996819, 51.597047874561696], [-0.83156138306724, 51.59695015903964], [-0.831279067386554, 51.596868221715724], [-0.831119729288761, 51.59683246683902], [-0.830996129682144, 51.596810555210986], [-0.830798964246538, 51.59678611250204], [-0.829935838169309, 51.596720865686486], [-0.82967342169104, 51.596707460026586], [-0.829378950815281, 51.59670542343618], [-0.828672101908656, 51.596738836236966], [-0.828529092462618, 51.59674190522934], [-0.828241907711544, 51.596737240965595], [-0.828066024571149, 51.59672739285258], [-0.827854311754233, 51.596707295846045], [-0.827399248313258, 51.59666228882735], [-0.827164974703315, 51.59662128423301], [-0.827063074447412, 51.59659778687348], [-0.826830893268571, 51.59653162563389], [-0.826403126611598, 51.596379885757386], [-0.826320361645679, 51.596342192238744], [-0.826196596762853, 51.596270819297594], [-0.825930135887572, 51.596078429107884], [-0.825702044863314, 51.59590980062742], [-0.825239717878873, 51.595531118786504], [-0.824901250965003, 51.59522021379687], [-0.824412039116432, 51.59470908081712], [-0.8242790371805, 51.59460434384618], [-0.824162427084317, 51.59453573788591], [-0.823734544991122, 51.59433363318264], [-0.822923577534385, 51.59387232098135], [-0.82274220720895, 51.593740122024236], [-0.822758790294358, 51.59343366962803], [-0.822450529949737, 51.592123177421634], [-0.822408018987733, 51.591980681321466], [-0.82236394886053, 51.59184266543808], [-0.822242174035691, 51.59158338051977], [-0.821801765862476, 51.5908065697487], [-0.821372709449585, 51.59009371260957], [-0.821171850754746, 51.58982284235581], [-0.820679968304875, 51.58936291919855], [-0.820417155492676, 51.58914357740762], [-0.82015811620844, 51.5888901042506], [-0.820045903377484, 51.58876399099103], [-0.81975498206002, 51.5884040936899], [-0.819793038416411, 51.58838379523831], [-0.819648800144719, 51.588268149727725], [-0.819147039514258, 51.58763368041164], [-0.818936357700162, 51.58740856531028], [-0.818746726401906, 51.58698404449756], [-0.818744261992127, 51.58691208559554], [-0.818786542624285, 51.586561832259704], [-0.818798419467402, 51.58638211648965], [-0.818772601288344, 51.58593047014409], [-0.818622316220491, 51.585380460186784], [-0.818493730937228, 51.58471737211902], [-0.818460174123387, 51.58461992329734], [-0.818316632401033, 51.58436670899539], [-0.818092592164715, 51.58404524580265], [-0.817774082795079, 51.58341531231479], [-0.817553796530972, 51.58311636524129], [-0.817445537064436, 51.58300557512581], [-0.81689125274485, 51.582562990062094], [-0.816348587477007, 51.58217357091916], [-0.816214612729635, 51.58210837837547], [-0.816144330954904, 51.58209148442308], [-0.816059129697027, 51.58209332267878], [-0.815742672724781, 51.5820523651453], [-0.815217212787465, 51.58194545592985], [-0.815002344756643, 51.58188304223224], [-0.814826435408141, 51.5818210214772], [-0.814485295861823, 51.581730356582035], [-0.81444044205173, 51.581790148477246], [-0.813566956536122, 51.581635656767844], [-0.813282023122958, 51.58154825394594], [-0.813052037332166, 51.581456910143594], [-0.812870182657061, 51.581346270732034], [-0.812790810356639, 51.58129061819263], [-0.812604263086127, 51.581138568732094], [-0.812386509085548, 51.58085492331321], [-0.812249092317067, 51.58070067277682], [-0.812167619564544, 51.58055957666617], [-0.812051961231651, 51.58029045130041], [-0.812042798783181, 51.580254391465495], [-0.812034433182585, 51.580187767648724], [-0.812033188044369, 51.58012481260171], [-0.812058064730261, 51.580000977815104], [-0.81229781440549, 51.579440518478464], [-0.812247901650195, 51.57941753400863], [-0.812446355706805, 51.57916777205078], [-0.81277233113049, 51.578787120404634], [-0.813191367818544, 51.57821318632392], [-0.813476583358647, 51.57767926033569], [-0.81372993476285, 51.57714950751218], [-0.813894821439398, 51.57669169369027], [-0.813998634879093, 51.57614064720803], [-0.814138744624452, 51.57508193151095], [-0.814120940539715, 51.57493428638376], [-0.81419874804071, 51.57321943977239], [-0.814492542549023, 51.572575897898666], [-0.814547744449169, 51.57211787423915], [-0.814549364628156, 51.57200009817749], [-0.81449843948966, 51.57157247390041], [-0.81447275908744, 51.57022974030085], [-0.814470739157426, 51.56964165674743], [-0.814429823166273, 51.56938407823071], [-0.814416473674158, 51.5693425811485], [-0.814362577800679, 51.569251219648685], [-0.81406844007837, 51.5689659058573], [-0.813908308238922, 51.56874308971205], [-0.813853532979604, 51.56863013877188], [-0.81375715260415, 51.56839717647337], [-0.81371284208748, 51.56815934527622], [-0.813667666933597, 51.567788426746645], [-0.813915408556528, 51.567527470860746], [-0.814280993234198, 51.56684059466537], [-0.814704823511867, 51.56613272518902], [-0.814994772052415, 51.56569055892733], [-0.815202529336662, 51.56519091397622], [-0.815219131565213, 51.56505170869626], [-0.815351636137841, 51.564671793906264], [-0.815511116853932, 51.56436408558186], [-0.815565592175225, 51.5642108755608], [-0.815662011458114, 51.564053592855515], [-0.815731002538058, 51.56389693250399], [-0.815762954470268, 51.56377766396064], [-0.815882314039101, 51.56307031436626], [-0.815899206541573, 51.563030920866616], [-0.815918960262566, 51.5629924554096], [-0.816100387305838, 51.56272812828101], [-0.816239061970809, 51.562387838558415], [-0.816351227865814, 51.56217946080997], [-0.816402225233145, 51.562104443964415], [-0.816445731089239, 51.56204014171416], [-0.816755073070336, 51.56173843863565], [-0.81682883069147, 51.5615089920632], [-0.81709149295673, 51.56100450196165], [-0.817126546068515, 51.5610435199925], [-0.817036868291134, 51.56144185218239], [-0.817602599672938, 51.56148891511105], [-0.817650902097453, 51.56129517879352], [-0.81772376875861, 51.56109989153342], [-0.818544773098936, 51.56114952106405], [-0.818940645385275, 51.56112652991029], [-0.819286252234888, 51.56087194248433], [-0.820505192935939, 51.560762809232635], [-0.821152924392013, 51.56109751750433], [-0.821401734784996, 51.56112699167495], [-0.821468077854438, 51.561127657861135], [-0.821837057068471, 51.56108460493917], [-0.822551882107614, 51.56083281445182], [-0.822991148836609, 51.56069335159132], [-0.823298868990794, 51.56056425765945], [-0.823427756279142, 51.560489119484224], [-0.823816316952276, 51.56018999039105], [-0.823841530161624, 51.56016326766115], [-0.823879440321637, 51.5600917131651], [-0.823939663402364, 51.55926686943448], [-0.824000930577316, 51.55924050793579], [-0.823876052668265, 51.55798579953388], [-0.823797968341331, 51.557154174451156], [-0.823813910366727, 51.55698348995032], [-0.824268965579194, 51.556733581409404], [-0.824612742777356, 51.55649154853787], [-0.826344281900068, 51.55484359477631], [-0.826657025878971, 51.55457337099326], [-0.827233265990788, 51.554040521447654], [-0.827929376968602, 51.55344502444081], [-0.828029419518581, 51.553368693973354], [-0.828246668974642, 51.55322159923911], [-0.828485269800709, 51.5530855074047], [-0.828605105979095, 51.55302466009866], [-0.829372820563392, 51.55267264797847], [-0.830416538296143, 51.552300003050114], [-0.830341853307235, 51.55217517181714], [-0.830015969895102, 51.55217192349864], [-0.82991663595149, 51.55216463892005], [-0.829524156953837, 51.55211486704629], [-0.829282415323888, 51.552092673855796], [-0.828838545910614, 51.55207835426137], [-0.828599504055965, 51.55206338004898], [-0.828680519991051, 51.55199764928292], [-0.828534433277995, 51.55195752639793], [-0.828384829125967, 51.55188589688778], [-0.827987906418731, 51.55167242458396], [-0.827957477145366, 51.551621766572], [-0.827834232346298, 51.55159086272802], [-0.827633977763617, 51.551525919798664], [-0.827259642164726, 51.55144395104261], [-0.826879262755715, 51.5513727108443], [-0.826619197529414, 51.551334143723224], [-0.825020961294276, 51.55117248609027], [-0.825087548806697, 51.55099511486544], [-0.825080332863119, 51.55093929339289], [-0.825041927300218, 51.55086247849746], [-0.82502361605882, 51.55078946149474], [-0.825044884876699, 51.55069166368164], [-0.825058487270179, 51.550667521970404], [-0.82509857658956, 51.550622964257876], [-0.825145597538488, 51.55058926609727], [-0.825325151596322, 51.5505056412203], [-0.824909915146001, 51.550164291306395], [-0.82525013660448, 51.550002248032946], [-0.825332063085088, 51.549957209837], [-0.825638185418255, 51.54977504214384], [-0.82578350044032, 51.54967668704559], [-0.825923116734683, 51.54957557721289], [-0.826170603160388, 51.54937393870707], [-0.826371785812396, 51.54917813090106], [-0.826492161334072, 51.549039961540565], [-0.826611394860751, 51.548890091280356], [-0.82670116630089, 51.54876420424681], [-0.826782355507479, 51.54863553380353], [-0.826823019292071, 51.54856850170786], [-0.827062757600335, 51.548106920435835], [-0.827101368877001, 51.54800749719491], [-0.827194201898492, 51.54770629998806], [-0.827307057244965, 51.54741159704493], [-0.827582602426052, 51.54684696658141], [-0.827901482950928, 51.54639156924703], [-0.828226190833503, 51.54604592938406], [-0.828636291311094, 51.545744301711125], [-0.82879259021163, 51.54566673370386], [-0.828904643767125, 51.545627388779295], [-0.829074413403866, 51.54558682127211], [-0.829642313890905, 51.54554213206049], [-0.831137752395514, 51.5457125947128], [-0.831296230672639, 51.545718668970665], [-0.831381409559054, 51.545715021306385], [-0.831520416985355, 51.54569302674314], [-0.831658465956176, 51.54565213966273], [-0.832162223002951, 51.54540897973132], [-0.832259763552867, 51.545373083913695], [-0.832342495362879, 51.54535232675641], [-0.832449690786029, 51.545333611293344], [-0.832560958333776, 51.54532482723805], [-0.832748224427793, 51.54533298427906], [-0.833594396864807, 51.5455158387706], [-0.833803468208608, 51.5455736658201], [-0.834066591719905, 51.54566080332341], [-0.834319302360527, 51.54576042533909], [-0.834632701147966, 51.545911902800114], [-0.834743597643834, 51.54597414830218], [-0.834972095381443, 51.546118487532766], [-0.835101437527799, 51.546192605160904], [-0.835308853525451, 51.54642845092972], [-0.835597379030446, 51.546650714213946], [-0.835675530378703, 51.54669644865621], [-0.835765285050956, 51.54673960061442], [-0.835946924814448, 51.54679895002405], [-0.836738145066418, 51.54693268079673], [-0.837616543696299, 51.54698454508781], [-0.837668585980954, 51.546979665457], [-0.837867989708348, 51.546964555807335], [-0.83797367625272, 51.54694851789646], [-0.838105566972017, 51.54692284834119], [-0.838233315283634, 51.54688994418392], [-0.838329229403341, 51.54686122067977], [-0.838482151664417, 51.546802489195365], [-0.839036827411148, 51.54642762424692], [-0.83955396219585, 51.54605418383688], [-0.840116011657223, 51.54567219327131], [-0.840736658187885, 51.54525391246058], [-0.840941426195899, 51.54514083988849], [-0.841049279937165, 51.54509604683764], [-0.841194847094701, 51.5450426342828], [-0.841299520083949, 51.545009498946165], [-0.841898633062652, 51.544870644649805], [-0.842282244574123, 51.54481328536381], [-0.842762474116396, 51.54475597844143], [-0.843565178344648, 51.54477737891959], [-0.844086979548171, 51.54484366398717], [-0.845732620874625, 51.545006428046236], [-0.847066038668597, 51.54519847249473], [-0.847735465249349, 51.545415455459946], [-0.84773690700669, 51.54541546961599], [-0.848634731053663, 51.54572550693968], [-0.849946581441456, 51.54620234699594], [-0.850255922443757, 51.54628810259981], [-0.850450510421732, 51.5463493547082], [-0.850677807173489, 51.54642891042725], [-0.850994850981171, 51.546552505063595], [-0.852786328510159, 51.547342426670774], [-0.85300310746802, 51.547496506935786], [-0.853571212311598, 51.54778799706584], [-0.854020445083318, 51.54798930492918], [-0.854581807452525, 51.548205193183556], [-0.85478620907829, 51.54827822314386], [-0.854963577157503, 51.54833660211785], [-0.855161244465997, 51.54839068294659], [-0.855663052553423, 51.5485088736389], [-0.856166529832507, 51.54867563412252], [-0.856279761006, 51.54870371304979], [-0.856530960852844, 51.54875111981111], [-0.856804082121709, 51.54878705024175], [-0.857112033920981, 51.54881432744164], [-0.857381573472553, 51.548820548731904], [-0.857549123049589, 51.54881049056259], [-0.857844479857821, 51.548764809719025], [-0.858057604662229, 51.54872012637499], [-0.858337617310588, 51.54865361386837], [-0.858552497890933, 51.54859635820055], [-0.859049392399301, 51.548450127924276], [-0.859439117962245, 51.5483792842905], [-0.859697682244768, 51.54836291412634], [-0.859779823131423, 51.54836551056866], [-0.860170027263243, 51.548390881318824], [-0.860456238387038, 51.54842243448379], [-0.861009536104037, 51.548500639150554], [-0.861158816462501, 51.54852906321894], [-0.861352413335375, 51.54857320311727], [-0.861544411683264, 51.54862362144007], [-0.861731905414109, 51.5486811891874], [-0.862073439754406, 51.548807688741114], [-0.86254414698236, 51.54901726458452], [-0.86282747298222, 51.54916477803516], [-0.863015068128655, 51.549276295417606], [-0.863120154717426, 51.549342054318615], [-0.863285809311142, 51.54946594721784], [-0.863418211576468, 51.54959311456195], [-0.863530092020445, 51.54973357070672], [-0.863653360363745, 51.549937978681236], [-0.863733641061499, 51.550131180181424], [-0.863790336700716, 51.5503448343906], [-0.863824973966162, 51.550691353426465], [-0.863841717303786, 51.55100353042492], [-0.863889686614544, 51.55116225019172], [-0.863971345177536, 51.55135816235228], [-0.864192531443895, 51.5518009005184], [-0.864636908176204, 51.552606367995786], [-0.864885616784935, 51.55304487507487], [-0.864984710926909, 51.55317801261536], [-0.865042267578469, 51.5532415116859], [-0.86524661818949, 51.553434113390985], [-0.866448255146234, 51.55464702695421], [-0.866553639357719, 51.55475954277147], [-0.86713929523259, 51.555454866418074], [-0.86728119491555, 51.55560729781788], [-0.867357192432134, 51.55568356216347], [-0.867846797612144, 51.55612348793147], [-0.867948777192819, 51.5561991033314], [-0.868039688780355, 51.55625572917072], [-0.868162193200772, 51.55631805467487], [-0.868334859667638, 51.55639345221028], [-0.868507816648064, 51.556457162985154], [-0.868686743286876, 51.556512838449954], [-0.868885971532242, 51.55656421341042], [-0.869870431325262, 51.55700170522159], [-0.870538382015661, 51.557289577406756], [-0.87065953954758, 51.55734829060127], [-0.870968323528286, 51.55751940747054], [-0.871084688448939, 51.55759695683154], [-0.871173919806704, 51.55766345498963], [-0.871421843971099, 51.55790412108149], [-0.871517352960249, 51.558008444760674], [-0.871560414081151, 51.55807539786269], [-0.871689483441928, 51.558339198343305], [-0.871715457861831, 51.558455441841], [-0.871819115572425, 51.558871857901316], [-0.872116688986198, 51.559438501590606], [-0.87224925001588, 51.559678057158926], [-0.872395481580982, 51.5598898694294], [-0.872503199025109, 51.56002578071336], [-0.872616797176149, 51.56015725249727], [-0.872767427555836, 51.560307962534345], [-0.873712440787397, 51.560887112412736], [-0.874019840047307, 51.56105730856152], [-0.874413245272104, 51.56124990894107], [-0.875159636577155, 51.56157807024888], [-0.875469862748955, 51.561692540724444], [-0.875618818634067, 51.561736229028845], [-0.87605776549836, 51.56183754414599], [-0.876366373823489, 51.56190074371407], [-0.87668521195865, 51.561958645316366], [-0.876968369886447, 51.56200091867397], [-0.877197163756339, 51.56202468778881], [-0.877516822654725, 51.5620493254706], [-0.878098847659676, 51.56208186543848], [-0.879220205739232, 51.56212315048378], [-0.879742407250114, 51.562124539056946], [-0.8803196812009, 51.56211566057546], [-0.88047709073344, 51.562109069498774], [-0.880781923890852, 51.5620912956137], [-0.881058065229737, 51.56206695318683], [-0.881262135404653, 51.56204012483733], [-0.881418631531618, 51.562011943580096], [-0.881649213834679, 51.56196288783239], [-0.882003250428868, 51.56187993977645], [-0.882376388095226, 51.56178278572967], [-0.882764299497775, 51.56167138432022], [-0.883194585739291, 51.561537905452155], [-0.883498576630078, 51.5614364931922], [-0.883756281221724, 51.56134003501421], [-0.884086956514705, 51.56120920221847], [-0.884407665982054, 51.56107287871968], [-0.885457870533961, 51.5606602434964], [-0.885606584631741, 51.56059601575753], [-0.88578613479336, 51.56050960117672], [-0.88595858283258, 51.56041862303493], [-0.886091760097573, 51.560340759581955], [-0.886521253482028, 51.56006159461465], [-0.886883345687433, 51.559824949307504], [-0.887389733197074, 51.559468282123994], [-0.887580604245187, 51.55927227271282], [-0.887708691217493, 51.559107139161064], [-0.888191015763102, 51.55861266662589], [-0.888192457957821, 51.55861268028735], [-0.888287760756616, 51.55849039596854], [-0.888562664893145, 51.558278995716826], [-0.888677108662246, 51.55814070717499], [-0.888887527216288, 51.55791161122132], [-0.889030158653071, 51.55774121885465], [-0.889203011709727, 51.557514464273005], [-0.88945350380216, 51.55717964382524], [-0.889600043815338, 51.556967026485395], [-0.889736358446423, 51.55670036168757], [-0.889858423154084, 51.55648571413559], [-0.889957478394766, 51.55626815130874], [-0.88999480235023, 51.556157006507235], [-0.890171676314085, 51.5555274577222], [-0.89040150985715, 51.554855248874496], [-0.891496918227321, 51.55316795557777], [-0.892148150167392, 51.55212836271704], [-0.892302414411729, 51.5517746441604], [-0.892679622502675, 51.55097074336506], [-0.892968782461996, 51.55046633574481], [-0.893655961353766, 51.54930928124159], [-0.894173495307085, 51.548604708475054], [-0.894625223197592, 51.54805597035748], [-0.895275002004698, 51.547308578527485], [-0.895581553072133, 51.54691762432374], [-0.89567259455686, 51.54679079793778], [-0.895853734572665, 51.54651645501248], [-0.896746527292651, 51.54508077321264], [-0.896901839906062, 51.544860136456265], [-0.897255891587921, 51.54494888564188], [-0.898115394177492, 51.545187148067974], [-0.89822539056202, 51.54523044209882], [-0.898280925208036, 51.54525973711452], [-0.898317695099433, 51.54528975512979], [-0.898473190139101, 51.54530020648797], [-0.899619101095523, 51.54544313546729], [-0.901006352145532, 51.54562517973134], [-0.901825064903737, 51.54570208025918], [-0.903152296119515, 51.54586195719927], [-0.903215411109321, 51.54587603470979], [-0.903297183099556, 51.545893883241035], [-0.903017403675823, 51.54655396139701], [-0.902616538461231, 51.54745118838641], [-0.902395351374664, 51.54801290343283], [-0.902224993241029, 51.54837997226972], [-0.902166365216381, 51.54859882282856], [-0.902146545476892, 51.54876318664974], [-0.902208891983797, 51.54892921824649], [-0.902230894835185, 51.549033728477525], [-0.902380735585514, 51.54999904656443], [-0.902673692529055, 51.551610411429984], [-0.902806620567669, 51.55250003963136], [-0.902816651036337, 51.55268266601908], [-0.902804979597758, 51.55292803179951], [-0.902756997764027, 51.55318384821566], [-0.902654701329301, 51.55353896524768], [-0.902427419928527, 51.55423280167036], [-0.901847751389036, 51.555843197130926], [-0.901770133963284, 51.556011515784924], [-0.90172081219273, 51.556082988265544], [-0.902203201151337, 51.55617741874876], [-0.906010818638152, 51.55679743475821], [-0.906204734572883, 51.556771367660915], [-0.906311884484255, 51.55675438267928], [-0.906358975073264, 51.55689599188705], [-0.90638590166065, 51.55691602462513], [-0.906615524939952, 51.55696492104195], [-0.907278267614382, 51.55705831304524], [-0.907858939004531, 51.55720578727805], [-0.908174621569804, 51.5572752632291], [-0.908339760107985, 51.55730647205926], [-0.908420198492941, 51.557320707807335], [-0.908923514869315, 51.557385632424236], [-0.909322889103033, 51.5574540848968], [-0.909506497855653, 51.557497152980005], [-0.909658336207082, 51.557541723987356], [-0.909754316957776, 51.55756959081508], [-0.909871264277585, 51.557625526703404], [-0.91002439519459, 51.55767640345812], [-0.91014009429463, 51.557724234915874], [-0.910363938659539, 51.55783421414451], [-0.910769828656022, 51.55805288423369], [-0.910899633150579, 51.55817457810929], [-0.911134211672749, 51.55843931338367], [-0.911191431662737, 51.558519870694006], [-0.911262279817118, 51.55863382382822], [-0.911345597527786, 51.558829717406], [-0.911347039740573, 51.55882973078292], [-0.911354152248679, 51.55895478193117], [-0.911501156990394, 51.55932300828838], [-0.911744284152759, 51.55977395051585], [-0.911784714781588, 51.55983277167005], [-0.911848028397377, 51.559899897522016], [-0.911951124589094, 51.55999256899618], [-0.912043240814804, 51.56006176008463], [-0.912343203354435, 51.560247072388215], [-0.91252735254784, 51.560389049785144], [-0.912663001694362, 51.56050809825428], [-0.913644040185922, 51.561715780647766], [-0.914729932802775, 51.56149024267299], [-0.915936249212879, 51.561720788632314], [-0.917099342153636, 51.56255696600573], [-0.917716153850379, 51.56209778262442], [-0.918510926061236, 51.561494569835055], [-0.919190082061234, 51.56187308324347], [-0.919265061021478, 51.56187467281339], [-0.919319677161742, 51.561883268238525], [-0.919395565855925, 51.56190734542486], [-0.919450182060758, 51.561915940789575], [-0.919451624375034, 51.56191595406745], [-0.919612764956992, 51.561873377936905], [-0.919684473323871, 51.562134798108005], [-0.919731696029427, 51.56227280618616], [-0.919795125391412, 51.562396576626476], [-0.919877773921036, 51.56250074208832], [-0.920024454979703, 51.56264236275641], [-0.920273793481437, 51.562835281288635], [-0.920455811890565, 51.56300779833283], [-0.92054707457537, 51.56311384087594], [-0.920622684574115, 51.56321074767881], [-0.920768557091237, 51.56344767224896], [-0.920815933327546, 51.56357938704838], [-0.92087756775181, 51.56365728255545], [-0.920897207761338, 51.56368084160506], [-0.920950783915168, 51.5637334861553], [-0.921113636188415, 51.563862665653886], [-0.921195103215065, 51.56395602921301], [-0.921351882125165, 51.56422002842434], [-0.921395592904906, 51.56432383493418], [-0.921420893006769, 51.56441308549212], [-0.921438619701684, 51.56451755238376], [-0.921413985191466, 51.56464410933019], [-0.92167481147157, 51.56453500840272], [-0.923479752756133, 51.56373602685831], [-0.924155377789785, 51.5634113259626], [-0.924873111301507, 51.56399247344971], [-0.924951149378637, 51.56404803772923], [-0.925274524870032, 51.56428388466152], [-0.92664770764064, 51.56515336065692], [-0.927393574791524, 51.56558368874587], [-0.927927453464337, 51.5659491340051], [-0.92835633038721, 51.56599441223158], [-0.928244524844939, 51.56725223174753], [-0.928125342518282, 51.56741209518939], [-0.9281054698832, 51.56745956981058], [-0.927839528670842, 51.568092855254655], [-0.93052584537502, 51.568532778436946], [-0.930434864440691, 51.56872077542371], [-0.930290537945866, 51.568968530677175], [-0.93032458943141, 51.568993118606556], [-0.930407160146686, 51.56904062792432], [-0.930494248489543, 51.56908008580425], [-0.93056005729139, 51.5691040638391], [-0.930644619283805, 51.56912821268005], [-0.930755210497826, 51.569149901051155], [-0.931002865082897, 51.56917193845677], [-0.931506345671459, 51.5692367670135], [-0.9319179887186, 51.56928007686346], [-0.93222706378822, 51.569328746497334], [-0.932389335623021, 51.56936169347699], [-0.932508352034028, 51.56939334769875], [-0.932608510110525, 51.56942932617174], [-0.932871163025979, 51.56955040480943], [-0.933086053531851, 51.569616199317096], [-0.933414865356232, 51.569684826955594], [-0.93386895042082, 51.56976448240679], [-0.934635570791928, 51.5700537823344], [-0.934785550106084, 51.57011898456062], [-0.934985327167408, 51.57021431104797], [-0.935122135234023, 51.5702874858722], [-0.935333952219633, 51.570423383659445], [-0.935683954424458, 51.570697207984594], [-0.935948857561102, 51.57084617434456], [-0.936321009353978, 51.57109861741231], [-0.936776166293208, 51.57138058458356], [-0.936874033955222, 51.57139136186155], [-0.937185388877335, 51.57140497135624], [-0.937358713203379, 51.57139754881963], [-0.937474500211682, 51.571382411871916], [-0.937604964789291, 51.57135661760672], [-0.938082770631526, 51.571224267138255], [-0.938303744516349, 51.57115343316592], [-0.938622419406116, 51.57103852370375], [-0.938583754985448, 51.57127375671787], [-0.938615426417796, 51.5714008261012], [-0.938651384040882, 51.57152973256723], [-0.938810396393867, 51.572013125409214], [-0.938917102284257, 51.5723881447753], [-0.938977920287056, 51.572564931845086], [-0.939147081147104, 51.57298457478389], [-0.93921529881351, 51.57340150695511], [-0.939295227462625, 51.57374930879435], [-0.939359853061118, 51.57401065198471]]]}}
+ benchmarks/json-data/integers.json view
@@ -0,0 +1,1 @@+[1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 6, 7, 7, 7, 8, 9, 9, 10, 10, 11, 12, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 26, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 50, 53, 56, 60, 63, 67, 72, 76, 81, 86, 91, 96, 102, 109, 115, 122, 130, 138, 146, 155, 165, 175, 186, 197, 209, 222, 236, 250, 266, 282, 299, 318, 337, 358, 380, 403, 428, 454, 482, 511, 543, 576, 611, 649, 688, 730, 775, 823, 873, 926, 983, 1043, 1107, 1175, 1247, 1323, 1404, 1490, 1582, 1679, 1781, 1890, 2006, 2129, 2259, 2398, 2544, 2700, 2865, 3041, 3227, 3425, 3634, 3857, 4093, 4343, 4609, 4891, 5191, 5509, 5846, 6204, 6583, 6986, 7414, 7868, 8349, 8860, 9403, 9978, 10589, 11237, 11925, 12655, 13430, 14252, 15124, 16050, 17032, 18075, 19181, 20355, 21601, 22923, 24326, 25815, 27396, 29072, 30852, 32740, 34744, 36871, 39128, 41523, 44064, 46762, 49624, 52661, 55884, 59305, 62935, 66787, 70875, 75213, 79817, 84702, 89887, 95389, 101227, 107423, 113998, 120976, 128381, 136239, 144578, 153427, 162818, 172784, 183360, 194583, 206493, 219132, 232545, 246778, 261883, 277912, 294923, 312975, 332131, 352460, 374034, 396928, 421223, 447005, 474365, 503400, 534212, 566911, 601610, 638433, 677511, 718980, 762987, 809688, 859247, 911840, 967652, 1026880, 1089734, 1156434, 1227217, 1302333, 1382046, 1466638, 1556408, 1651673, 1752769, 1860052, 1973902, 2094721, 2222934, 2358996, 2503385, 2656613, 2819219, 2991777, 3174898, 3369227, 3575451, 3794297, 4026539, 4272995, 4534536, 4812086, 5106625, 5419191, 5750889, 6102889, 6476435, 6872845, 7293518, 7739939, 8213686, 8716429, 9249944, 9816115, 10416939, 11054539, 11731166, 12449207, 13211198, 14019829, 14877955, 15788605, 16754994, 17780533, 18868844, 20023768, 21249383, 22550016, 23930257, 25394980, 26949356, 28598872, 30349352, 32206975, 34178300, 36270285, 38490317, 40846232, 43346349, 45999492, 48815029, 51802899, 54973651, 58338478, 61909260, 65698602, 69719882, 73987297, 78515911, 83321713, 88421668, 93833782, 99577160, 105672079, 112140056, 119003924, 126287916, 134017747, 142220706, 150925751, 160163614, 169966908, 180370243, 191410345, 203126189, 215559137, 228753081, 242754599, 257613123, 273381107, 290114218, 307871529, 326715729, 346713346, 367934976, 390455540, 414354543, 439716356, 466630515, 495192035, 525501749, 557666661, 591800322, 628023236, 666463282, 707256166, 750545902, 796485316, 845236589, 896971830, 951873682, 1010135966, 1071964368, 1137577163, 1207205986, 1281096650, 1359510014, 1442722903, 1531029087, 1624740315, 1724187420, 1829721484, 1941715077, 2060563573, 2186686548, 2320529259, 2462564214, 2613292844, 2773247272, 2942992191, 3123126858, 3314287206, 3517148098, 3732425698, 3960880011, 4203317554, 4460594215, 4733618266, 5023353573, 5330822998, 5657112012, 6003372524, 6370826950, 6760772526, 7174585891, 7613727944, 8079749004, 8574294281, 9099109685, 9656047991, 10247075377, 10874278366, 11539871197, 12246203633, 12995769265, 13791214310, 14635346955, 15531147272, 16481777734, 17490594386, 18561158687, 19697250088, 20902879371, 22182302812, 23540037202, 24980875800, 26509905246, 28132523526, 29854459026, 31681790754, 33620969802, 35678842122, 37862672691, 40180171161, 42639519077, 45249398761, 48019023960, 50958172379, 54077220194, 57387178688, 60899733121, 64627283986, 68582990784, 72780818484, 77235586822, 81963022620, 86979815309, 92303675844, 97953399235, 103948930895, 110311437058, 117063379497, 124228594829, 131832378662, 139901574895, 148464670491, 157551896043, 167195332496, 177429024407, 188289100133, 199813899374, 212044108527, 225022904322, 238796106249, 253412338321, 268923200725, 285383451995, 302851202324, 321388118716, 341059642687, 361935221296, 384088552321, 407597844432, 432546093294, 459021374572, 487117154867, 516932621682, 548573033590, 582150091830, 617782334651, 655595555791, 695723248569, 738307077168, 783497376747, 831453684183, 882345301285, 936351892486, 993664119121, 1054484312524, 1119027188325, 1187520604468, 1260206365627, 1337341076854, 1419197049486, 1506063262491, 1598246382662, 1696071847252, 1799885012878, 1910052374747, 2026962860500, 2151029203266, 2282689398739, 2422408251457, 2570679015712, 2728025136906, 2895002099486, 3072199387991, 3260242568131, 3459795495242, 3671562657914, 3896291665080, 4134775885316, 4387857247705, 4656429214122, 4941439933460, 5243895588908, 5564863950114, 5905478142772, 6266940648935, 6650527552175, 7057593042589, 7489574197539, 7947996055022, 8434476997558, 8950734465625, 9498591020797, 10079980779998, 10696956243580, 11351695541337, 12046510122031, 12783852913581, 13566326982715, 14396694724673, 15277887615381, 16213016560543, 17205382878181, 18258489953389, 19376055606456, 20562025218016, 21820585657560, 23156180064488, 24573523533875, 26077619762337, 27673778712750, 29367635360200, 31165169585327, 33072727285306, 35097042776985, 37245262571278, 39524970602741, 41944215003394, 44511536515321, 47235998642351, 50127219647252, 53195406507421, 56451390948928, 59906667686130, 63573435001862, 67464637811456, 71594013362620, 75976139732519, 80626487293267, 85561473327514, 90798519986944, 96356115798305, 102253880934088, 108512636478302, 115154477931865, 122202853217119, 129682645456833, 137620260819954, 146043721744222, 154982765864743, 164468950997792, 174535766550465, 185218751749486, 196555621106568, 208586397563259, 221353553785311, 234902162105402, 249280053643550, 264537987166964, 280729828285480, 297912739615178, 316147382581544, 335498131574595, 356033301212013, 377825387512598, 400951323831468, 425492752460545, 451536312853150, 479173947490266, 508503226468250, 539627691953919, 572657223723034, 607708427072674, 644905044476938, 684378392439283, 726267825083707, 770721226121430, 817895530929871, 867957280587026, 921083209817197, 977460870923688, 1037289295911185, 1100779699135317, 1168156222959992, 1239656729054927, 1315533638126921, 1396054821049394, 1481504544536185, 1572184474698156, 1668414742025481, 1770535071555377, 1878905982215138, 1993910059574563, 2115953306501003, 2245466576485316, 2382907094698829, 2528760072151156, 2683540418647385, 2847794560591953]
+ benchmarks/json-data/jp10.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":15,"page":1,"completed_in":0.104827,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}
+ benchmarks/json-data/jp100.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:40:04 +0000","from_user":"ChuriSta_gt","id_str":"41190705623732224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3072\u3089\u304c\u306a\u306e\u300c\u3064\u300d\u306f\u3082\u3046Twitter\u306e\u300c\u3064\u300d\u3060\uff01","id":41190705623732224,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"71746558","profile_image_url":"http://a2.twimg.com/profile_images/591641547/wwd_normal.gif","created_at":"Fri, 25 Feb 2011 17:40:02 +0000","from_user":"fuckkilldiestar","id_str":"41190699571494912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u306b\u3057\u3066\u3082Twitter\u3084pixiv\u96e2\u308c\u3092\u3069\u3046\u306b\u304b\u3057\u308d\u674f\u4ec1\u30d6\u30eb\u30de","id":41190699571494912,"from_user_id":71746558,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"131230176","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"proory_bot","id_str":"41190683922546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30ea\u30cd\u30f3\u30dd\u30fc\u30c1 http://bit.ly/btjqlH","id":41190683922546688,"from_user_id":131230176,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://proory.com/" rel="nofollow">proory tems</a>"},{"from_user_id_str":"120359038","profile_image_url":"http://a1.twimg.com/profile_images/946521484/200805161826000_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"tukinosuke","id_str":"41190680835391488","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190680835391488,"from_user_id":120359038,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"166512109","profile_image_url":"http://a3.twimg.com/profile_images/1224583217/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:50 +0000","from_user":"yurii1129","id_str":"41190649839620096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u6c17\u4ed8\u3044\u305f\u2026\u307f\u3043\u304f\u3093\u306eTwitter\u540d\u3001\u3084\u307e\u306d\u3084\u3093(\uffe3\u25c7\uffe3;)","id":41190649839620096,"from_user_id":166512109,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"228999619","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:39:49 +0000","from_user":"takami926","id_str":"41190644793745408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7530\u539f\u3055\u3093\u3001\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002WEB\u3082TWITTER\u3082\u62dd\u898b\u3057\u3066\u307e\u3059\u3002\u7530\u539f\u3055\u3093\u304c\u653f\u6cbb\u5bb6\u306b\u306a\u3063\u3066\u3001\u65e5\u672c\u3092\u5909\u3048\u3066\u304f\u3060\u3055\u3044\u3002\u5c16\u95a3\u3001\u5317\u65b9\u554f\u984c\u5171\u306b\u65e5\u672c\u306e\u653f\u6cbb\u306e\u5931\u6557\u3067\u3059\u3002\u8a55\u8ad6\u5bb6\u306f\u8272\u3005\u8a00\u3063\u3066\u307e\u3059\u304c\u3001\u4e2d\u6771\u307b\u3069\u56fd\u6c11\u306e\u71b1\u6c17\u304c\u7121\u304f\u3001\u683c\u5dee\u304c\u3042\u308a\u3001\u4f55\u3082\u5909\u308f\u3089\u306a\u3044\u666f\u6c17\u4f4e\u8ff7\u306e\u65e5\u672c\u306b\u56fd\u6c11\u306f\u8ae6\u3081\u3066\u308b\u3093\u3067\u3059\u3002","id":41190644793745408,"from_user_id":228999619,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"151773701","profile_image_url":"http://a0.twimg.com/profile_images/1213699753/obi_nao_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:44 +0000","from_user":"obi_nao","id_str":"41190622949941248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3060\u3044\u3076\u5e74\u4e0b\u306e\u5f8c\u8f29\u306b\u3001\u30d3\u30b8\u30cd\u30b9\u3084\u308b\u306a\u3089\u771f\u5263\u306bTwitter\u3084\u308c\uff01\u3063\u3066\u6012\u3089\u308c\u305f\u3002\u306a\u306e\u3067\u4eca\u65e5\u304b\u3089\u771f\u5263\u306b\u3064\u3076\u3084\u304f\u3053\u3068\u306b\u3057\u307e\u3059\u3002\u3088\u308d\u3057\u304f\u3067\u3059\u3002","id":41190622949941248,"from_user_id":151773701,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"20817229","profile_image_url":"http://a0.twimg.com/profile_images/1212012721/205_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"allte","id_str":"41190619804082176","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7206\u7b11\u3057\u3066\u547c\u5438\u56f0\u96e3\u3067\u75d9\u6523\u3059\u308b\u5618\u304f\u3093\u304c\u898b\u308c\u308b\u306e\u306fTwitter\u3060\u3051","id":41190619804082176,"from_user_id":20817229,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"166907967","profile_image_url":"http://a2.twimg.com/profile_images/1250526230/___normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"NTTYAHOOOOOOOI","id_str":"41190618235412480","metadata":{"result_type":"recent"},"to_user_id":106469594,"text":"@takahirororo \u3066\u304b\u4f55\u3067twitter\u4e0a\u3067\u30a2\u30c9\u30d0\u30a4\u30b9\u3082\u3089\u3063\u3066\u3093\u306d\u3093\uff57","id":41190618235412480,"from_user_id":166907967,"to_user":"takahirororo","geo":null,"iso_language_code":"ja","to_user_id_str":"106469594","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"82581287","profile_image_url":"http://a0.twimg.com/profile_images/774721566/miyaru2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:38 +0000","from_user":"kine_rahchaos","id_str":"41190598132244480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093\u304cTwitter\u59cb\u3081\u305f\u3060\u3068\u2026","id":41190598132244480,"from_user_id":82581287,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"136633905","profile_image_url":"http://a2.twimg.com/profile_images/1247161991/yama_normal.png","created_at":"Fri, 25 Feb 2011 17:39:35 +0000","from_user":"yamachi39","id_str":"41190584706285568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3084\u3063\u3071\u308amixi\u3088\u308atwitter\u306e\u304c\u597d\u304d\u304b\u3082","id":41190584706285568,"from_user_id":136633905,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://jigtwi.jp/?p=1" rel="nofollow">jigtwi</a>"},{"from_user_id_str":"44029295","profile_image_url":"http://a2.twimg.com/profile_images/1112965522/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:32 +0000","from_user":"no2yosee","id_str":"41190572769280000","metadata":{"result_type":"recent"},"to_user_id":97721124,"text":"@hn0345 \u3042\u3001\u500b\u4eba\u7684\u306b\u306f\u4eca\u306ftwitter\u306e\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u306b\u66f8\u3044\u3066\u3042\u308b\u30d6\u30ed\u30b0\u306e\u30e6\u30cb\u30c3\u30c8\u3092\u306e\u3093\u3073\u308a\u3084\u3063\u3066\u307e\u3059w","id":41190572769280000,"from_user_id":44029295,"to_user":"hn0345","geo":null,"iso_language_code":"ja","to_user_id_str":"97721124","source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"149872179","profile_image_url":"http://a0.twimg.com/profile_images/1145770150/Winter11_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:31 +0000","from_user":"xmyyyxx","id_str":"41190566951653376","metadata":{"result_type":"recent"},"to_user_id":95069405,"text":"@rindofu \u653b\u7565\u672c\u3042\u308c\u3070\u3044\u3044\u306e\u306b\u3063\u3066\u601d\u3044\u307e\u3059(T\u03c9T)/~~~ \u79c1\u3082\u76f4\u3057\u305f\u3044\u3068\u3053\u3044\u3063\u3071\u3044\u3060\u3051\u3069\u3001\u3042\u306860\u5e74\u304f\u3089\u3044\u3044\u304d\u3089\u308c\u308b\u306f\u305a\u3060\u3057\u3001\u306e\u3093\u3073\u308a\u76f4\u308c\u3070\u3044\u3044\u306a\u3042 \u304a\u3084\u3059\u307f\u3067\u3059^^\uff01\u308a\u3093\u3055\u3093\u3068twitter\u3067\u4ef2\u826f\u304f\u306a\u308c\u3066\u3088\u304b\u3063\u305f\u3067\u3059\u3063","id":41190566951653376,"from_user_id":149872179,"to_user":"rindofu","geo":null,"iso_language_code":"ja","to_user_id_str":"95069405","source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"105579892","profile_image_url":"http://a0.twimg.com/profile_images/1212950455/love_happy_pink_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"love_happy_pink","id_str":"41190566494601216","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u308c\u898b\u305f\u3044\u306a\u266aRT @kazukt \u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41190566494601216,"from_user_id":105579892,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com/" rel="nofollow">TwitBird iPad</a>"},{"from_user_id_str":"16996368","profile_image_url":"http://a0.twimg.com/profile_images/1198892387/pochi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"HyoYoshikawa","id_str":"41190564187611136","metadata":{"result_type":"recent"},"to_user_id":1800565,"text":"@shinichiro_beck \u73fe\u5730\u304b\u3089\u306a\u3089\u826f\u304f\u3066\u4ed6\u306e\u5730\u57df\u304b\u3089\u3060\u4f59\u8a08\u306a\u3089\u3001\u4f55\u306e\u305f\u3081\u306bTwitter\u304c\u3042\u308b\u306e\u304b\u308f\u304b\u3089\u306a\u3044\u3088\u3002\u3044\u307e\u8d77\u304d\u3066\u308b\u3053\u3068\u306e\u8aac\u660e\u3082\u3064\u304b\u306a\u3044\u3002\u30a2\u30eb\u30b8\u30e3\u30b8\u30fc\u30e9\u304c\u4f1d\u3048\u3066\u308b\u3053\u3068\u304c\u5168\u3066\u3058\u3083\u306a\u3044\u3057\u3001\u65e5\u672c\u306eTV\u306f\u4f1d\u3048\u306a\u3044\u3067\u3057\u3087\u3046\u3002\u77e5\u308a\u305f\u304c\u3063\u3066\u308b\u4eba\u3082\u305f\u304f\u3055\u3093\u3044\u308b\u3002","id":41190564187611136,"from_user_id":16996368,"to_user":"shinichiro_beck","geo":null,"iso_language_code":"ja","to_user_id_str":"1800565","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"119070802","profile_image_url":"http://a2.twimg.com/profile_images/1229773005/346d8435099798113a1326e1ba4949ee_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:39:25 +0000","from_user":"takotako726","id_str":"41190545439207424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5\u5c11\u5973\u307e\u3069\u304b\u30de\u30ae\u30ab\u306e\u53cd\u97ff\u304ctwitter\u3067\u306f\u3093\u3071\u306d\u3048\u4ef6\u3002","id":41190545439207424,"from_user_id":119070802,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"165695316","profile_image_url":"http://a1.twimg.com/profile_images/681748782/ring_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:21 +0000","from_user":"pandora_shotbar","id_str":"41190526447390720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u2026\uff5chttp://pandora-twitter.seesaa.net/article/187809936.html","id":41190526447390720,"from_user_id":165695316,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"88862311","profile_image_url":"http://a2.twimg.com/profile_images/1182243698/161113_100001897885617_169366_q_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:16 +0000","from_user":"amebaguide","id_str":"41190504926416896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30a2\u30e1\u30d6\u30ed\u653b\u7565\u30ac\u30a4\u30c9\u306e\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30d6\u30ed\u30b0\u306e\u653b\u7565\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u96c6\uff5chttp://accessup-twitter.seesaa.net/article/187809931.html","id":41190504926416896,"from_user_id":88862311,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"186895007","profile_image_url":"http://a2.twimg.com/profile_images/1229610799/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:11 +0000","from_user":"zizikt","id_str":"41190486123356161","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u308c\u306f\u500b\u4eba\u7684\u306b\u306f\u91cd\u5b9d\u3067\u3059\u3002\n\u25c6iPhone&iPad\u5411\u3051Twitter\u30a2\u30d7\u30ea\u300c\u3064\u3044\u3063\u3077\u308b\u300d\u306bEvernote\u3068\u306e\u9023\u643a\u6a5f\u80fd\u3092\u8ffd\u52a0 \nhttp://bit.ly/hPf44u","id":41190486123356161,"from_user_id":186895007,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"132320738","profile_image_url":"http://a3.twimg.com/profile_images/1229760475/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:04 +0000","from_user":"faina_","id_str":"41190453592334336","metadata":{"result_type":"recent"},"to_user_id":167894537,"text":"@gjmorley \u30e2\u30fc\u30ea\u30fc\u3055\u3093\u306e\u7ffb\u8a33\u306e\u8a00\u8449\u306e\u30bb\u30f3\u30b9\u304c\u3059\u304d\u3067\u3059\u3002\u305d\u3057\u3066\u3001Twitter\u3067\u77e5\u308b\u3001\u73fe\u5730\u306e\u4eba\u306e\u76ee\u306e\u529b\u3084\u3001\u60c5\u5831\u3092\u4f1d\u3048\u3066\u304f\u308c\u308b\u7686\u3055\u3093\u306e\u60c5\u71b1\u306b\u611f\u52d5\u3057\u3066\u3044\u307e\u3059\u3002\u611f\u52d5\u3059\u308b\u3063\u3066\u3059\u3054\u3044\u30a8\u30cd\u30eb\u30ae\u30fc\u3067\u3059\uff01\uff01","id":41190453592334336,"from_user_id":132320738,"to_user":"gjmorley","geo":null,"iso_language_code":"ja","to_user_id_str":"167894537","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"24870552","profile_image_url":"http://a3.twimg.com/profile_images/907130634/4_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:03 +0000","from_user":"tana1192","id_str":"41190450480021504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u500b\u4eba\u7684\u306b\u306f\u3001\u30bf\u30b0\u5f3e\u304d\u3059\u308c\u3070\u3044\u3044\uff08\u5f3e\u3051\u308b\u30c4\u30fc\u30eb\u3092\u4f7f\u3063\u3066Twitter\u3092\u3059\u308c\u3070\u3044\u3044\uff09\u3068\u601d\u3046\u3093\u3060\u3051\u3069\u306a\u3042\u3002\u307f\u3093\u306a\u305d\u308c\u306a\u308a\u306bTwitter\u3084\u308b\u4eba\u3060\u3057\u3001\u30c4\u30fc\u30eb\u9078\u3073\u304f\u3089\u3044\u5e45\u3092\u6301\u3063\u3066\u3084\u3063\u3066\u3082\u3002 \u307e\u3042\u3001\u4ffa\u30a2\u30cb\u30e1\u306f\u89b3\u308b\u89b3\u308b\u8a50\u6b3a\u3059\u308b\u3060\u3051\u306e\u4eba\u3060\u304b\u3089\u95a2\u4fc2\u306a\u3044\u3093\u3060\u3051\u3069\u3082\uff57\uff57\u5b9f\u6cc1\u306f\u697d\u3057\u305d\u3046\u306b\u898b\u3048\u308b\u3088\u3002","id":41190450480021504,"from_user_id":24870552,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"58509646","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Fri, 25 Feb 2011 17:39:02 +0000","from_user":"kakuyas","id_str":"41190446663344128","metadata":{"result_type":"recent"},"to_user_id":107076877,"text":"@Dayspool \u6df1\u591c\uff12\uff19\u6642\u304f\u3089\u3044\u307e\u3067\u306f\u6bce\u65e5\u55b6\u696d\u3057\u3066\u308b\u306e\u3067\u3001twitter\u3001\u30e1\u30c3\u30bb\u3001PS3\u306a\u3069\u3067\u3088\u3093\u3067\u3051\u308c\u3002\u3053\u3063\u3061\u304b\u3089\u58f0\u304b\u3051\u308b\u3053\u3068\u3082\u3042\u308b\u304b\u3082\u3060\u304c\uff57","id":41190446663344128,"from_user_id":58509646,"to_user":"Dayspool","geo":null,"iso_language_code":"ja","to_user_id_str":"107076877","source":"<a href="http://cheebow.info/chemt/archives/2007/04/twitterwindowst.html" rel="nofollow">Twit for Windows</a>"},{"from_user_id_str":"149128527","profile_image_url":"http://a2.twimg.com/profile_images/1254922702/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:00 +0000","from_user":"uni13yoki","id_str":"41190437087748096","metadata":{"result_type":"recent"},"to_user_id":119468594,"text":"@kuro_wr84 \u304a\u308c\u3068\u304a\u524d\u3067Twitter\u3067\u4f1a\u8a71\u3057\u305f\u3089\u3001\u5927\u5909\u306a\u3053\u3068\u306b\u306a\u308b\u306a","id":41190437087748096,"from_user_id":149128527,"to_user":"kuro_wr84","geo":null,"iso_language_code":"ja","to_user_id_str":"119468594","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"18670595","profile_image_url":"http://a2.twimg.com/profile_images/1250674062/ProfilePhoto_normal.png","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"nyuuuuun","id_str":"41190436450222080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3078\u30fc\u3053\u3093\u306a\u306b\u3088\u304f\u4f3c\u308b\u3053\u3068\u3082\u3042\u308b\u3093\u3060\u30fc\nhttp://twitter.com/Re_44/status/35943233016168448\nhttp://twitter.com/3510_misaka/status/36122114821988352","id":41190436450222080,"from_user_id":18670595,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"96267603","profile_image_url":"http://a3.twimg.com/profile_images/1245253473/DSiLL3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"arivis","id_str":"41190433119940608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://twitter.com/#!/arivis/status/40636755380142080 \u306a\u3093\u3064\u3046\u304b\u3053\u308c\u3067\u8d64\u3063\u3066\u306e\u3082\u3061\u3087\u3063\u3068\u3042\u308c\u3063\u3059\u306d\u3002\u305d\u3057\u3066\u4e88\u671f\u3057\u3066\u3044\u305f\u304b\u306e\u3088\u3046\u3060","id":41190433119940608,"from_user_id":96267603,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"148097776","profile_image_url":"http://a3.twimg.com/profile_images/1166904064/broken-heart_normal.png","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"ReajuBreaker_A","id_str":"41190422135058432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u672c\u57a2\u30d5\u30a9\u30ed\u30fc\u3088\u308d\u3057\u304f\u3067\u3059\u2192 http://twitter.com/ReajuBreaker \uff08\uff20\u3060\u3068\u30ea\u30d7\u30e9\u30a4\u304c\u57cb\u307e\u308b\u305f\u3081\u3001URL\u306b\u3057\u3066\u3042\u308a\u307e\u3059\uff09","id":41190422135058432,"from_user_id":148097776,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.twitter.com/ReajuBreaker" rel="nofollow">\u73fe\u5145\u6bba\u3057\u306e\u7121\u4eba\u9023\u545f\uff1c\u30aa\u30fc\u30c8\u30c4\u30a4\u30fc\u30c8\uff1e</a>"},{"from_user_id_str":"59711654","profile_image_url":"http://a2.twimg.com/profile_images/416212928/flowers-06-1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"agamo45","id_str":"41190421522546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41190421522546688,"from_user_id":59711654,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"145311373","profile_image_url":"http://a3.twimg.com/profile_images/1187802576/a_gam_02_normal.png","created_at":"Fri, 25 Feb 2011 17:38:55 +0000","from_user":"nogic1008","id_str":"41190418141937664","metadata":{"result_type":"recent"},"to_user_id":88117317,"text":"@runasoru \u307e\u3042\u5acc\u306a\u3089\u6df1\u591c\u5e2f\u306bTwitter\u898b\u306a\u304d\u3083\u3044\u3044\u3060\u3051\u3067\u3059\u304b\u3089\u306d\u30fc \u30103/19BDM\u30aa\u30d5http://twvt.us/bdoff_kansai\u3011","id":41190418141937664,"from_user_id":145311373,"to_user":"runasoru","geo":null,"iso_language_code":"ja","to_user_id_str":"88117317","source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"195851300","profile_image_url":"http://a2.twimg.com/profile_images/1124572815/be7b4c0a06cb60e8_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:49 +0000","from_user":"LoveLAscrewDoll","id_str":"41190391147540480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @jp_mjp: SCREW TV SHOW Vol.6\u306e\u653e\u9001\u304c\u7121\u4e8b\u306b\u7d42\u4e86\u3044\u305f\u3057\u307e\u3057\u305f\u3002\u3054\u89a7\u9802\u304d\u3042\u308a\u304c\u3068\u3046\u3054\u3056\u3044\u307e\u3057\u305f\uff01\u6b21\u56de\u653e\u9001\u306f3\u670818\u65e5(\u91d1)\u3067\u3059\u3002\u8996\u8074\u8005\u30d7\u30ec\u30bc\u30f3\u30c8\u306e\u8a73\u7d30\u306f\u5f8c\u65e5MJP\u3067\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u3002\u305d\u306e\u969b\u306b\u306f\u3001\u3053\u306eTwitter\u3067\u3082\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u306e\u3067\u3001\u304a\u697d\u3057\u307f\u306b\uff01#SCREWTV","id":41190391147540480,"from_user_id":195851300,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"ChuriSta_gt","id_str":"41190389549510656","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u3053\u4e00\u9031\u9593Twitter\u304c\u3084\u305f\u3089\u697d\u3057\u3044\u306e\u3067\u3059\u3051\u3069\u30fc\u30fc\u30fc\uff01\u306b\u3072\u3072\u3063\u7b11","id":41190389549510656,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"50592111","profile_image_url":"http://a0.twimg.com/profile_images/1252176582/lFjpi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"crowNeko","id_str":"41190387271864320","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a8\u30ed\u30b2\u30d7\u30ec\u30a4\u3057\u306a\u304c\u3089\u307e\u3069\u30de\u30aeTL\u3092\u898b\u306a\u3044\u3088\u3046\u306b\u534a\u76ee\u306b\u306a\u308a\u306a\u304c\u3089Twitter\u3057\u3066\u308b\u6df1\u591c2\u6642\u534a\u3002","id":41190387271864320,"from_user_id":50592111,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://stone.com/Twittelator" rel="nofollow">Twittelator</a>"},{"from_user_id_str":"7141467","profile_image_url":"http://a3.twimg.com/profile_images/1198540741/icon12912579345276_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:40 +0000","from_user":"hina_geshi","id_str":"41190355961380864","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7d50\u5c40\u30cd\u30bf\u30d0\u30ec\u3059\u3093\u306a\u3063\u3066\u8a00\u3046\u65b9\u304c\u30a2\u30ec\u3060\u3088\u306d\u3001\u3057\u306a\u3044\u308f\u3051\u7121\u3044\u3058\u3083\u306a\u3044\u8133\u5185\u5782\u308c\u6d41\u3057\u304cTwitter\u306a\u3093\u3060\u304b\u3089\u3055","id":41190355961380864,"from_user_id":7141467,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"149608984","profile_image_url":"http://a0.twimg.com/profile_images/1205950885/090702_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"Mr_Tsubaki","id_str":"41190349447774208","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3069\u304b\u306fTwitter\u5408\u308f\u305b\u3066\uff11\u6642\u9593\u306f\u697d\u3057\u3044","id":41190349447774208,"from_user_id":149608984,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"122271550","profile_image_url":"http://a0.twimg.com/profile_images/961936499/neoneko_bot5jpg_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"neoneko_bot5","id_str":"41190348726345728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30c6\u30b9\u30c8\uff1a23\u3011\u4eca\u65e5\u304b\u3089\u5ba3\u4f1d\u958b\u59cb\u2606\u306d\u304a\u306d\u3053\u306eTwitter \u3067 EasyBottex\u3000\u3067\u304d\u308b\u307e\u3067\uff01\u2192http://neoneko.blog31.fc2.com/","id":41190348726345728,"from_user_id":122271550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www20.atpages.jp/neoneko/" rel="nofollow">neoneko_bot5</a>"},{"from_user_id_str":"127069188","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:38:37 +0000","from_user":"MYCHEBOT","id_str":"41190340908163074","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30eb\u30d5\u3055\u3093\u304c\u914d\u4fe1\u3092\u7d42\u4e86\u3057\u307e\u3057\u305f\uff01/ http://777labo.com/mychecker/view/745.php / \u30c8\u30d4\u30c3\u30af:XSplit\u30c6\u30b9\u30c8\u3000twitter\u2192http://twitter.com/rukh01","id":41190340908163074,"from_user_id":127069188,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://777labo.com/mychecker/" rel="nofollow">MYCHEBOT</a>"},{"from_user_id_str":"107626142","profile_image_url":"http://a1.twimg.com/profile_images/1104968421/SuperMaika1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:34 +0000","from_user":"MaikaPaPa","id_str":"41190328614666240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"75\u5e74\u524d\u306e\u4eca\u65e52\u670826\u65e5\u672a\u660e\u3001\u82e5\u304d\u9752\u5e74\u5c06\u6821\u3089\u304c\u653f\u6cbb\u8150\u6557\u3068\u8fb2\u6751\u306e\u56f0\u7aae\u306b\u5bfe\u3057\u3066\u6c7a\u8d77\u3057\u307e\u3057\u305f\u3002\u3082\u3061\u308d\u3093\u5f53\u6642\u306fTwitter\u3082FB\u3082\u3001\u307e\u305f\u5f53\u7136\u306a\u304c\u3089Internet\u3082\u3042\u308a\u307e\u305b\u3093\u3067\u3057\u305f\u3002\u4e00\u65b9\u3001\u30c1\u30e5\u30cb\u30b8\u30a2\u3001\u30a8\u30b8\u30d7\u30c8\u3001\u4e2d\u6771\u306b\u5e83\u304c\u308b\u53cd\u653f\u5e9c\u30c7\u30e2\u3068\u5f37\u6a29\u4f53\u5236\u306e\u5d29\u58ca\u3002\u73fe\u5728\u306e\u65e5\u672c\u3067\u306f\u8003\u3048\u3089\u308c\u306a\u3044\u3053\u3068\u3067\u3059\u3002","id":41190328614666240,"from_user_id":107626142,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"11111695","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"kumatchipooh","id_str":"41190306145775617","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @inosenaoki: \u306a\u308b\u307b\u3069\u306d\u3002 RT @dansrmz @inosenaoki \u3053\u3061\u3089\u304c\u30bd\u30d5\u30c8\u30d0\u30f3\u30af\u526f\u793e\u9577\u306e\u677e\u672c\u5fb9\u4e09\u3055\u3093\u306e\u3001Twitter\u306b\u95a2\u3059\u308b\u8ad6\u8003\u3067\u3059\u3002 \u25b6 "Twitter\u306e2\u30c1\u30e3\u30f3\u30cd\u30eb\u5316\u306f\u9632\u6b62\u51fa\u6765\u308b\u304b" http://t.co/Mwzb8Zf","id":41190306145775617,"from_user_id":11111695,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"212161909","profile_image_url":"http://a1.twimg.com/profile_images/1252895790/natm01_normal.gif","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"n34hitman","id_str":"41190303830511616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u30fb\u30d6\u30ed\u30b0\u30a2\u30d5\u30a3\u30ea\u30a8\u30a4\u30c8\u81ea\u52d5\u6295.... http://goo.gl/a4RHB 4054","id":41190303830511616,"from_user_id":212161909,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twibow.net/" rel="nofollow">Twibow</a>"},{"from_user_id_str":"105945593","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:38:24 +0000","from_user":"nakano_bot","id_str":"41190285710983168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u306ebot\u306f\u4e0d\u52d5\u7523\u4f1a\u793e\u69d8\u5411\u3051\u306e\u4e0d\u52d5\u7523\u30dd\u30fc\u30bf\u30eb\u30b5\u30a4\u30c8\u3078\u306e\u4e00\u62ec\u8ee2\u9001\uff0bTwitter\u7121\u6599\u8ee2\u9001\u30b5\u30fc\u30d3\u30b9\u306b\u3088\u308a\u3064\u3076\u3084\u304d\u307e\u3059\u3002\u3054\u5229\u7528\u306b\u306a\u308a\u305f\u3044\u5834\u5408\u306f http://bit.ly/demey0 \u306b\u304a\u6c17\u8efd\u306b\u304a\u554f\u3044\u5408\u308f\u305b\u4e0b\u3055\u3044\u3002","id":41190285710983168,"from_user_id":105945593,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.teramax.jp/aboutus.html" rel="nofollow">tmxbot</a>"},{"from_user_id_str":"170904226","profile_image_url":"http://a2.twimg.com/profile_images/1249020397/1789kb_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:21 +0000","from_user":"1789kb","id_str":"41190274428305408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3068\u308a\u3042\u3048\u305a\u4eca\u56de\u521d\u3081\u3066\u30ea\u30a2\u30eb\u30bf\u30a4\u30e0\u3067\u898b\u3066\u308f\u304b\u3063\u305f\u306e\u306f\u3001QB\u306f\u5168\u8eab\u304c\u30a2\u30f3\u30d1\u30f3\u30bf\u30a4\u30d7\u3060\u3068\u3044\u3046\u3053\u3068\u3068\u3001\u307e\u3069\u30de\u30ae\u7d42\u4e86\u5f8c\u306eTwitter\u306e\u3056\u308f\u3064\u304d\u304c\u3059\u3054\u3044\u3068\u3044\u3046\u3053\u3068","id":41190274428305408,"from_user_id":170904226,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"166169644","profile_image_url":"http://a1.twimg.com/profile_images/1217017679/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:18 +0000","from_user":"Okkkkkkkkkkun","id_str":"41190262420017152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3063\u3066Twitter\u3067\u3064\u3076\u3084\u304f\u81ea\u5206\u3082\u76f8\u5f53\u5c0f\u3055\u3044\u306a\u3002","id":41190262420017152,"from_user_id":166169644,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"196623456","profile_image_url":"http://a3.twimg.com/profile_images/1219076661/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:06 +0000","from_user":"NoMoneyClub","id_str":"41190213342601216","metadata":{"result_type":"recent"},"to_user_id":195462431,"text":"@yosal15 \nTwitter\u3084\u3063\u3066\u308b\u3089\u3057\u3044\u3002\u3051\u3069\u3001\u898b\u3064\u304b\u3089\u306a\u3044\u3002","id":41190213342601216,"from_user_id":196623456,"to_user":"yosal15","geo":null,"iso_language_code":"ja","to_user_id_str":"195462431","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"126984048","profile_image_url":"http://a3.twimg.com/profile_images/1254579571/zipyaru-20090829-23-0012_normal.png","created_at":"Fri, 25 Feb 2011 17:38:02 +0000","from_user":"minaduki_naduki","id_str":"41190196418584576","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u203b\u30e1\u30fc\u30eb\u3067\u5973\u306e\u5b50\u53e3\u8aac\u304f\u306e\u306b\u5fd9\u3057\u3044\u3093\u3060\u305d\u3046\u3067\u3059\u3000\u307e\u3058\u3058\u3054\u308d RT @yowano_k: \u5fd9\u3057\u304f\u3066\u3082Twitter\u306b\u9854\u3092\u51fa\u3057\u305f\u304f\u306a\u308b\u50d5\u30a7\u2026\u2026","id":41190196418584576,"from_user_id":126984048,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"200568705","profile_image_url":"http://a3.twimg.com/profile_images/1242179765/101230_1355_01_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:01 +0000","from_user":"hammerstrap","id_str":"41190190428979200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6628\u65e5\u91d1\u66dc\u65e5\u306f\u732e\u8840\u306b\u5f80\u304f\u3002\u4eca\u306e\u50d5\u306e\u4eba\u9593\u3068\u3057\u3066\u306e\u4fa1\u5024\u306f\u3001\u7cbe\u3005\u3053\u306e\u7a0b\u5ea6\u3002\u8179\u304c\u6e1b\u3063\u305f\u3002\u5374\u8aac\u3002twitter\u306e\u767e\u56db\u5341\u6587\u5b57\u306b\u82db\u3005\u3068\u3057\u3066\u3001\u4e00\u3064\u306e\u4eee\u8aac\u306b\u4fe1\u6191\u6027\u3092\u5f97\u308b\u3002\u6226\u6642\u4e0b\u306e\u7d19\u306e\u7d71\u5236\u3068\u3001\u4e2d\u5cf6\u6566\u306e\u6587\u7ae0\u306e\u95a2\u4fc2\u6027\u3002\u73fe\u5728\u30a6\u30a7\u30d6\u30ed\u30b0\u306b\u3001\u7e8f\u3081\u3066\u3044\u308b\u6700\u4e2d\u3002\u8fd1\u65e5\u516c\u958b\u4e88\u5b9a\u3002","id":41190190428979200,"from_user_id":200568705,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164970427","profile_image_url":"http://a0.twimg.com/profile_images/1227176662/9192b021ef85ce9902c28955f86e604b_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:59 +0000","from_user":"syuigetsuIT","id_str":"41190184041197569","metadata":{"result_type":"recent"},"to_user_id":141926331,"text":"@iliad_tga \u30a4\u30ea\u30a2\u30b9\u3055\u3093\u304c\u305d\u306e\u8fba\u7406\u89e3\u306e\u3042\u308b\u3053\u3068\u306f\u5206\u304b\u3063\u3066\u307e\u3059\uff57\u3000\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u306ftwitter\u306e\u6c7a\u5b9a\u7684\u306a\u6b20\u70b9\u3060\u3068\u601d\u3044\u307e\u3059\u306d\u3047\u3002","id":41190184041197569,"from_user_id":164970427,"to_user":"iliad_tga","geo":null,"iso_language_code":"ja","to_user_id_str":"141926331","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94526795","profile_image_url":"http://a0.twimg.com/profile_images/679411954/akb48_in_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:56 +0000","from_user":"akb48_in","id_str":"41190171248431104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"AKB48\u67cf\u6728\u7531\u7d00 \u304a\u75b2\u308c\u69d8\u3002: \n\u3053\u3093\u3070\u3093\u306f(^O^)\uff0f\u266a\n\u3000\n\u3000\n\u3000\n\u4eca\u65e5\u306e\u516c\u6f14\u697d\u3057\u304b\u3063\u305f\u301c\n\u3000\n\u3000\n\u4e45\u3057\u3076\u308a\u3067\u7dca\u5f35\u3057\u305f\u3051\u3069\u3001\u306f\u3058\u3051\u307e\u304f\u3063\u305f\u305c\u3043\uff01\uff01\n\u3000\n\u3000\n\u3000\nMC\u306f\u565b\u307f\u307e\u304f\u308a\u306e\u30c6\u30f3\u30d1\u308a\u307e\u304f... http://bit.ly/ie8bEa akb48 twitter","id":41190171248431104,"from_user_id":94526795,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"222270374","profile_image_url":"http://a3.twimg.com/profile_images/1250946143/P1040062_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:53 +0000","from_user":"chrxpac","id_str":"41190158455943168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671f\u3011Twitter\u306f\uff8a\uff9f\uff7f\uff7a\uff9d\u304b\u3089\u3057\u304b\u3067\u304d\u306a\u3044\u306e\u3067\uff98\uff8c\uff9f\u8fd4\u3057\u304c\u9045\u304f\u306a\u308a\u307e\u3059(\u00b4\u30fb\u03c9\u30fb\uff40)\u3054\u4e86\u627f\u4e0b\u3055\u3044!!","id":41190158455943168,"from_user_id":222270374,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"64009258","profile_image_url":"http://a2.twimg.com/profile_images/1154025023/Mixi___normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:52 +0000","from_user":"Tatsuyuko","id_str":"41190153447944192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4f01\u696d\u304c\u5c31\u6d3b\u751f\u306bFacebook\u3092\u4f7f\u3063\u3066\u7533\u8acb\u305b\u3088\u3068\u3044\u3044\u3001\u4f01\u696d\u304cFacebook\u3092\u4f7f\u3048\u3068\u4f01\u696d\u304c\u8a00\u3063\u3066\u304d\u305f\u308a\u3059\u308c\u3070\u305d\u308c\u3069\u3053\u308d\u3058\u3083\u306a\u3044\u304b\u3068\u3002\u5c11\u306a\u304f\u3068\u3082\u5c31\u6d3b\u3067Twitter\u306e\u8a00\u52d5\u3084\u30d5\u30a9\u30ed\u30ef\u30fc\u3092\u8abf\u67fb\u3059\u308b\u4f01\u696d\u306f\u304b\u306a\u308a\u591a\u3044\u3067\u3059 RT @Isshee: \u4f01\u696d\u3067\u3082\u540c\u3058\u3067\u3057\u3087 RT","id":41190153447944192,"from_user_id":64009258,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"105145175","profile_image_url":"http://static.twitter.com/images/default_profile_normal.png","created_at":"Fri, 25 Feb 2011 17:37:49 +0000","from_user":"snao813","id_str":"41190141703753728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @yumisaiki: \u795e\u69d8\u306f\u672c\u5f53\u306b\u4eba\u9593\u3092\u3059\u3070\u3089\u3057\u3044\u30d0\u30e9\u30f3\u30b9\u3067\u914d\u7f6e\u3057\u3066\u304a\u3089\u308c\u308b\u3002\u795d\u5cf6\u307f\u305f\u3044\u306a\u5c0f\u3055\u3044\u3068\u3053\u308d\u306b\u306a\u3093\u3067\u3053\u3093\u306a\u306b\u7acb\u6d3e\u306a\u4eba\u304c\u305f\u304f\u3055\u3093\u3044\u308b\u3093\u3060\u308d\u3046\u3002\u795e\u69d8\u3042\u308a\u304c\u3068\u3046\u3002\u672c\u5f53\u306b\u3042\u308a\u304c\u3068\u3046\u3002\u4eba\u9593\u3063\u3066\u3059\u3070\u3089\u3057\u3044\u3068\u601d\u3048\u305f\u3002twitter\u3082\u3042\u308a\u304c\u3068\u3046\u3002\u3000#kaminoseki","id":41190141703753728,"from_user_id":105145175,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"203667204","profile_image_url":"http://a2.twimg.com/profile_images/1254664000/eve_blackcat_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:46 +0000","from_user":"eve_blackcat","id_str":"41190129292943361","metadata":{"result_type":"recent"},"to_user_id":146894340,"text":"@kuroiso02 \u3057\u308a\u3068\u308a\u3068\u304b\uff1f\n\u2026\u3067\u3082Twitter\u3060\u3068\u7d42\u308f\u3089\u306a\u304f\u306a\u308b\u30b1\u30c9\u2026","id":41190129292943361,"from_user_id":203667204,"to_user":"kuroiso02","geo":null,"iso_language_code":"ja","to_user_id_str":"146894340","source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"6528403","profile_image_url":"http://a0.twimg.com/profile_images/1240591244/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:45 +0000","from_user":"sortiee","id_str":"41190125924917248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30cb\u30e1\u5b9f\u6cc1\u306ftwitter\u306e\u764c","id":41190125924917248,"from_user_id":6528403,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/peraperaprv/Home" rel="nofollow">P3:PeraPeraPrv</a>"},{"from_user_id_str":"186058304","profile_image_url":"http://a0.twimg.com/profile_images/1250454564/IMG_0210_normal.JPG","created_at":"Fri, 25 Feb 2011 17:37:37 +0000","from_user":"00o8o00","id_str":"41190090386448384","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190090386448384,"from_user_id":186058304,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49219631","profile_image_url":"http://a2.twimg.com/profile_images/1231873117/__2-colornow__2__normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:33 +0000","from_user":"irisgazer","id_str":"41190073227550720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3059\u3088\u306d\u3047 RT @minamitaiheiyou: \u6545\u306b\u30cd\u30bf\u30d0\u30ec\u3092\u3059\u308b\u306e\u3082\u81ea\u7531\u3002\u30cd\u30bf\u3070\u308c\u3057\u305f\u4eba\u3092\u30c7\u30a3\u30b9\u308b\u306e\u3082\u81ea\u7531\u3002\u3042\u3068\u306f\u5404\u3005\u306e\u88c1\u91cf\u3067\u4e57\u308a\u5207\u3063\u3066\u304f\u3060\u3055\u3044\u3088\u3081\u3093\u3069\u304f\u3055\u3044\u306a RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41190073227550720,"from_user_id":49219631,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"98560114","profile_image_url":"http://a0.twimg.com/profile_images/1252332545/IMGP8170_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:32 +0000","from_user":"qess0093","id_str":"41190070706905088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30b7\u30e5\u30fc\u30c6\u30a3\u304f\u305d\u3046\u305c\u3048\uff57 RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41190070706905088,"from_user_id":98560114,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:37:31 +0000","from_user":"SyokoShiratori","id_str":"41190064243478528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.50kg \u540c\u3058\u304f\u30c0\u30a4\u30a8\u30c3\u30c8\u4e2d\u3067\u3059\u3002\u3088\u304f\u3053\u306e\u30b5\u30a4\u30c8\u3067\u4f53\u91cd\u5831\u544a\u3057\u3066\u307e\u3059\u266a http://bit.ly/fhN2fM RT @msophiah \u3046\u3046\u3046\u30fb\u30fb\u30fb\u304a\u8179\u3059\u3044\u305f\u301c\u30fb\u30fb\u30fb\u6211\u6162\u3001\u6211\u6162\u3001\u6211\u6162\u3002\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3002","id":41190064243478528,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"180410237","profile_image_url":"http://a3.twimg.com/profile_images/1254473979/icon_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:30 +0000","from_user":"ka_ph","id_str":"41190062184079360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671fpost\u3011\u30d5\u30a7\u30eb\u30c7\u30a3\u30ca\u30f3\u30c8bot( http://twitter.com/ferdinand_bot )\u4f5c\u308a\u307e\u3057\u305f\u3002\u304a\u5b50\u69d8\u306e\u540d\u524d\u304a\u501f\u308a\u3055\u305b\u3066\u304f\u308c\u308b\u65b9\u3044\u307e\u3057\u305f\u3089@ka_ph\u307e\u3067\u304a\u9858\u3044\u3057\u307e\u3059\u3002","id":41190062184079360,"from_user_id":180410237,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"52283906","profile_image_url":"http://a3.twimg.com/profile_images/387644016/10100654519_s_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"rolling_bean","id_str":"41190043313913856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3081\u307e\u3044\u304c\u3057\u307e\u3059\u306d\u301cRT @yurikalin:\u30b3\u30a4\u30c4\u30e9\u5168\u54e1\u3044\u306a\u304f\u306a\u3063\u305f\u3089\u3001\u660e\u308b\u304f\u306a\u308b\u3060\u308d\u3046\u306a\u3041\uff5e\u266a\uff1e\u65e5\u672c\u306e\u30d3\u30b8\u30e7\u30f3 RT roll \u65e5\u7d4c\uff06CSIS\u30b7\u30f3\u30dd\u30b8\u30a6\u30e0\u300c\u5b89\u4fdd\u6539\u5b9a50\u5468\u5e74\u3001\u3069\u3046\u306a\u308b\u65e5\u7c73\u95a2\u4fc2\u300d http://bit.ly/dES8PY\u3000http://bit.ly/ihg0GT","id":41190043313913856,"from_user_id":52283906,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tabtter.jp" rel="nofollow">\u30bf\u30d6\u30c3\u30bf\u30fc</a>"},{"from_user_id_str":"351896","profile_image_url":"http://a3.twimg.com/profile_images/1179865336/icon12911887173020_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"cicada","id_str":"41190043292925952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4e2d\u5b66\u53d7\u9a13\u7a0b\u5ea6\u306e\u7b97\u6570\u306e\u554f\u984c\u3092\u51fa\u3059BOT http://twitter.com/arithmetic_bot \u6c17\u306b\u306f\u306a\u308b\u304c\u3001\u3061\u3083\u3093\u3068\u898b\u308b\u65e5\u304c\u6765\u308b\u3060\u308d\u3046\u304b\u30fb\u30fb\u3000#tearai\uff1a\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c http://locolabo.com/mz/ #mzlf","id":41190043292925952,"from_user_id":351896,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://locolabo.com/mz/" rel="nofollow">\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c</a>"},{"from_user_id_str":"744554","profile_image_url":"http://a1.twimg.com/profile_images/1088753125/11868894_normal.gif","created_at":"Fri, 25 Feb 2011 17:37:20 +0000","from_user":"Febreze","id_str":"41190019020505088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u3042\u307e\u308a\u6c17\u306b\u3057\u306a\u3044\u30bf\u30a4\u30d7\u3060\u3051\u3069\u306a\u3093\u304b\u3053\u3046Twitter\u958b\u304f\u3060\u3051\u3067\u30ac\u30f3\u30ac\u30f3\u30cd\u30bf\u30d0\u30ec\u5165\u3063\u3066\u304f\u308b\u306e\u306f\u306a\u3093\u3068\u3082\u8a00\u3048\u306a\u3044\u306a\u3002","id":41190019020505088,"from_user_id":744554,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"203371794","profile_image_url":"http://a1.twimg.com/profile_images/1226537594/___normal.png","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"himeko24","id_str":"41190004139114496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b21\u3044\u3063\u3066\u307f\u3088\u30fc\u3000\u306f\u3044\u3053\u308c\u3000 \u6fc0\u5b89\u26052010\u5e74\u590f\u65b0\u30c7\u30b6\u30a4\u30f3\u2605\u30bb\u30af\u30b7\u30fc\u306a\u9023\u4f53\u5f0f\u7121\u5730\u6c34\u7740 \u80f8\u30d1\u30c3\u30c9\u4ed8\u304dQ122 http://bit.ly/h72C4i","id":41190004139114496,"from_user_id":203371794,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.google.co.jp" rel="nofollow">himeko24</a>"},{"from_user_id_str":"119988932","profile_image_url":"http://a3.twimg.com/profile_images/1214344633/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"7na_love_6sa","id_str":"41190002000007169","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0\u3057\u307e\u3057\u305f\uff01Twitter\uff06mixi\u304b\u3089\u3082\u30b3\u30e1\u30f3\u30c8\u5b9c\u3057\u304f\u306d\u266a\n\u300c\u30cd\u30a4\u30eb\u30c1\u30a7\u30f3\u30b8\u266a\u300d http://amba.to/hy0Do2","id":41190002000007169,"from_user_id":119988932,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217408835","profile_image_url":"http://a1.twimg.com/profile_images/1215428655/____4.0157_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"nikubenki1123","id_str":"41189985424125952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189985424125952,"from_user_id":217408835,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"139137996","profile_image_url":"http://a0.twimg.com/profile_images/1087408006/cut_work_18_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"fujiokayouko","id_str":"41189984354566144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u591c\u4e2d\u306bTwitter\u3092\u306a\u3093\u3068\u306a\u304f\u8997\u3044\u305f\u3089\u3082\u306e\u3059\u3054\u3044\u307e\u3069\u30de\u30aeTL\u3067","id":41189984354566144,"from_user_id":139137996,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Mobile Web</a>"},{"from_user_id_str":"61221002","profile_image_url":"http://a3.twimg.com/profile_images/554916301/_1259757374_61_normal.png","created_at":"Fri, 25 Feb 2011 17:37:08 +0000","from_user":"hiromk63","id_str":"41189970613903360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kenji_kohashi \u7121\u4e8b\u6620\u753b\u88fd\u4f5c\u306e\u5831\u544a\u306f\u3067\u304d\u305f\u3051\u3069\u4eca\u3060\u7de8\u96c6\u306f\u7d9a\u3044\u3066\u307e\u3059w \u305d\u3093\u306a\u3068\u3053\u3067 \u6620\u753b\u300cDON'T STOP!\u300d\u306eTwitter \u30a2\u30ab\u30a6\u30f3\u30c8 @DONTSTOPMOVIE \u3082\u958b\u59cb\u3001\u3082\u3057\u826f\u304b\u3063\u305f\u3089\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u304f\u3060\u3055\u3044\uff01\u50d5\u3082\u542b\u3081\u6620\u753b\u88fd\u4f5c\u95a2\u4fc2\u8005\u304c\u6c17\u9577\u306b\u3064\u3076\u3084\u304d\u307e\u3059","id":41189970613903360,"from_user_id":61221002,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147393812","profile_image_url":"http://a1.twimg.com/profile_images/1114001122/hana_10_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"tubasa_uki","id_str":"41189965924667392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff10\uff10\uff17\u3082\u3073\u3063\u304f\u308a\u3000\u5927\u56fd\u306e\u5927\u7d71\u9818\u9078\u304b\u3089\u3000\u5cf6\u56fd\u306e\u5730\u65b9\u9078\u306e\u9078\u6319\u307e\u3067\u306b\u3082\u3000\u6697\u8e8d\u3057\u3066\u3044\u308b\uff3e\uff3e\u3000\u3053\u306eTwitter \u30b9\u30ad\u30e3\u30f3\u30c0\u30eb\u3084\u60aa\u8cea\u306a\u4e8b\u4ef6\u306b\u3082\u7d61\u3080\u304c\u3000Twitter\u304b\u3089\u767a\u4fe1\u3055\u308c\u305f\u3000\u5e73\u548c\u3078\u306e\u8ca2\u732e\u306f\u3000\u307e\u3055\u306b\u30ce\u30fc\u3079\u30eb\u5e73\u548c\u8cde\u3082\u306e http://bit.ly/esjWDG #dotubo_ss","id":41189965924667392,"from_user_id":147393812,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"96081746","profile_image_url":"http://a0.twimg.com/profile_images/1244505419/illust832_normal.png","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"kazukt","id_str":"41189963131387904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41189963131387904,"from_user_id":96081746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"86306230","profile_image_url":"http://a1.twimg.com/profile_images/593004766/j2j_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:03 +0000","from_user":"excite_j2j","id_str":"41189949927596032","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u79c1\u306f\u3001\u65e9\u7a32\u7530\u5927\u5b66\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u306e\u5b66\u751f\u306e\u8003\u3048\u3066\u3044\u308b\u3001\u5352\u696d\u751fSoudai /\u65e9\u7a32\u7530\u30ab\u30fc\u30c9\u4f1a\u54e1/ Soudai\u5b66\u751f\u89aa/\u3001\u8ab0\u304b\u304c\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u65e9\u7a32\u7530\u5927\u5b662000\u5186\u306e\u5165\u5834\u6599\u306e\u30e1\u30f3\u30d0\u30fc\u3092\u7d39\u4ecb\u3057\u3066\u304f\u308c\u305f\u65b9\u304c\u305a\u3063\u3068\u5b89\u4e0a\u304c\u308a\u3060\u3002 (\u5143\u767a\u8a00 http://bit.ly/esxiwT )","id":41189949927596032,"from_user_id":86306230,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://d.hatena.ne.jp/fn7" rel="nofollow">\u65e5\u672c\u8a9e\u65e5\u672c\u8a9e\u7ffb\u8a33\u30b8\u30a7\u30cd\u30ec\u30fc\u30bf</a>"},{"from_user_id_str":"120927161","profile_image_url":"http://a0.twimg.com/profile_images/1230006483/20110131_13022_26776_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:00 +0000","from_user":"FRISKFOSSILFANG","id_str":"41189933855158272","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189933855158272,"from_user_id":120927161,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"228973151","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:59 +0000","from_user":"daisuke1589","id_str":"41189931887890432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u3063\u3066\u52dd\u624b\u306b\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u3082\u3044\u3044\u3093\u3060\u3063\u3051\uff1f","id":41189931887890432,"from_user_id":228973151,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"54314110","profile_image_url":"http://a2.twimg.com/profile_images/1193541240/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:57 +0000","from_user":"Alohazuki","id_str":"41189922668953600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u306e\u5e83\u5cf6\u5f01\u3082\u3042\u3063\u305f\u3093\u3060\u306d\u3002","id":41189922668953600,"from_user_id":54314110,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"72594681","profile_image_url":"http://a3.twimg.com/profile_images/1227240916/____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:56 +0000","from_user":"uri4ichi","id_str":"41189916922744832","metadata":{"result_type":"recent"},"to_user_id":226852303,"text":"@7_fuka Twitter\u304b\u3076\u308c\u306f\u3001\u3059\u3050\u306bD\u306b\u8d70\u308b\u306e\u3067\u3002\u306a\u3093\u3060\u304b\u5fae\u7b11\u307e\u3057\u3044\u306e\u3067\u3059( \u2579\u25e1\u2579)","id":41189916922744832,"from_user_id":72594681,"to_user":"7_fuka","geo":null,"iso_language_code":"ja","to_user_id_str":"226852303","source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"168393854","profile_image_url":"http://a3.twimg.com/profile_images/1253554518/GuNp3xVS_normal","created_at":"Fri, 25 Feb 2011 17:36:55 +0000","from_user":"makonyanhime","id_str":"41189913701515264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6589\u85e4\u3055\u3093\u3082\u30c0\u30e1\u3060...\u4eca\u591c\u306fTwitter\u5909\u3060\u306a\u3041(;_;)","id":41189913701515264,"from_user_id":168393854,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122636787","profile_image_url":"http://a2.twimg.com/profile_images/1189607563/DSC01987_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:54 +0000","from_user":"enpy1217","id_str":"41189908500594688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u4e45\u3057\u3076\u308a\u306b\u958b\u3044\u305f\u3002\u3068\u3066\u3082\u591a\u5fd9\u3060\u3063\u305f\u3002\u75b2\u308c\u305f\u3002\u304a\u98a8\u5442\u306b\u3082\u5165\u308c\u306a\u304b\u3063\u305f\u3002\u30ad\u30bf\u30cd\u2026","id":41189908500594688,"from_user_id":122636787,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"81663694","profile_image_url":"http://a3.twimg.com/profile_images/1177576126/__normal.png","created_at":"Fri, 25 Feb 2011 17:36:51 +0000","from_user":"progmiya","id_str":"41189895494049792","metadata":{"result_type":"recent"},"to_user_id":94050844,"text":"@hirasai_skyhigh \u6674\u308c\u541b\u3002\u30cd\u30bf\u30d0\u30ec\u306f\u898b\u305f\u304f\u306a\u3044\u3051\u3069\u30012ch\u3082twitter\u3082\u3084\u308a\u305f\u3044\u306e\u304c\u4eba\u3068\u8a00\u3046\u3082\u306e\u3088","id":41189895494049792,"from_user_id":81663694,"to_user":"hirasai_skyhigh","geo":null,"iso_language_code":"ja","to_user_id_str":"94050844","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"159237469","profile_image_url":"http://a3.twimg.com/profile_images/1140433484/______2_normal.png","created_at":"Fri, 25 Feb 2011 17:36:50 +0000","from_user":"hikari_juku","id_str":"41189892096532480","metadata":{"result_type":"recent"},"to_user_id":135634241,"text":"@sssukimasuky \n\u4f55\u304b\u3042\u3063\u305f\u98a8\u3067\u3059\u306d\uff08\u7b11\uff09\u3000\u78ba\u304b\u306bTwitter\u306f\u6c17\u8efd\u3067\u3059\u3057\u306d\u3002\u30e1\u30fc\u30eb\u306b\u306a\u308b\u3068\u30d5\u30c3\u30c8\u30ef\u30fc\u30af\u304c\u91cd\u304f\u306a\u308b\u5834\u5408\u3082\u3042\u308b\u304b\u3082\u3057\u308c\u307e\u305b\u3093\u306d\u3002\u305d\u3046\u8003\u3048\u308b\u3068\u3059\u3054\u3044\u6642\u4ee3\u3060\u3002","id":41189892096532480,"from_user_id":159237469,"to_user":"sssukimasuky","geo":null,"iso_language_code":"ja","to_user_id_str":"135634241","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"141915990","profile_image_url":"http://a0.twimg.com/profile_images/1248969898/icon679566266564378764images_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:48 +0000","from_user":"adashino_","id_str":"41189886878949376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189886878949376,"from_user_id":141915990,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"111308629","profile_image_url":"http://a1.twimg.com/profile_images/1137421845/mmooton_normal.png","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"mmooton","id_str":"41189877940748288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @minponjp: \u3010\u3064\u3076\u3084\u304f\u3060\u3051\u306710000\u5186\u5546\u54c1\u5238GET\u3011<<visa\u30ae\u30d5\u30c8\u30ab\u30fc\u30c910000\u5186\u5206\u3092\u6bce\u6708\u62bd\u9078\u3067\u30d7\u30ec\u30bc\u30f3\u30c8>> \u21d2\u8a73\u3057\u304f\u306f\u4e0b\u306e\uff35\uff32\uff2c\u3088\u308a\u2193\u2193\u2193\u2193\u2193 http://minpon.jp/user_data/twitter_campaign.php","id":41189877940748288,"from_user_id":111308629,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"140945098","profile_image_url":"http://a0.twimg.com/profile_images/1198948281/b7664c71-87bc-4187-9d46-a61ab8d41b96_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"waruimayuko","id_str":"41189877122867200","metadata":{"result_type":"recent"},"to_user_id":113371008,"text":"@toumeisyoujyo \u3042\u3053\u3061\u3083\u3093Twitter\u3084\u3063\u3066\u305f\u306e\u306d\u3002\u307e\u3060\u304a\u5e2d\u3042\u308b\u305d\u3046\u306a\u306e\u3067\u662f\u975e\uff01","id":41189877122867200,"from_user_id":140945098,"to_user":"toumeisyoujyo","geo":null,"iso_language_code":"ja","to_user_id_str":"113371008","source":"<a href="http://twimi.jp/?r=via" rel="nofollow">twimi\u2606new</a>"},{"from_user_id_str":"167512527","profile_image_url":"http://a1.twimg.com/profile_images/1172286365/newspaper_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"KoranKaget","id_str":"41189871775252480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://bit.ly/93Eeud RT @motocentrism \u30d6\u30ed\u30b0\u8a18\u4e8b\u66f8\u304d\u307e\u3057\u305f\u30fc\uff1a MotoGP\u3000\u30d6\u30c3\u30af\u30e1\u30fc\u30ab\u30fc\u306b\u898b\u308b\u5404\u30e9\u30a4\u30c0\u30fc\u306e\u4e0b\u99ac\u8a55 - http://goo.gl/xVe6... http://bit.ly/hDYxyx @motogpudpate","id":41189871775252480,"from_user_id":167512527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"160251772","profile_image_url":"http://a3.twimg.com/profile_images/1150692471/_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"keikochaki","id_str":"41189870781075456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u305a\u3063\u3068twitter\u3084\u3063\u3066\u308b\u3088\u306d\u300d\u3068\u6012\u3089\u308c\u3066\u3057\u307e\u3063\u305f(\u82e6\u7b11)","id":41189870781075456,"from_user_id":160251772,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"211565766","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:36:42 +0000","from_user":"sayap1yo","id_str":"41189858236043264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u98df\u4e8b\u4f1a\u884c\u304d\u305f\u304b\u3063\u305f\u3051\u3069\n\u53cb\u9054\u3068\u904a\u3093\u3067\u307e\u3093\u305f\ue056\ue326\n\nTwitter\u898b\u3066\u307e\u3057\u305f\u3051\u3069\n\u3064\u3076\u3084\u304f\u30bf\u30a4\u30df\u30f3\u30b0\n\u5931\u3063\u3066\u305f\u3060\u3051\u3067\u3059( \u00b4 \u25bd ` )\uff89\u7b11","id":41189858236043264,"from_user_id":211565766,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com" rel="nofollow">TwitBird</a>"},{"from_user_id_str":"19603191","profile_image_url":"http://a1.twimg.com/profile_images/1254077264/116_normal.gif","created_at":"Fri, 25 Feb 2011 17:36:40 +0000","from_user":"Purple_Flash","id_str":"41189851873157120","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189851873157120,"from_user_id":19603191,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"215930291","profile_image_url":"http://a0.twimg.com/profile_images/1247906106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"minori_millie","id_str":"41189810055938048","metadata":{"result_type":"recent"},"to_user_id":212972774,"text":"@c_c_chika \u7b11\u3063\u3066\u305d\u3046\u3060\u306a\u3063\u3066\u601d\u3063\u3066\u305f(o^^o)\u30c1\u30ab\u306e\u7b11\u3044\u58f0\u304c\u805e\u3053\u3048\u3066\u304d\u305f\u3082\u3093\u3002mail\u306bTwitter\u3067\u5927\u5fd9\u3057\u3084\u3002","id":41189810055938048,"from_user_id":215930291,"to_user":"c_c_chika","geo":null,"iso_language_code":"ja","to_user_id_str":"212972774","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"SyokoShiratori","id_str":"41189809586311168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.90kg \u30c0\u30a4\u30a8\u30c3\u30c8\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002(*^^*)\u30c0\u30a4\u30a8\u30c3\u30c8\u4f53\u91cd\u5831\u544a\u306e\u3064\u3076\u3084\u304d\u3067\u3059\u3002 http://bit.ly/fhN2fM RT @hayayumi \u3053\u3093\u306a\u6642\u9593\u306b\u3084\u304d\u306b\u304f\u30fc\u266b\u30c0\u30a4\u30a8\u30c3\u30c8\u671f\u9593\u306a\u306e\u306b\u306d....","id":41189809586311168,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"12337665","profile_image_url":"http://a0.twimg.com/profile_images/1146194926/pixiv-icon_normal.png","created_at":"Fri, 25 Feb 2011 17:36:27 +0000","from_user":"t_a_k_i","id_str":"41189797364121600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Google\u30ea\u30fc\u30c0\u30fc\u3067\u30b5\u30a4\u30c8\u306e\u66f4\u65b0\u30c1\u30a7\u30c3\u30af\u3059\u308b\u3088\u308a\u3001Twitter\u30a2\u30ab\u30a6\u30f3\u30c8\u3092\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u66f4\u65b0\u3092\u77e5\u308b\u307b\u3046\u304c\u4fbf\u5229\u3060\u306a\u3053\u308c","id":41189797364121600,"from_user_id":12337665,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"104862453","profile_image_url":"http://a3.twimg.com/profile_images/1248609864/Image014_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:25 +0000","from_user":"yuz_ume","id_str":"41189787943714816","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189787943714816,"from_user_id":104862453,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"213846746","profile_image_url":"http://a1.twimg.com/profile_images/1242263342/haruhi1_normal.png","created_at":"Fri, 25 Feb 2011 17:36:23 +0000","from_user":"sloth888jpgame","id_str":"41189778409922560","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u643a\u5e2f\u96fb\u8a71\u7528\u306eTwitter\u3092\u5229\u7528\u3057\u305f\u30b2\u30fc\u30e0\u3092\u77e5\u3063\u3066\u3044\u308b\u4eba\u306f\u3001\u7d39\u4ecb\u3057\u3066\u304f\u3060\u3055\u3044\u3002 #TwitterGame","id":41189778409922560,"from_user_id":213846746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"17484724","profile_image_url":"http://a2.twimg.com/profile_images/1138677235/iconue_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:22 +0000","from_user":"tsutcho","id_str":"41189777831231490","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093twitter\u306b\u7acb\u3064\u30fb\u30fb\u30fb\u3060\u3068\u30fb\u30fb\u30fb\uff1f\uff12\u756a\u76ee\u306e\u30d5\u30a9\u30ed\u30ef\u30fc\u306e\u5ea7\u3092\u3044\u305f\u3060\u3044\u3066\u304a\u3053\u3046","id":41189777831231490,"from_user_id":17484724,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"220041064","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"sloth888jp_bot5","id_str":"41189772521254914","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6642\u3005\u3001TwiAll\uff08\u30c4\u30a4\u30aa\u30fc\u30eb\uff09\u3067Twitter\u306e\u81ea\u52d5\u30d5\u30a9\u30ed\u30fc\u30fb\u30d5\u30a9\u30ed\u30fc\u8fd4\u3057\u3092\u3057\u3066\u3044\u307e\u3059\u3002","id":41189772521254914,"from_user_id":220041064,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"177693537","profile_image_url":"http://a0.twimg.com/profile_images/1240130924/20110207213206_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"Na_Okinawa","id_str":"41189769912397824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41189769912397824,"from_user_id":177693537,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147006592","profile_image_url":"http://a2.twimg.com/profile_images/1251306448/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"takasu_rika","id_str":"41189763532865536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41189763532865536,"from_user_id":147006592,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"100239985","profile_image_url":"http://a1.twimg.com/profile_images/733461294/CIMG0207_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"strangebarjun","id_str":"41189762182152192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u3092\u59cb\u3081\u3066\u3001\u305d\u308d\u305d\u308d\u4e00\u5e74\u306b\u306a\u308a\u307e\u3059\u3002\u632f\u308a\u8fd4\u308b\u3068\u3001\u307c\u304f\u306e\u4eba\u9593\u6027\u3092\u305d\u3063\u304f\u308a\u53cd\u6620\u3059\u308b\u304c\u5982\u304f\u3001\u534a\u7aef\u3067\u3059\u306d\u3002\u60c5\u5831\u53ce\u96c6\u30c4\u30fc\u30eb\u3001\u60c5\u5831\u767a\u4fe1\u30c4\u30fc\u30eb\u3001\u30b3\u30df\u30e5\u30cb\u30b1\u30fc\u30b7\u30e7\u30f3\u30c4\u30fc\u30eb\u3001\u3069\u308c\u3082\u6a5f\u80fd\u3057\u5207\u308c\u3066\u3044\u306a\u3044\u306a\u3042\u3001\u3068\u3002\u305d\u3057\u3066\u3042\u308b\u306e\u306f\u300c\u3069\u3053\u304b\u3089\u3082\u76f8\u624b\u306b\u3055\u308c\u3066\u3044\u306a\u3044\u300d\u3068\u3044\u3046\u3001\u65e2\u77e5\u306e\u73fe\u5b9f\u3067\u3059\u3002","id":41189762182152192,"from_user_id":100239985,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"126390384","profile_image_url":"http://a2.twimg.com/profile_images/1176065038/nemunemu_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:18 +0000","from_user":"gesukapper","id_str":"41189757476286464","metadata":{"result_type":"recent"},"to_user_id":80935865,"text":"@tatsugorou \u306a\u3093\u304b\u4e16\u306e\u4e2d\u306b\u306f\u611a\u75f4\u3082\u4e0b\u30cd\u30bf\u3082\u8a00\u3044\u653e\u984c\u306etwitter\u3068\u3044\u3046\u3082\u306e\u304c\u3042\u308b\u305d\u3046\u3067\u3059\u3002","id":41189757476286464,"from_user_id":126390384,"to_user":"tatsugorou","geo":null,"iso_language_code":"ja","to_user_id_str":"80935865","source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"196059029","profile_image_url":"http://a1.twimg.com/profile_images/1208831726/ruka2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:17 +0000","from_user":"luka_m_bot","id_str":"41189756666777600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u308f\u305f\u3057\u3082twitter\u306f\u3058\u3081\u307e\u3057\u305f","id":41189756666777600,"from_user_id":196059029,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www24.atpages.jp/aoi2/bot.php" rel="nofollow">\u5de1\u308b\u97f3</a>"},{"from_user_id_str":"88135613","profile_image_url":"http://a3.twimg.com/profile_images/1088552877/P9280150_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:14 +0000","from_user":"Roko38","id_str":"41189740321587200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff46\uff42\u306b\u30ed\u30b0\u30a4\u30f3\u3059\u308b\u6a5f\u4f1a\u304c\u65e5\u306b\u65e5\u306b\u5897\u3048\u3066\u304d\u305f\uff3e\uff3e \u6163\u308c\u3066\u304f\u308b\u3068\u3042\u3063\u3061\u306e\u304c\u9762\u767d\u3044\uff06\u4f7f\u3044\u52dd\u624b\u304c\u3044\u3044\u3088\u3046\u306a\u6c17\u304c\u3059\u308b\u3002\u8907\u5408\u7684\u306b\u8272\u3005\u51fa\u6765\u307e\u3059\u3088\u306d\u2026\u3063\u3066\u3001\u601d\u3063\u305f\u3053\u3068\u3092\u545f\u304f\u306e\u306fTwitter\u3060\u3063\u305f\u308a\u3067\u3059\u304c\u2026(^_^; \u305d\u3057\u3066\u81ea\u5206\u306e\u5834\u5408\u306f\u30c4\u30a4\u3068\u9023\u52d5\u3057\u3065\u3089\u3044\u72b6\u6cc1\u3060\u3063\u305f\u308a\u3067\u2026\u3002","id":41189740321587200,"from_user_id":88135613,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"110825211","profile_image_url":"http://a2.twimg.com/profile_images/1108977866/o_t_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:12 +0000","from_user":"kou_nanjyo","id_str":"41189731941363712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189731941363712,"from_user_id":110825211,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"2095960","profile_image_url":"http://a2.twimg.com/profile_images/1248999075/majiresu2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:10 +0000","from_user":"guldeen","id_str":"41189726945947648","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3083\u307e\u3041\u3002\u25bchttp://bit.ly/et4vVa \uff3b\u89d2\u5ddd\u66f8\u5e97\uff3d\u300c\u30b6\u30fb\u30b9\u30cb\u30fc\u30ab\u30fc\u300d\u4f11\u520a\u3078\u3000\u300c\u6dbc\u5bae\u30cf\u30eb\u30d2\u300d\u751f\u3093\u3060\u30e9\u30ce\u30d9\u96d1\u8a8c18\u5e74\u3067\u5e55 via http://twitter.com/lkj777","id":41189726945947648,"from_user_id":2095960,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164121549","profile_image_url":"http://a1.twimg.com/profile_images/1251758789/m_108-07ae3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:09 +0000","from_user":"hachi_touhi","id_str":"41189719299727360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u6c17\u306b\u3057\u3066\u305f\u3089Twitter\u3084\u3063\u3066\u3089\u308c\u306a\u3044ww","id":41189719299727360,"from_user_id":164121549,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twicca.r246.jp/" rel="nofollow">twicca</a>"},{"from_user_id_str":"194494659","profile_image_url":"http://a3.twimg.com/profile_images/1249717822/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:08 +0000","from_user":"tomonattomo","id_str":"41189715415801856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308f\u3001\u660e\u65e5\u671d\u304b\u3089\u30d0\u30a4\u30c8\u3084\u306e\u306b\u306a\u3093\u3060\u3053\u306e\u306d\u3075\u304b\u3057\u3002\u3042\u3001\u591c\u66f4\u304b\u3057\u3002\u30d1\u30d4\u30eb\u30b9\u3068BUMP\u3001\u3048\u307f\u3068Twitter\u306eDM\u3057\u3059\u304e\u305f\u306a\u2026","id":41189715415801856,"from_user_id":194494659,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mixi.jp/promotion.pl?id=voice_twitter" rel="nofollow"> mixi \u30dc\u30a4\u30b9 </a>"},{"from_user_id_str":"97224364","profile_image_url":"http://a3.twimg.com/profile_images/1150074355/fb8bcca60d340862c053a756377bfae8_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:36:06 +0000","from_user":"xxxheat","id_str":"41189709174677504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u5b8c\u5168\u306b\u30d0\u30b0\u3063\u3066\u308borz","id":41189709174677504,"from_user_id":97224364,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"}],"max_id":41190705623732224,"since_id":38643906774044672,"refresh_url":"?since_id=41190705623732224&q=twitter","next_page":"?page=2&max_id=41190705623732224&rpp=100&lang=ja&q=twitter","results_per_page":100,"page":1,"completed_in":0.093336,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41190705623732224","query":"twitter"}
+ benchmarks/json-data/jp50.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"104712480","profile_image_url":"http://a3.twimg.com/profile_images/1204016928/icon5087697006727791368kuro2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:31:51 +0000","from_user":"asongfor_xx","id_str":"30649192296751104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7f8e\u4eba\u5929\u6c17\u304b\u3089tweet\u3059\u308b\u3068\u3053\u3093\u306a\u611f\u3058\u306a\u3093\u3060\u306a\u3002 RT asongfor_xx: \u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u304b\u306a\u3053\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u6674\u6642\u3005\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u73870%\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th","id":30649192296751104,"from_user_id":104712480,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"165965113","profile_image_url":"http://a0.twimg.com/profile_images/1200885316/shogomeguro_normal.jpg","created_at":"Thu, 27 Jan 2011 15:24:35 +0000","from_user":"shogomeguro","id_str":"30647362477105152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"2011.1.26 \u793e\u7a93\u304b\u3089\u3002\u4e0d\u601d\u8b70\u306a\u5929\u6c17\u3067\u3053\u306e\u5f8c\u96ea\u304c\u3061\u3089\u3064\u3044\u305f\u3093\u3060\u3088\u306d\u3002\u6771\u4eac\u306e\u521d\u96ea\u3067\u3057\u305f\u3002 http://instagr.am/p/BO_xn/","id":30647362477105152,"from_user_id":165965113,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://instagr.am" rel="nofollow">instagram</a>"},{"from_user_id_str":"166018520","profile_image_url":"http://a0.twimg.com/profile_images/1207460953/100-40030_normal.jpg","created_at":"Thu, 27 Jan 2011 15:18:17 +0000","from_user":"115nayume","id_str":"30645776254238722","metadata":{"result_type":"recent"},"to_user_id":118384679,"text":"@dancinpea09 \u6771\u4eac\u3001\u660e\u65e5\u3082\u5929\u6c17\u826f\u3044\u307f\u305f\u3044\u3067\u3001\u3088\u304b\u3063\u305f\u3067\u3059\u306d\u30fc\u266a \u30ca\u30a4\u30b9\u30c8\u30ea\u30c3\u30d7\uff01\u304a\u3084\u3059\u307f\u306a\u3055\u3044\u3002 http://twitpic.com/3tvun3","id":30645776254238722,"from_user_id":166018520,"to_user":"dancinpea09","geo":null,"iso_language_code":"ja","to_user_id_str":"118384679","source":"<a href="http://tweetli.st/" rel="nofollow">TweetList!</a>"},{"from_user_id_str":"202937674","profile_image_url":"http://a1.twimg.com/profile_images/1218797578/______2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:11:48 +0000","from_user":"ryuusisan","id_str":"30644146498699264","metadata":{"result_type":"recent"},"to_user_id":203058384,"text":"@manaasutakshi \u6771\u4eac\u306f\u964d\u3063\u3066\u306a\u3044\u3093\u3067\u3059\u304b\u30fb\u30fb\u30fb\u5929\u6c17\u4e88\u5831\u306b\u3088\u308b\u3068\u660e\u65e5\u3082\u6771\u4eac\u306f\u964d\u3089\u306a\u3044\u305d\u3046\u3067\u3059\u306d\uff01\uff01\u79c1\u306e\u4f4f\u3093\u3067\u3044\u308b\u3068\u3053\u308d\u306f\u5fae\u5999\u306b\u964d\u308a\u305d\u3046\u3067\u51fa\u52e4\u6642\u306b\u964d\u3063\u3066\u305f\u3089\u3061\u3087\u3063\u3068\u5acc\u3060\u306a\u3041\u3000\u306a\u3093\u3066\u601d\u3044\u307e\u3059","id":30644146498699264,"from_user_id":202937674,"to_user":"manaasutakshi","geo":null,"iso_language_code":"ja","to_user_id_str":"203058384","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"3222182","profile_image_url":"http://a0.twimg.com/profile_images/1199090957/ProfilePhoto_normal.png","created_at":"Thu, 27 Jan 2011 15:09:35 +0000","from_user":"44mune","id_str":"30643589545459713","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u306e\u308a\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d http://twitpic.com/3tvruh","id":30643589545459713,"from_user_id":3222182,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"154341982","profile_image_url":"http://a0.twimg.com/profile_images/1155496864/_____normal.jpg","created_at":"Thu, 27 Jan 2011 15:02:39 +0000","from_user":"slave_420_bot","id_str":"30641845490946049","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u30f3\u3068\u3053\u899a\u3048\u3066\u308b\u306e\u306f\u300c\u672d\u5e4c\u300d\u300c\u4ed9\u53f0\u300d\u300c\u6771\u4eac\u300d\u300c\u5927\u962a\u300d\u300c\u540d\u53e4\u5c4b\u300d\u300c\u798f\u5ca1\u300d\u306e\u4eca\u65e5\u3068\u660e\u65e5\u306e\u5929\u6c17\u3060\u306a\u3002\u5929\u6c17\u304c\u77e5\u308a\u305f\u3044\u6642\u306f\u300c\u5834\u6240\u300d\u3068\u300c\u4eca\u65e5\u306e\u5929\u6c17\u300d\u304b\u300c\u660e\u65e5\u306e\u5929\u6c17\u300d\u3092\u304a\u7533\u3057\u4ed8\u3051\u304f\u3060\u3055\u3044\u3001\u304a\u5b22\u69d8\uff1f","id":30641845490946049,"from_user_id":154341982,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bot.syoyu.net/" rel="nofollow">\u7adc\u30f6\u5cf0\u90b8\u306e\u3069\u3053\u304b</a>"},{"from_user_id_str":"72042678","profile_image_url":"http://a3.twimg.com/profile_images/1198771027/larxene_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:57 +0000","from_user":"larxene_bot","id_str":"30641668772339712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u5929\u6c17\u306f \u672d\u5e4c\u304c\u6674\u308c \u4ed9\u53f0\u304c\u66c7\u6642\u3005\u96ea \u6771\u4eac\u304c\u6674\u306e\u3061\u66c7 \u540d\u53e4\u5c4b\u304c\u6674\u6642\u3005\u66c7 \u5927\u962a\u304c\u6674\u6642\u3005\u66c7 \u798f\u5ca1\u304c\u6674\u308c \u3089\u3057\u3044\u308f\u3088 \u6ce8\u610f\u3057\u306a\u3055\u3044","id":30641668772339712,"from_user_id":72042678,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www4.kiwi-us.com/~yuuna/larxene_bot_manual/index.html" rel="nofollow">\u5fd8\u5374\u306e\u57ce \u5730\u4e0a\u306e12\u968e</a>"},{"from_user_id_str":"101331893","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 15:01:34 +0000","from_user":"yoshiftan","id_str":"30641572240424961","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3073\u3063\u304f\u308a\uff01\u6691\u305d\u3046\u3060\u306a\u3053\u308a\u3083\u3002","id":30641572240424961,"from_user_id":101331893,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"Keitai Mail"},{"from_user_id_str":"65207550","profile_image_url":"http://a3.twimg.com/profile_images/448731969/_________R_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:33 +0000","from_user":"kabuyo","id_str":"30641566469066752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u5929\u6c17\u4e88\u5831\u3067\u306f\u6771\u4eac\u3067\u306f\u4e7e\u71e5\u6ce8\u610f\u5831\u304c\u7d9a\u3044\u3066\u3044\u308b\u3089\u3057\u3044\u306e\u306b\u3001\u306a\u305c\u79c1\u304c\u5e72\u3057\u305f\u6d17\u6fef\u7269\u306f\u96e8\u306b\u6fe1\u308c\u3066\u3057\u307e\u3063\u305f\u306e\u3060\u308d\u3046\u304b\u2025\u3000\u3088\u3063\u307d\u3069\u904b\u304c\u60aa\u3044\u3089\u3057\u3044\u2025","id":30641566469066752,"from_user_id":65207550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:54:30 +0000","from_user":"mikutyan","id_str":"30639792026812416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066","id":30639792026812416,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:53:06 +0000","from_user":"mikutyan","id_str":"30639439847890944","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u660e\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306a\u3093\u3060\u308d\u3046 \u96e8\u964d\u3063\u305f\u3089\u56f0\u308b\u3002","id":30639439847890944,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 14:47:19 +0000","from_user":"Cirno_fan","id_str":"30637984684449792","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u305f\u3044\u30c1\u30eb\u30ce\uff01\u30dc\u30c3\u30c8\u3060\u3051\u3069\u5929\u6c17\u4e88\u5831\u3082\u3067\u304d\u308b\u3088\uff01\u300c\u6771\u4eac\u306e\u4eca\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066\u300d\u307f\u305f\u3044\u306bTL\u767a\u8a00\u3057\u3066\u304f\u308c\u308c\u3070\u8abf\u3079\u3066\u3042\u3052\u308b\uff01 #followme #followmejp #followmevip #tenki","id":30637984684449792,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"33858777","profile_image_url":"http://a0.twimg.com/profile_images/352864695/muga_normal.jpg","created_at":"Thu, 27 Jan 2011 14:46:12 +0000","from_user":"collonist","id_str":"30637702105796610","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u3063\u3066\u51ac\u306f\u57fa\u672c\u7684\u306b\u6674\u308c\u3066\u308b\u304b\u3089\u3001\u5929\u6c17\u4e88\u5831\u898b\u306a\u304f\u3066\u3082\u5168\u7136\u554f\u984c\u306a\u3044\u3002\u5c71\u5f62\u3060\u3068\u660e\u65e5\u306f\u3069\u3093\u3060\u3051\u96ea\u304c\u964d\u308b\u306e\u304b\u3001\u3069\u3093\u3060\u3051\u5bd2\u3044\u306e\u304b\u628a\u63e1\u3057\u3066\u3068\u304d\u305f\u3044\u306e\u3067\u3001\u5929\u6c17\u4e88\u5831\u306f\u5fc5\u305a\u30c1\u30a7\u30c3\u30af\u3057\u3066\u305f\u306e\u3060\u304c\u3002","id":30637702105796610,"from_user_id":33858777,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"79336228","profile_image_url":"http://a0.twimg.com/profile_images/1130029876/zmanmu_normal.png","created_at":"Thu, 27 Jan 2011 14:30:23 +0000","from_user":"atsuki777","id_str":"30633725041573890","metadata":{"result_type":"recent"},"to_user_id":null,"text":"MXTV\u306e\u5929\u6c17\u4e88\u5831\u521d\u3081\u3066\u898b\u305f\u3051\u3069\u6771\u4eac\u753a\u7530\u516b\u738b\u5b50\u3063\u3066\u5730\u57df\u8868\u793a\u304c\u2026w\u516b\u738b\u5b50\u3068\u753a\u7530\u306f\u6771\u4eac\u3058\u3083\u306a\u3044\u306e\u304bwww","id":30633725041573890,"from_user_id":79336228,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"90576097","profile_image_url":"http://a0.twimg.com/profile_images/1203320254/nanami1_normal.png","created_at":"Thu, 27 Jan 2011 14:28:26 +0000","from_user":"dycroft","id_str":"30633234245099521","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633234245099521,"from_user_id":90576097,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"147215268","profile_image_url":"http://a2.twimg.com/profile_images/1198555202/ichika-7.4.0-3P_normal.gif","created_at":"Thu, 27 Jan 2011 14:28:23 +0000","from_user":"kiaran5032","id_str":"30633222211637248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002\u6674\u308c\u6642\u3005\u304f\u3082\u308a #MX","id":30633222211637248,"from_user_id":147215268,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"1741599","profile_image_url":"http://a0.twimg.com/profile_images/1205744888/950637_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:21 +0000","from_user":"dasaitama","id_str":"30633212535382016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u3001\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633212535382016,"from_user_id":1741599,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"34140879","profile_image_url":"http://a3.twimg.com/profile_images/1186413535/__6_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:17 +0000","from_user":"ryuji_chaos","id_str":"30633197016449024","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002","id":30633197016449024,"from_user_id":34140879,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"1400","profile_image_url":"http://a0.twimg.com/profile_images/1198556839/westerndog_20090104_320x320_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:16 +0000","from_user":"westerndog","id_str":"30633191232503808","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633191232503808,"from_user_id":1400,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"89239832","profile_image_url":"http://a3.twimg.com/profile_images/519522846/noriko_normal.jpg","created_at":"Thu, 27 Jan 2011 14:15:01 +0000","from_user":"Noriko_Fujimoto","id_str":"30629857234788352","metadata":{"result_type":"recent"},"to_user_id":115645219,"text":"@nossa430402 \u5bcc\u5c71\u306f\u3059\u3054\u3044\u96ea\u307f\u305f\u3044\u3067\u3059\u306d\uff5e\uff08\u5bd2\u3063\uff09\u3000\u6771\u4eac\u306f\u305d\u306e\u5206\u6bce\u65e5\u826f\u3044\u5929\u6c17\u3067\u3059\u3002\u5bd2\u3044\u3051\u3069\u30fb\u30fb\u30fb\u3002","id":30629857234788352,"from_user_id":89239832,"to_user":"nossa430402","geo":null,"iso_language_code":"ja","to_user_id_str":"115645219","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"107265539","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 14:01:10 +0000","from_user":"kurumasuki330","id_str":"30626371826884608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u9031\u571f\u66dc\u65e5\u3001\u8eca\u3067\u6771\u4eac\u304b\u3089\u6771\u540d\u3001\u7c73\u539f\u7d4c\u7531\u3067\u91d1\u6ca2\u306e\u5b9f\u5bb6\u3078\u3002\u305d\u3057\u3066\u3001\u6708\u66dc\u65e5\u306b\u6771\u4eac\u3078\u5e30\u308b\u30b9\u30b1\u30b8\u30e5\u30fc\u30eb\u3002\u5929\u6c17\u4e88\u5831\u3060\u3068\u4eca\u9031\u672b\u3001\u5317\u9678\u5730\u65b9\u306f\u5927\u96ea\uff01\u5e30\u308c\u308b\u304b\u81ea\u4fe1\u304c\u306a\u304f\u306a\u3063\u3066\u304d\u305f\u3002\u307e\u305f\u3001\u305d\u306e\u6642\u5b9f\u6cc1\u4e2d\u7d99\u3057\u307e\u3059\u3002","id":30626371826884608,"from_user_id":107265539,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"155313166","profile_image_url":"http://a3.twimg.com/profile_images/1167554721/73931_1408370184003_1674923704_920888_5686998_n_normal.jpg","created_at":"Thu, 27 Jan 2011 14:00:50 +0000","from_user":"takuya_aoki","id_str":"30626287127105536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3081\u3063\u3061\u3083\u3044\u3044\u5929\u6c17\u3067\u904e\u3054\u3057\u3084\u3059\u3044\u3051\u3069\u30c9\u30e9\u30a4\u30a2\u30a4\u306b\u306f\u3061\u3087\u3063\u3068\u304d\u3064\u3044\u306a\u30fb\u30fb\u30fb\u76ee\u85ac\u304c\u624b\u653e\u305b\u306a\u3044","id":30626287127105536,"from_user_id":155313166,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"179984398","profile_image_url":"http://a1.twimg.com/profile_images/1182382310/g4350_normal.jpg","created_at":"Thu, 27 Jan 2011 13:52:50 +0000","from_user":"aiilabo","id_str":"30624271902449664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0 \u25c6\u611f\u60c5\u3092\u307f\u3064\u3081\u308b\u65b9\u6cd5 - \u3053\u3053\u6570\u65e5\u3001\u6642\u6298\u96e8\u304c\u30d1\u30e9\u30d1\u30e9\u3000\u5fae\u5999\u306a\u5929\u6c17\u306e\u6771\u4eac\u304b\u3089\u3042\u308b\u304c\u307e\u307e\u3067\u3059\u3002 \n\n \u4eca\u65e5\u306f\u3001\u6628\u65e5\u306e\u300c\u30de\u30a4\u30ca\u30b9\u611f\u60c5\u306f\u60aa\u3067\u3059\u304b\uff1f\n.. \u27aa http://am6.jp/e3e9tS","id":30624271902449664,"from_user_id":179984398,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://feedtweet.am6.jp/" rel="nofollow">\u261e feedtweet.jp \u261c</a>"},{"from_user_id_str":"185992391","profile_image_url":"http://a2.twimg.com/profile_images/1192695844/otenki_normal.png","created_at":"Thu, 27 Jan 2011 13:00:37 +0000","from_user":"otenki_luci_bot","id_str":"30611130938298368","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u767a\u58f2\u65e5\u304b\u2026\u2026\u541b\u305f\u3061\u306b\u3068\u3063\u3066\u306f\u591a\u5206\u300190\u65e5\u5f8c\u306e\u3053\u3068\u3060\u3002\u3055\u3066\u660e\u65e5\u306e\u6771\u4eac\u90fd\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3060\u305d\u3046\u3060\u3002\u3055\u3059\u304c\u306b\u4f55\u304b\u7740\u305f\u65b9\u304c\u3044\u3044\u305e\u3001\u30a4\u30fc\u30ce\u30c3\u30af\u3002","id":30611130938298368,"from_user_id":185992391,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/otenki_luci_bot" rel="nofollow">\u304a\u3066\u3093\u304d\u308b\u3057\u3075\u3047\u308b</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 13:00:04 +0000","from_user":"heta_weather01","id_str":"30610995843964928","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Jo napot.\u30cf\u30f3\u30ac\u30ea\u30fc\u3067\u3059\u3002\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3067\u660e\u65e5\u306f\u6674\u6642\u3005\u66c7\u3001\u79c1\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067-2\u2103\u3067\u3059\u3002\u3048\u3001\u3053\u306e\u30d5\u30e9\u30a4\u30d1\u30f3\u3067\u3059\u304b\uff1f\u2026\u3061\u3087\u3063\u3068\u500b\u4eba\u7684\u306b\u6bb4\u308a\u305f\u3044\u4eba\u304c\u3044\u308b\u3093\u3067\u3059\u266a","id":30610995843964928,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"109740077","profile_image_url":"http://a0.twimg.com/profile_images/1212763349/1d3d3821-6b3a-449f-a636-05b95ce3d5d8_normal.png","created_at":"Thu, 27 Jan 2011 12:59:41 +0000","from_user":"snow_arai","id_str":"30610896141156354","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3001\u30ab\u30e9\u30ab\u30e9\u9023\u7d9a\u3000\uff13\u4f4d\u30bf\u30a4 - \u65e9\u8d77\u304d\u2606\u304a\u5929\u6c17\u2606ONAIR\u65e5\u8a18\uff1a\u65e5\u7d4c\u30a6\u30fc\u30de\u30f3\u30aa\u30f3\u30e9\u30a4\u30f3 http://j.mp/hxP3Di","id":30610896141156354,"from_user_id":109740077,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"53407951","profile_image_url":"http://a1.twimg.com/profile_images/397960795/airman_normal.jpg","created_at":"Thu, 27 Jan 2011 12:57:32 +0000","from_user":"Airman2009","id_str":"30610355541508096","metadata":{"result_type":"recent"},"to_user_id":null,"text":". @04mmy22 @qsk1 \u98a8\u3068\u96f2\u30fb\u30fb\u30fb\u98db\u884c\u6a5f\u306e\u5927\u5c0f\u554f\u308f\u305a\u3001\u3053\u308c\u3070\u304b\u308a\u306f\u3069\u3046\u3057\u3088\u3046\u3082\u7121\u3044\u3067\u3059\u3088\u306d\u3002 \u6700\u8fd1\u306e\u5357\u6771\u4eac\u306e\u5929\u6c17\u306f\u5909\u3067\u3059\u306d\u3002\u3002\u3002","id":30610355541508096,"from_user_id":53407951,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"111826019","profile_image_url":"http://a1.twimg.com/profile_images/1121742732/DVC00052_normal.jpg","created_at":"Thu, 27 Jan 2011 12:51:12 +0000","from_user":"nijiks","id_str":"30608762859421696","metadata":{"result_type":"recent"},"to_user_id":100014282,"text":"@sanaeru \u79c1\u3053\u3093\u306a\u5929\u6c17\u306e\u4e2d\uff64\u4e8c\u6cca\u4e09\u65e5\u3067\u660e\u65e5\u304b\u3089\u6771\u4eac\u884c\u304f\u3093\u3067\u3059\u3051\u3069\u2026\uff61\u65e5\u66dc\u65e5\u98db\u884c\u6a5f\u98db\u3076\u304b\u3057\u3089\u2026\uff1f","id":30608762859421696,"from_user_id":111826019,"to_user":"sanaeru","geo":null,"iso_language_code":"ja","to_user_id_str":"100014282","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"164951488","profile_image_url":"http://a3.twimg.com/profile_images/799082230/twitter_normal.jpg","created_at":"Thu, 27 Jan 2011 12:47:49 +0000","from_user":"minorif_jp","id_str":"30607912309096448","metadata":{"result_type":"recent"},"to_user_id":105078670,"text":"@ecco_HIRADO \u5e73\u6238\u725b\u3063\u3066\u5143\u306f\u30aa\u30e9\u30f3\u30c0\u304b\u3089\u304d\u305f\u725b\u306a\u3093\u3060\u306d\u3002\u304a\u3044\u3057\u305d\u3046\u2026\u3002\u5e73\u6238\u306f\u3088\u304b\u6240\u305f\u3043\u3002\u3042\u305f\u3044\u3052\u3047\u3093\u5b9f\u5bb6\u3093\u65b9\u306f\u30c0\u30d6\u30eb\u706b\u5c71\u3084\u9ce5\u30a4\u30f3\u30d5\u30eb\u3067\u5927\u5909\u3084\u3063\u3069\u3002\u6771\u4eac\u3093\u826f\u304b\u3068\u3053\u306f\u5929\u6c17\u306e\u5fc3\u914d\u305b\u305a\u66ae\u3089\u305b\u308b\u3068\u3053\u3058\u3083\u3063\u3069\u3093\u3002","id":30607912309096448,"from_user_id":164951488,"to_user":"ecco_HIRADO","geo":null,"iso_language_code":"ja","to_user_id_str":"105078670","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"10456803","profile_image_url":"http://a1.twimg.com/profile_images/145280215/vot_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:43:37 +0000","from_user":"vot_","id_str":"30606853377363968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3086\u3063\u304f\u308a\u5929\u6c17\u4e88\u5831\u3067\u3059\u3002\u6771\u4eac\u90fd,\u5927\u5cf6\u5730\u65b9\u300228\u65e5\uff08\u91d1\u66dc\u65e5\u306e\u5929\u6c17\u306f\u6674\u308c\u306e\u3061\u66c7\u308a\u3001\u6700\u9ad8\u6c17\u6e29\u306f7\u5ea6 \u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3057\u3087\u3046\u3002","id":30606853377363968,"from_user_id":10456803,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://voiceoftwitter.com" rel="nofollow">\uff56\uff4f\uff49\uff43\uff45 \uff4f\uff46 \uff54\uff57\uff49\uff54\uff54\uff45\uff52</a>"},{"from_user_id_str":"23900716","profile_image_url":"http://a3.twimg.com/profile_images/1092646332/twitter_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:38:00 +0000","from_user":"keiyama","id_str":"30605442639990784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u30c8\u30e2\u30b3\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/27(\u6728)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3tuekm #bt_tenki","id":30605442639990784,"from_user_id":23900716,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"32018516","profile_image_url":"http://a0.twimg.com/profile_images/1089472069/237_normal.jpg","created_at":"Thu, 27 Jan 2011 12:36:28 +0000","from_user":"DigJandG","id_str":"30605057460281344","metadata":{"result_type":"recent"},"to_user_id":196050661,"text":"@kosumoworld55 \u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3044\u3064\u3082\u601d\u3046\u3093\u3060\u3002\u4f55\u3067\u6a2a\u6d5c\u3042\u305f\u308a\u306f\u3044\u3064\u3082\u597d\u3044\u5929\u6c17\u306a\u3093\u3060\u3002\u6771\u4eac\u3082\u3002\u3061\u306a\u307f\u306b\u516c\u9b5a\u306f\u3042\u3093\u307e\u308a\u597d\u304d\u3067\u306f\u3042\u308a\u307e\u305b\u3093\u3002\u306a\u3093\u304b\u81ed\u304f\u3063\u3066\u3002\u3067\u3082\u3001\u7435\u7436\u6e56\u3067\u516c\u9b5a\u3063\u3066\u3042\u307e\u308a\u805e\u304b\u306a\u3044\u69d8\u306a\u30fb\u30fb\u30fb\u3002\u4ffa\u304c\u91e3\u308a\u3092\u3057\u306a\u3044\u304b\u3089\u304b\u306a\uff1f","id":30605057460281344,"from_user_id":32018516,"to_user":"kosumoworld55","geo":null,"iso_language_code":"ja","to_user_id_str":"196050661","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90935348","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 12:34:34 +0000","from_user":"sorakeiko","id_str":"30604575937396737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u95a2\u6771\u5730\u65b9\u306e\u660e\u65e5\u306e\u5929\u6c17\u2015\u7d9a\u304d\u3002\u660e\u65e5\u671d\u6700\u4f4e\u6c17\u6e29\u30fb\u8ed2\u4e26\u307f\u6c37\u70b9\u4e0b\u30fb\u5b87\u90fd\u5bae\u3001\u6c34\u6238\u30de\u30a4\u30ca\u30b95\u5ea6\u30fb\u6771\u4eac\u3001\u6a2a\u6d5c1\u5ea6\u3002\u6700\u9ad8\u6c17\u6e29\u30fb\u4eca\u65e5\u3088\u308a3\u5ea6\u524d\u5f8c\u4f4e\u304f5\uff5e8\u5ea6\u30fb\u6771\u4eac\u3001\u5343\u84498\u5ea6\u3002\u5411\u3053\u3046\u4e00\u9031\u9593\u30fb\u4e7e\u71e5\u3057\u305f\u6674\u308c\u7d9a\u304f\u30fb\uff08\u571f\uff09\u4f0a\u8c46\u8af8\u5cf6\u306b\u51b7\u305f\u3044\u96e8\u3084\u96ea\u304c\u898b\u3089\u308c\u305d\u3046\u3060\u304c\u3001\u95a2\u6771\u306e\u4e7e\u3044\u305f\u72b6\u614b\u7d9a\u304f\u3002","id":30604575937396737,"from_user_id":90935348,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"6113557","profile_image_url":"http://a3.twimg.com/profile_images/1227080026/profile_red_herencia_normal.png","created_at":"Thu, 27 Jan 2011 12:33:57 +0000","from_user":"fmoto7","id_str":"30604423327653888","metadata":{"result_type":"recent"},"to_user_id":null,"text":""\u6771\u4eac\u6c34\u904b\u7528\u30bb\u30f3\u30bf\u30fc\u306f\u3001\u524d\u534a\u6226\u304c\u7d42\u308f\u3063\u305f\u3068\u3053\u308d\u3067\u4e00\u6c17\u306b\u6c34\u5727\u9ad8\u3081\u3001\u5f8c\u534a\u6226\u59cb\u307e\u308b\u3068\u6c34\u5727\u4e0b\u3052\u3001\u7d42\u308f\u308b\u3068\u307e\u305f\u3059\u3050\u4e0a\u3052\u308b\u3002\u30c6\u30ec\u30d3\u306e\u8996\u8074\u3001\u305d\u306e\u65e5\u306e\u5929\u6c17\u306a\u3069\u30e9\u30a4..." http://tumblr.com/xjy1cwiwrm","id":30604423327653888,"from_user_id":6113557,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tumblr.com/" rel="nofollow">Tumblr</a>"},{"from_user_id_str":"118092912","profile_image_url":"http://a3.twimg.com/profile_images/1225330653/____normal.PNG","created_at":"Thu, 27 Jan 2011 12:29:13 +0000","from_user":"saechuchun","id_str":"30603231042207744","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3082\u5730\u9707\u306e\u8a71\u984c\u306e\u3068\u304d\u306e\u300c\u3082\u3057\u6771\u4eac\u3067\u76f4\u4e0b\u578b\u5730\u9707\u304c\u8d77\u304d\u305f\u3089\u300d\u3068\u304b\u5929\u6c17\u4e88\u5831\u306e\u3068\u304d\u306f\u897f\u3067\u96e8\u3060\u308d\u3046\u3068\u300c\u6771\u4eac\u3067\u306f\u301c\u65e5\u9593\u4e7e\u71e5\u3057\u3066\u307e\u3059\u306d\u30fc\u300d\u3068\u304b\u305d\u3046\u3044\u3046\u30ad\u30fc\u5c40\u306e\u95a2\u6771\u4e2d\u5fc3\u4e3b\u7fa9\u306f\u597d\u304d\u3067\u306f\u306a\u3044","id":30603231042207744,"from_user_id":118092912,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&rpp=50&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":50,"page":1,"completed_in":0.170202,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"}
+ benchmarks/json-data/numbers.json view
@@ -0,0 +1,1 @@+[1.15, 1.3224999999999998, 1.5208749999999998, 1.7490062499999994, 2.0113571874999994, 2.313060765624999, 2.6600198804687487, 3.0590228625390607, 3.5178762919199196, 4.045557735707907, 4.652391396064092, 5.350250105473706, 6.152787621294761, 7.075705764488975, 8.137061629162321, 9.357620873536668, 10.761264004567169, 12.375453605252241, 14.231771646040077, 16.36653739294609, 18.821518001888, 21.644745702171196, 24.891457557496874, 28.625176191121405, 32.918952619789614, 37.856795512758055, 43.535314839671756, 50.06561206562252, 57.57545387546589, 66.21177195678577, 76.14353775030362, 87.56506841284916, 100.69982867477653, 115.804802975993, 133.17552342239193, 153.15185193575073, 176.1246297261133, 202.5433241850303, 232.9248228127848, 267.86354623470254, 308.04307816990786, 354.24953989539404, 407.3869708797031, 468.49501651165855, 538.7692689884072, 619.5846593366683, 712.5223582371685, 819.4007119727437, 942.3108187686552, 1083.6574415839534, 1246.2060578215462, 1433.136966494778, 1648.1075114689947, 1895.323638189344, 2179.622183917745, 2506.565511505407, 2882.5503382312177, 3314.9328889659, 3812.172822310785, 4383.998745657402, 5041.598557506012, 5797.838341131914, 6667.5140923017, 7667.641206146955, 8817.787387068996, 10140.455495129345, 11661.523819398746, 13410.752392308557, 15422.365251154839, 17735.720038828065, 20396.078044652273, 23455.489751350113, 26973.813214052625, 31019.885196160518, 35672.867975584595, 41023.79817192228, 47177.36789771062, 54253.97308236721, 62392.06904472228, 71750.87940143062, 82513.5113116452, 94890.53800839197, 109124.11870965076, 125492.73651609836, 144316.6469935131, 165964.14404254008, 190858.76564892105, 219487.5804962592, 252410.71757069806, 290272.32520630275, 333813.17398724816, 383885.1500853353, 441467.9225981356, 507688.1109878559, 583841.3276360342, 671417.5267814393, 772130.1557986551, 887949.6791684533, 1021142.1310437213, 1174313.4507002793, 1350460.4683053212, 1553029.5385511192, 1785983.969333787, 2053881.564733855, 2361963.7994439327, 2716258.369360523, 3123697.124764601, 3592251.6934792907, 4131089.447501184, 4750752.864626361, 5463365.794320315, 6282870.663468362, 7225301.262988616, 8309096.452436907, 9555460.920302443, 10988780.058347808, 12637097.067099977, 14532661.627164973, 16712560.871239718, 19219445.001925673, 22102361.752214525, 25417716.0150467, 29230373.417303704, 33614929.42989926, 38657168.84438414, 44455744.17104176, 51124105.79669802, 58792721.66620272, 67611629.91613312, 77753374.40355308, 89416380.56408603, 102828837.64869894, 118253163.29600377, 135991137.79040432, 156389808.45896497, 179848279.7278097, 206825521.68698114, 237849349.94002828, 273526752.4310325, 314555765.2956874, 361739130.09004045, 415999999.60354644, 478399999.5440784, 550159999.4756901, 632683999.3970436, 727586599.3066001, 836724589.20259, 962233277.5829784, 1106568269.2204251, 1272553509.6034887, 1463436536.044012, 1682952016.4506137, 1935394818.9182055, 2225704041.755936, 2559559648.019326, 2943493595.222225, 3385017634.5055585, 3892770279.681392, 4476685821.6336, 5148188694.87864, 5920416999.1104355, 6808479548.977001, 7829751481.32355, 9004214203.522081, 10354846334.050394, 11908073284.157951, 13694284276.781643, 15748426918.29889, 18110690956.04372, 20827294599.450275, 23951388789.367817, 27544097107.772987, 31675711673.938934, 36427068425.02977, 41891128688.78423, 48174797992.10186, 55401017690.91714, 63711170344.5547, 73267845896.2379, 84258022780.67358, 96896726197.77461, 111431235127.4408, 128145920396.5569, 147367808456.04044, 169472979724.44647, 194893926683.11343, 224128015685.58044, 257747218038.41748, 296409300744.1801, 340870695855.80707, 392001300234.1781, 450801495269.3048, 518421719559.70044, 596184977493.6555, 685612724117.7037, 788454632735.3593, 906722827645.6631, 1042731251792.5125, 1199140939561.3892, 1379012080495.5974, 1585863892569.937, 1823743476455.4275, 2097304997923.7415, 2411900747612.3022, 2773685859754.1475, 3189738738717.2695, 3668199549524.8594, 4218429481953.5884, 4851193904246.626, 5578872989883.619, 6415703938366.162, 7378059529121.086, 8484768458489.248, 9757483727262.635, 11221106286352.03, 12904272229304.832, 14839913063700.555, 17065900023255.637, 19625785026743.98, 22569652780755.58, 25955100697868.91, 29848365802549.246, 34325620672931.63, 39474463773871.375, 45395633339952.07, 52204978340944.88, 60035725092086.61, 69041083855899.59, 79397246434284.53, 91306833399427.2, 105002858409341.27, 120753287170742.45, 138866280246353.81, 159696222283306.88, 183650655625802.88, 211198253969673.3, 242877992065124.28, 279309690874892.9, 321206144506126.8, 369387066182045.8, 424795126109352.6, 488514395025755.5, 561791554279618.75, 646060287421561.5, 742969330534795.8, 854414730115015.0, 982576939632267.1, 1129963480577107.2, 1299458002663673.2, 1494376703063224.0, 1718533208522707.5, 1976313189801113.5, 2272760168271280.5, 2613674193511972.0, 3005725322538767.5, 3456584120919582.5, 3975071739057519.5, 4571332499916147.0, 5257032374903569.0, 6045587231139104.0, 6952425315809969.0, 7995289113181464.0, 9194582480158682.0, 1.0573769852182484e+16, 1.2159835330009856e+16, 1.3983810629511332e+16, 1.6081382223938032e+16, 1.8493589557528736e+16, 2.1267627991158044e+16, 2.4457772189831748e+16, 2.8126438018306508e+16, 3.234540372105248e+16, 3.719721427921035e+16, 4.27767964210919e+16, 4.919331588425568e+16, 5.657231326689403e+16, 6.505816025692813e+16, 7.481688429546734e+16, 8.603941693978744e+16, 9.894532948075555e+16, 1.1378712890286886e+17, 1.3085519823829918e+17, 1.5048347797404406e+17, 1.7305599967015066e+17, 1.9901439962067325e+17, 2.288665595637742e+17, 2.6319654349834032e+17, 3.026760250230913e+17, 3.48077428776555e+17, 4.002890430930382e+17, 4.603323995569939e+17, 5.29382259490543e+17, 6.087895984141244e+17, 7.00108038176243e+17, 8.051242439026793e+17, 9.258928804880812e+17, 1.0647768125612933e+18, 1.224493334445487e+18, 1.4081673346123103e+18, 1.6193924348041567e+18, 1.8623013000247798e+18, 2.1416464950284966e+18, 2.462893469282771e+18, 2.8323274896751867e+18, 3.257176613126464e+18, 3.7457531050954337e+18, 4.3076160708597484e+18, 4.95375848148871e+18, 5.696822253712016e+18, 6.551345591768818e+18, 7.53404743053414e+18, 8.66415454511426e+18, 9.963777726881399e+18, 1.1458344385913608e+19, 1.3177096043800648e+19, 1.5153660450370744e+19, 1.7426709517926355e+19, 2.0040715945615307e+19, 2.30468233374576e+19, 2.650384683807624e+19, 3.047942386378767e+19, 3.505133744335582e+19, 4.030903805985919e+19, 4.635539376883806e+19, 5.330870283416377e+19, 6.130500825928833e+19, 7.0500759498181575e+19, 8.10758734229088e+19, 9.323725443634512e+19, 1.0722284260179688e+20, 1.233062689920664e+20, 1.4180220934087634e+20, 1.6307254074200778e+20, 1.8753342185330894e+20, 2.1566343513130526e+20, 2.4801295040100103e+20, 2.8521489296115116e+20, 3.2799712690532385e+20, 3.7719669594112236e+20, 4.337762003322907e+20, 4.988426303821342e+20, 5.7366902493945437e+20, 6.597193786803724e+20, 7.586772854824282e+20, 8.724788783047925e+20, 1.0033507100505113e+21, 1.1538533165580878e+21, 1.326931314041801e+21, 1.5259710111480708e+21, 1.7548666628202813e+21, 2.0180966622433234e+21, 2.3208111615798217e+21, 2.668932835816795e+21, 3.0692727611893135e+21, 3.529663675367711e+21, 4.059113226672867e+21, 4.667980210673796e+21, 5.368177242274866e+21, 6.173403828616095e+21, 7.099414402908508e+21, 8.164326563344784e+21, 9.388975547846502e+21, 1.0797321880023475e+22, 1.2416920162026996e+22, 1.4279458186331043e+22, 1.64213769142807e+22, 1.8884583451422802e+22, 2.171727096913622e+22, 2.497486161450665e+22, 2.872109085668265e+22, 3.3029254485185042e+22, 3.798364265796279e+22, 4.368118905665721e+22, 5.0233367415155795e+22, 5.7768372527429155e+22, 6.643362840654352e+22, 7.639867266752504e+22, 8.78584735676538e+22, 1.0103724460280185e+23, 1.1619283129322213e+23, 1.3362175598720545e+23, 1.5366501938528623e+23, 1.7671477229307915e+23, 2.0322198813704103e+23, 2.3370528635759717e+23, 2.687610793112367e+23, 3.090752412079222e+23, 3.554365273891105e+23, 4.0875200649747705e+23, 4.700648074720986e+23, 5.405745285929133e+23, 6.216607078818502e+23, 7.149098140641278e+23, 8.221462861737468e+23, 9.454682290998088e+23, 1.0872884634647801e+24, 1.250381732984497e+24, 1.4379389929321714e+24, 1.653629841871997e+24, 1.9016743181527962e+24, 2.1869254658757156e+24, 2.5149642857570727e+24, 2.8922089286206334e+24, 3.326040267913728e+24, 3.824946308100787e+24, 4.3986882543159046e+24, 5.05849149246329e+24, 5.817265216332783e+24, 6.6898549987827e+24, 7.693333248600105e+24, 8.84733323589012e+24, 1.0174433221273637e+25, 1.1700598204464681e+25, 1.3455687935134384e+25, 1.547404112540454e+25, 1.779514729421522e+25, 2.04644193883475e+25, 2.353408229659962e+25, 2.7064194641089563e+25, 3.1123823837253e+25, 3.5792397412840944e+25, 4.116125702476708e+25, 4.733544557848214e+25, 5.443576241525446e+25, 6.260112677754262e+25, 7.199129579417401e+25, 8.27899901633001e+25, 9.52084886877951e+25, 1.0948976199096437e+26, 1.25913226289609e+26, 1.4480021023305035e+26, 1.665202417680079e+26, 1.9149827803320907e+26, 2.202230197381904e+26, 2.5325647269891895e+26, 2.9124494360375676e+26, 3.349316851443203e+26, 3.8517143791596826e+26, 4.429471536033635e+26, 5.09389226643868e+26, 5.857976106404481e+26, 6.736672522365153e+26, 7.747173400719924e+26, 8.909249410827912e+26, 1.0245636822452099e+27, 1.1782482345819913e+27, 1.35498546976929e+27, 1.5582332902346833e+27, 1.7919682837698857e+27, 2.0607635263353683e+27, 2.3698780552856732e+27, 2.725359763578524e+27, 3.1341637281153025e+27, 3.6042882873325974e+27, 4.1449315304324867e+27, 4.7666712599973594e+27, 5.481671948996963e+27, 6.303922741346507e+27, 7.249511152548482e+27, 8.336937825430755e+27, 9.587478499245366e+27, 1.102560027413217e+28, 1.2679440315251995e+28, 1.4581356362539794e+28, 1.6768559816920761e+28, 1.9283843789458875e+28, 2.2176420357877703e+28, 2.5502883411559357e+28, 2.932831592329326e+28, 3.3727563311787245e+28, 3.8786697808555327e+28, 4.460470247983863e+28, 5.129540785181441e+28, 5.8989719029586575e+28, 6.783817688402455e+28, 7.801390341662823e+28, 8.971598892912247e+28, 1.0317338726849081e+29, 1.1864939535876443e+29, 1.3644680466257909e+29, 1.5691382536196593e+29, 1.8045089916626083e+29, 2.0751853404119993e+29, 2.3864631414737988e+29, 2.7444326126948684e+29, 3.1560975045990984e+29, 3.629512130288963e+29, 4.173938949832307e+29, 4.800029792307153e+29, 5.520034261153225e+29, 6.348039400326208e+29, 7.300245310375139e+29, 8.39528210693141e+29, 9.65457442297112e+29, 1.1102760586416787e+30, 1.2768174674379305e+30, 1.46834008755362e+30, 1.6885911006866628e+30, 1.941879765789662e+30, 2.2331617306581113e+30, 2.568135990256828e+30, 2.9533563887953516e+30, 3.396359847114654e+30, 3.905813824181852e+30, 4.491685897809129e+30, 5.165438782480498e+30, 5.940254599852573e+30, 6.831292789830458e+30, 7.855986708305026e+30, 9.034384714550779e+30, 1.0389542421733396e+31, 1.1947973784993405e+31, 1.3740169852742412e+31, 1.5801195330653773e+31, 1.817137463025184e+31, 2.0897080824789613e+31, 2.4031642948508052e+31, 2.7636389390784257e+31, 3.1781847799401893e+31, 3.6549124969312175e+31, 4.2031493714709e+31, 4.833621777191535e+31, 5.558665043770264e+31, 6.392464800335803e+31, 7.3513345203861735e+31, 8.454034698444098e+31, 9.722139903210713e+31, 1.1180460888692319e+32, 1.2857530021996165e+32, 1.478615952529559e+32, 1.7004083454089925e+32, 1.9554695972203414e+32, 2.2487900368033926e+32, 2.586108542323901e+32, 2.974024823672486e+32, 3.420128547223359e+32, 3.933147829306862e+32, 4.523120003702891e+32, 5.2015880042583246e+32, 5.981826204897073e+32, 6.879100135631634e+32, 7.910965155976377e+32, 9.097609929372833e+32, 1.0462251418778757e+33, 1.2031589131595571e+33, 1.3836327501334904e+33, 1.591177662653514e+33, 1.8298543120515409e+33, 2.104332458859272e+33, 2.4199823276881623e+33, 2.7829796768413863e+33, 3.200426628367594e+33, 3.6804906226227334e+33, 4.232564216016143e+33, 4.867448848418564e+33, 5.597566175681348e+33, 6.437201102033549e+33, 7.402781267338582e+33, 8.513198457439368e+33, 9.790178226055273e+33, 1.1258704959963564e+34, 1.2947510703958096e+34, 1.488963730955181e+34, 1.712308290598458e+34, 1.9691545341882266e+34, 2.2645277143164603e+34, 2.604206871463929e+34, 2.994837902183518e+34, 3.4440635875110457e+34, 3.960673125637702e+34, 4.554774094483357e+34, 5.237990208655861e+34, 6.023688739954239e+34, 6.927242050947375e+34, 7.96632835858948e+34, 9.161277612377902e+34, 1.0535469254234585e+35, 1.2115789642369772e+35, 1.3933158088725236e+35, 1.6023131802034022e+35, 1.8426601572339122e+35, 2.119059180818999e+35, 2.4369180579418488e+35, 2.8024557666331258e+35, 3.2228241316280944e+35, 3.706247751372308e+35, 4.262184914078154e+35, 4.901512651189877e+35, 5.636739548868358e+35, 6.482250481198611e+35, 7.454588053378403e+35, 8.572776261385162e+35, 9.858692700592935e+35, 1.1337496605681875e+36, 1.3038121096534156e+36, 1.499383926101428e+36, 1.7242915150166418e+36, 1.982935242269138e+36, 2.2803755286095084e+36]
+ benchmarks/json-data/twitter1.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"80430860","profile_image_url":"http://a2.twimg.com/profile_images/536455139/icon32_normal.png","created_at":"Wed, 26 Jan 2011 07:07:02 +0000","from_user":"kazu_yamamoto","id_str":"30159761706061824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell Server Pages \u3063\u3066\u3001\u307e\u3060\u7d9a\u3044\u3066\u3044\u305f\u306e\u304b\uff01","id":30159761706061824,"from_user_id":80430860,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30159761706061824,"since_id":0,"refresh_url":"?since_id=30159761706061824&q=haskell","next_page":"?page=2&max_id=30159761706061824&rpp=1&q=haskell","results_per_page":1,"page":1,"completed_in":0.012606,"since_id_str":"0","max_id_str":"30159761706061824","query":"haskell"}
+ benchmarks/json-data/twitter10.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=10&q=haskell","results_per_page":10,"page":1,"completed_in":0.012714,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}
+ benchmarks/json-data/twitter100.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"3646730","profile_image_url":"http://a3.twimg.com/profile_images/404973767/avatar_normal.jpg","created_at":"Wed, 26 Jan 2011 04:35:07 +0000","from_user":"nicolaslara","id_str":"30121530767708160","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 Python y Clojure. Obviamente son diferentes, y cada uno tiene sus ventajas y desventajas. De Haskell faltar\u00eda pattern matching","id":30121530767708160,"from_user_id":3646730,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"5912444","profile_image_url":"http://a2.twimg.com/profile_images/546261026/ssf0xg11_normal.jpg","created_at":"Wed, 26 Jan 2011 00:45:45 +0000","from_user":"shelarcy","id_str":"30063810773516288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @Hackage: download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30063810773516288,"from_user_id":5912444,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:41:00 +0000","from_user":"kudzu_naoki","id_str":"30062613287141376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u9b54\u6cd5Haskell\u5c11\u5973\u5019\u88dc\u3092\u63a2\u3059\u306e\u3082\u5927\u5909\u306a\u3093\u3060","id":30062613287141376,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:40:25 +0000","from_user":"omasanori","id_str":"30062465656033280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5Haskell\u5c11\u5973\u306e\u4e00\u65e5\u306fGHC HEAD\u306e\u30d3\u30eb\u30c9\u304b\u3089\u59cb\u307e\u308b","id":30062465656033280,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:37:12 +0000","from_user":"omasanori","id_str":"30061656331526144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061656331526144,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:35:42 +0000","from_user":"kudzu_naoki","id_str":"30061282665168896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061282665168896,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"1631333","profile_image_url":"http://a1.twimg.com/profile_images/81268862/profile300_normal.jpg","created_at":"Wed, 26 Jan 2011 00:30:02 +0000","from_user":"qnighy","id_str":"30059855884582913","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30059855884582913,"from_user_id":1631333,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9093754","profile_image_url":"http://a1.twimg.com/profile_images/99435906/PHD_3d_col_blk_normal.jpg","created_at":"Wed, 26 Jan 2011 00:26:20 +0000","from_user":"phdwine","id_str":"30058925516656640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Last weekend of Tri Nations Tasting with PHD wines at Haskell Vineyards. Hope you didn't miss the Pinot Noir tasting last week !","id":30058925516656640,"from_user_id":9093754,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"2119923","profile_image_url":"http://a2.twimg.com/profile_images/1096701078/djayprofile_normal.jpg","created_at":"Wed, 26 Jan 2011 00:21:14 +0000","from_user":"djay75","id_str":"30057639543050240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30057639543050240,"from_user_id":2119923,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"134323731","profile_image_url":"http://a2.twimg.com/profile_images/1225818824/IMG00518-20110125-1547_normal.jpg","created_at":"Wed, 26 Jan 2011 00:19:30 +0000","from_user":"PrinceOfBrkeley","id_str":"30057205554216960","metadata":{"result_type":"recent"},"to_user_id":167093027,"text":"@PayThaPrince go to haskell.","id":30057205554216960,"from_user_id":134323731,"to_user":"PayThaPrince","geo":null,"iso_language_code":"en","to_user_id_str":"167093027","source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"705857","profile_image_url":"http://a1.twimg.com/profile_images/429483912/ben_twitter_normal.jpg","created_at":"Wed, 26 Jan 2011 00:03:28 +0000","from_user":"bennadel","id_str":"30053166972141569","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Using #Homebrew to install Haskell - the last of the Seven Languages (in Seven Weeks) http://bit.ly/eA9Cv1 This has been some journey.","id":30053166972141569,"from_user_id":705857,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"251466","profile_image_url":"http://a2.twimg.com/profile_images/1194100934/pass_normal.jpg","created_at":"Wed, 26 Jan 2011 00:02:54 +0000","from_user":"simonszu","id_str":"30053025502466048","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Ouh yeah! Ich werde doch produktiv sein, diese Semesterferien. Ich werde funktional Programmieren lernen. #haskell, Baby.","id":30053025502466048,"from_user_id":251466,"geo":null,"iso_language_code":"de","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"357786","profile_image_url":"http://a0.twimg.com/profile_images/612044841/FM_2010_normal.jpg","created_at":"Tue, 25 Jan 2011 23:59:13 +0000","from_user":"diligiant","id_str":"30052100973006848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @paulrbrown: "...we only discovered a single bug after compilation." (http://t.co/K0wlEYz) #haskell","id":30052100973006848,"from_user_id":357786,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"101597523","profile_image_url":"http://a1.twimg.com/profile_images/1206183256/2010-12-12-204902_normal.jpg","created_at":"Tue, 25 Jan 2011 23:54:46 +0000","from_user":"wlad_kent","id_str":"30050977964892160","metadata":{"result_type":"recent"},"to_user_id":86297184,"text":"@Nilson_Neto Isso eh bem basico. quando vc estiver estudando recurs\u00e3o em Haskell, ai vc vai ver oq eh papo de nerd - kkk - 1\u00ba periodo isso.","id":30050977964892160,"from_user_id":101597523,"to_user":"Nilson_Neto","geo":null,"iso_language_code":"pt","to_user_id_str":"86297184","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 23:51:22 +0000","from_user":"listwarenet","id_str":"30050123383832577","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84336-haskell-cafe-monomorphic-let-bindings-and-darcs.html Haskell-cafe - Monomorph","id":30050123383832577,"from_user_id":144546280,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"5776901","profile_image_url":"http://a0.twimg.com/profile_images/472682157/lucabw_normal.JPG","created_at":"Tue, 25 Jan 2011 23:48:40 +0000","from_user":"lsbardel","id_str":"30049446469312512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Very interesting technology stack these guys use http://bit.ly/ghAjS7 #python #redis #haskell","id":30049446469312512,"from_user_id":5776901,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"3005901","profile_image_url":"http://a0.twimg.com/profile_images/278943006/Lone_Pine_Peak_-_Peter_200x200_normal.jpg","created_at":"Tue, 25 Jan 2011 23:45:48 +0000","from_user":"pmonks","id_str":"30048721110573056","metadata":{"result_type":"recent"},"to_user_id":203834278,"text":"@techielicous Haskell: http://bit.ly/gy3oFi ;-)","id":30048721110573056,"from_user_id":3005901,"to_user":"techielicous","geo":null,"iso_language_code":"en","to_user_id_str":"203834278","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"162697074","profile_image_url":"http://a2.twimg.com/profile_images/826205838/ryan3_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:47 +0000","from_user":"TheRonaldMCD","id_str":"30048468781244416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Aldi Food Market (4122 Gaston Ave, Haskell, Dallas) http://4sq.com/ekqRY7","id":30048468781244416,"from_user_id":162697074,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"203834278","profile_image_url":"http://a0.twimg.com/profile_images/1223375080/me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:04 +0000","from_user":"techielicous","id_str":"30048286589067264","metadata":{"result_type":"recent"},"to_user_id":3005901,"text":"@pmonks I was thinking Haskell or Scheme","id":30048286589067264,"from_user_id":203834278,"to_user":"pmonks","geo":null,"iso_language_code":"en","to_user_id_str":"3005901","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"537690","profile_image_url":"http://a3.twimg.com/profile_images/45665122/nushiostamp_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:14 +0000","from_user":"nushio","id_str":"30046818658164737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u3046\u3044\u3084\u5951\u7d04\u306b\u3088\u308b\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0\u3068\u304b\u3042\u3063\u305f\u306a\u3002Haskell\u306a\u3093\u304b\u3088\u308a\u3042\u3063\u3061\u306e\u65b9\u304c\u9b54\u6cd5\u5c11\u5973\u547c\u3070\u308f\u308a\u306b\u3075\u3055\u308f\u3057\u3044\u3002","id":30046818658164737,"from_user_id":537690,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"181192","profile_image_url":"http://a2.twimg.com/profile_images/1089890701/q530888600_9828_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:03 +0000","from_user":"aodag","id_str":"30046772223016960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046772223016960,"from_user_id":181192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"5886055","profile_image_url":"http://a3.twimg.com/profile_images/85531669/ichi_normal.jpg","created_at":"Tue, 25 Jan 2011 23:37:53 +0000","from_user":"kanaya","id_str":"30046729243983873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9e97\u3057\u3044\u3002\u201c@omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d\u201d","id":30046729243983873,"from_user_id":5886055,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/app/twitter/id333903271?mt=8" rel="nofollow">Twitter for iPad</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Tue, 25 Jan 2011 23:36:26 +0000","from_user":"omasanori","id_str":"30046367187476481","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046367187476481,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"1659992","profile_image_url":"http://a1.twimg.com/profile_images/504488750/1_normal.jpg","created_at":"Tue, 25 Jan 2011 23:16:13 +0000","from_user":"finalfusion","id_str":"30041278544609280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30041278544609280,"from_user_id":1659992,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"272513","profile_image_url":"http://a2.twimg.com/profile_images/320244078/Mike_Painting2_normal.png","created_at":"Tue, 25 Jan 2011 23:05:09 +0000","from_user":"mikehadlow","id_str":"30038492373319680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just written the same simple program in C#, F# and Haskell: 18, 12 and 9 LoC respectively. And I'm much better at C# than F# or Haskell.","id":30038492373319680,"from_user_id":272513,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"89393264","profile_image_url":"http://a0.twimg.com/profile_images/1169486472/020_portland_me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:01:28 +0000","from_user":"newsportlandme","id_str":"30037564589084673","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Governor's Choice to Run Maine DOC Under Scrutiny - MPBN: State Rep. Anne Haskell, a Portland Democrat, says Mai... http://bit.ly/fO30gC","id":30037564589084673,"from_user_id":89393264,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"38138","profile_image_url":"http://a3.twimg.com/profile_images/1212565885/Screen_shot_2011-01-11_at_5.28.47_PM_normal.png","created_at":"Tue, 25 Jan 2011 22:59:55 +0000","from_user":"michaelneale","id_str":"30037174615281664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The haskell EvilMangler http://t.co/P2Tls7J","id":30037174615281664,"from_user_id":38138,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"45692","profile_image_url":"http://a3.twimg.com/profile_images/1177741507/dogkarno_r_normal.jpg","created_at":"Tue, 25 Jan 2011 22:45:06 +0000","from_user":"karno","id_str":"30033448286552064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3063\u3066\u95a2\u6570\u306b\u30ab\u30ec\u30fc\u7c89\u3076\u3061\u8fbc\u3080\u3068\u304b\u306a\u3093\u3068\u304b","id":30033448286552064,"from_user_id":45692,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://yubitter.com/" rel="nofollow">yubitter</a>"},{"from_user_id_str":"27605","profile_image_url":"http://a2.twimg.com/profile_images/15826632/meron_normal.jpg","created_at":"Tue, 25 Jan 2011 22:44:23 +0000","from_user":"celeron1ghz","id_str":"30033268761956352","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30033268761956352,"from_user_id":27605,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:43:30 +0000","from_user":"necocen","id_str":"30033044035346432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3042Haskell\u77e5\u3089\u3093\u3057\u306d","id":30033044035346432,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:42:54 +0000","from_user":"necocen","id_str":"30032894856531968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30032894856531968,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"10821270","profile_image_url":"http://a0.twimg.com/profile_images/1195474259/Salto_Marlon_normal.jpg","created_at":"Tue, 25 Jan 2011 22:35:09 +0000","from_user":"jjedMoriAnktah","id_str":"30030942106025984","metadata":{"result_type":"recent"},"to_user_id":null,"text":""A Haskell program that outputs a Python program that outputs a Ruby program that outputs the original Haskell program" http://is.gd/E6Julu","id":30030942106025984,"from_user_id":10821270,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"7554762","profile_image_url":"http://a0.twimg.com/profile_images/100515212/ajay-photo_normal.jpg","created_at":"Tue, 25 Jan 2011 22:34:30 +0000","from_user":"comatose_kid","id_str":"30030780205899776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @bumptech: Bump Dev Blog - Why we use Haskell at Bump http://devblog.bu.mp/haskell-at-bump","id":30030780205899776,"from_user_id":7554762,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"148474705","profile_image_url":"http://a0.twimg.com/profile_images/1119234716/fur_hat_-_gilbeys_vodka_-_life_-_11-30-1962_normal.JPG","created_at":"Tue, 25 Jan 2011 22:29:19 +0000","from_user":"landmvintage","id_str":"30029476003840000","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @faerymoongodess: Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30029476003840000,"from_user_id":148474705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"37715508","profile_image_url":"http://a1.twimg.com/profile_images/1207891411/ballerina_normal.jpg","created_at":"Tue, 25 Jan 2011 22:24:52 +0000","from_user":"faerymoongodess","id_str":"30028356326002688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30028356326002688,"from_user_id":37715508,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 22:17:16 +0000","from_user":"Hackage","id_str":"30026442456694784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"base16-bytestring 0.1.0.0, added by BryanOSullivan: Fast base16 (hex) encoding and deconding for ByteStrings http://bit.ly/eu75TN","id":30026442456694784,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"199750997","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 22:12:07 +0000","from_user":"benreads","id_str":"30025146991382528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Writing Systems Software in a Functional Language -- brief, but fun. I want to see how well they can make Systems Haskell perform at scale.","id":30025146991382528,"from_user_id":199750997,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"35359797","profile_image_url":"http://a1.twimg.com/profile_images/1173453785/48893_521140819_1896062_q_normal.jpg","created_at":"Tue, 25 Jan 2011 22:09:45 +0000","from_user":"jcawthorne1","id_str":"30024549265309696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just saw Jeff Haskell give the middle finger!! Lol awesome","id":30024549265309696,"from_user_id":35359797,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Tue, 25 Jan 2011 22:06:44 +0000","from_user":"goodfox","id_str":"30023790381498369","metadata":{"result_type":"recent"},"to_user_id":null,"text":"At the Haskell Convocation. (@ Haskell Indian Nations U Auditorium) http://4sq.com/eKKXyn","id":30023790381498369,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"14674418","profile_image_url":"http://a2.twimg.com/profile_images/238230125/IMG_1030-1_normal.jpg","created_at":"Tue, 25 Jan 2011 22:02:31 +0000","from_user":"sanityinc","id_str":"30022731919523840","metadata":{"result_type":"recent"},"to_user_id":371289,"text":"@xshay Haskell's great, but Clojure's similarly lazy in all the ways that matter, and is more practical for day-to-day use.","id":30022731919523840,"from_user_id":14674418,"to_user":"xshay","geo":null,"iso_language_code":"en","to_user_id_str":"371289","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"371289","profile_image_url":"http://a2.twimg.com/profile_images/1113482439/me-brisbane_normal.jpg","created_at":"Tue, 25 Jan 2011 21:58:29 +0000","from_user":"xshay","id_str":"30021714444292096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just made a lazy sequence of prime numbers in haskell. I'm smitten.","id":30021714444292096,"from_user_id":371289,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"199453873","profile_image_url":"http://a3.twimg.com/a/1294785484/images/default_profile_3_normal.png","created_at":"Tue, 25 Jan 2011 21:48:40 +0000","from_user":"stackfeed","id_str":"30019243982454784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Practical Scala reference manual, for searching things like method names: Hello, \n\nInspired by\nHaskell API Searc... http://bit.ly/g4zWZQ","id":30019243982454784,"from_user_id":199453873,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:32 +0000","from_user":"aapnoot","id_str":"30018455189065728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018455189065728,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"aapnoot","id_str":"30018452601180160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30018452601180160,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"Hackage","id_str":"30018451867176960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018451867176960,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"138502705","profile_image_url":"http://a1.twimg.com/profile_images/1083845614/yclogo_normal.gif","created_at":"Tue, 25 Jan 2011 21:45:04 +0000","from_user":"newsyc100","id_str":"30018340839755777","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell improves log processing 4x over Python http://devblog.bu.mp/haskell-at-bump (http://bit.ly/gQxxR8)","id":30018340839755777,"from_user_id":138502705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://news.ycombinator.com" rel="nofollow">newsyc</a>"},{"from_user_id_str":"1578246","profile_image_url":"http://a0.twimg.com/profile_images/59312315/avatar_simpson_small_normal.jpg","created_at":"Tue, 25 Jan 2011 21:43:32 +0000","from_user":"magthe","id_str":"30017953801969665","metadata":{"result_type":"recent"},"to_user_id":null,"text":"New version of download uploaded to #hackage #haskell","id":30017953801969665,"from_user_id":1578246,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://api.supertweet.net" rel="nofollow">MyAuth API Proxy</a>"},{"from_user_id_str":"135838970","profile_image_url":"http://a2.twimg.com/profile_images/1079929891/logo_normal.png","created_at":"Tue, 25 Jan 2011 21:37:51 +0000","from_user":"reward999","id_str":"30016525180084224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Found Great Dane (Main & Haskell- Dallas): We found a great dane. 214-712-0000 http://bit.ly/fQ8iBw","id":30016525180084224,"from_user_id":135838970,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"137719265","profile_image_url":"http://a2.twimg.com/profile_images/1092224079/8__4__normal.jpg","created_at":"Tue, 25 Jan 2011 21:34:22 +0000","from_user":"WeiMatas","id_str":"30015646020411392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Fourth day Rez party Eddie Haskell County in second life \u2013 which took place in cabaret Tadd","id":30015646020411392,"from_user_id":137719265,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://dlvr.it" rel="nofollow">dlvr.it</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 21:33:21 +0000","from_user":"listwarenet","id_str":"30015392571195392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/83889-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Haskell-cafe -","id":30015392571195392,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"}],"max_id":30121530767708160,"since_id":0,"refresh_url":"?since_id=30121530767708160&q=haskell","next_page":"?page=2&max_id=30121530767708160&rpp=100&q=haskell","results_per_page":100,"page":1,"completed_in":1.195569,"since_id_str":"0","max_id_str":"30121530767708160","query":"haskell"}
+ benchmarks/json-data/twitter20.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"166199691","profile_image_url":"http://a2.twimg.com/profile_images/1252958188/38_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"_classicc","id_str":"41191052790603776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"my twitter is actin slow today.","id":41191052790603776,"from_user_id":166199691,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"138835410","profile_image_url":"http://a1.twimg.com/profile_images/1250985094/243321801_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"amereronday","id_str":"41191050307567616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter jail, here i come.","id":41191050307567616,"from_user_id":138835410,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"359548","profile_image_url":"http://a2.twimg.com/profile_images/53612334/don_otvos_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"donnyo","id_str":"41191050110451712","metadata":{"result_type":"recent"},"to_user_id":7074534,"text":"@stlsmallbiz I see there is currently a Twitter promo too....tempting....","id":41191050110451712,"from_user_id":359548,"to_user":"stlsmallbiz","geo":null,"iso_language_code":"en","place":{"id":"82b7b2f97b12261d","type":"poi","full_name":"Yammer Inc, San Francisco"},"to_user_id_str":"7074534","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"122523770","profile_image_url":"http://a0.twimg.com/profile_images/1073533262/11646_1076222405045_1810798478_156114_3663737_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"msBreChan","id_str":"41191049720238080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"so twitter gt spam now -_-","id":41191049720238080,"from_user_id":122523770,"geo":{"type":"Point","coordinates":[35.2213,-80.8276]},"iso_language_code":"en","place":{"id":"4d5ed95f830e9b41","type":"neighborhood","full_name":"Elizabeth, Charlotte"},"to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"229024950","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"NinaMaechik","id_str":"41191047853912064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Glad I can remember my twitter password! LOL! Hugs to Nick from his aunties...","id":41191047853912064,"from_user_id":229024950,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"215545822","profile_image_url":"http://a2.twimg.com/profile_images/1239909540/RTL_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"RightToLaugh","id_str":"41191047371558912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"#Bacon wrapped dates http://bit.ly/hUxVC9 Just like my grandma used to make http://twitter.com/#","id":41191047371558912,"from_user_id":215545822,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217845526","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"TheShoeLooker","id_str":"41191047052804096","metadata":{"result_type":"recent"},"to_user_id":38033240,"text":"@ShoeDazzle love love love to twitter or blog about your deals and shoes!\ntheshoelooker.blogspot.com","id":41191047052804096,"from_user_id":217845526,"to_user":"shoedazzle","geo":null,"iso_language_code":"en","to_user_id_str":"38033240","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"24953438","profile_image_url":"http://a3.twimg.com/profile_images/1181252763/76820_10150100014748783_677998782_7386695_4377006_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"liljermaine32","id_str":"41191046025056256","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter fam I gotta question 4 ya is texas south or midwest #arguments","id":41191046025056256,"from_user_id":24953438,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122451024","profile_image_url":"http://a2.twimg.com/profile_images/1143400129/100706-ETCanada_201134_1__normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"Kim_DEon","id_str":"41191045161164801","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Help @CARE @EvaLongoria and ME use Twitter to change the lives of girls in poverty across the world! Ready? Go to http://TwitChange.com NOW!","id":41191045161164801,"from_user_id":122451024,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128351479","profile_image_url":"http://a3.twimg.com/profile_images/1150198829/Kirby_Photo__edit__normal.JPG","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"TheDaveKirby","id_str":"41191043894493184","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Maybe its time to clean house...MY HOUSE http://bit.ly/ejG22P","id":41191043894493184,"from_user_id":128351479,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"87512773","profile_image_url":"http://a0.twimg.com/profile_images/1252511106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"supportthehood","id_str":"41191043206610946","metadata":{"result_type":"recent"},"to_user_id":2467330,"text":"@eastcoastmp3 #FF it's the way twitter works !!!","id":41191043206610946,"from_user_id":87512773,"to_user":"eastcoastmp3","geo":null,"iso_language_code":"en","to_user_id_str":"2467330","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"149894545","profile_image_url":"http://a0.twimg.com/profile_images/1219334400/patrick_camo_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"suburbpat","id_str":"41191040912330752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I havent had a rib session on twitter in a while.......I wanna Rib with a nigga with alot followers lol","id":41191040912330752,"from_user_id":149894545,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"97749622","profile_image_url":"http://a0.twimg.com/profile_images/1254640781/IMG1633A_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"jrricardosantos","id_str":"41191040547430400","metadata":{"result_type":"recent"},"to_user_id":101017476,"text":"@yofzs pq tirou o CAPS LOCK? kkkk tava bem legal...hehehe eu estou no t\u00e9dio...kkk tbm estou no twitter e msn..aff!!","id":41191040547430400,"from_user_id":97749622,"to_user":"yofzs","geo":null,"iso_language_code":"en","to_user_id_str":"101017476","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94381536","profile_image_url":"http://a1.twimg.com/profile_images/1174777929/41509_100001699300415_3521888_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"DonNieves","id_str":"41191038978752512","metadata":{"result_type":"recent"},"to_user_id":151926400,"text":"@TiiH13 cheira meu ovo, no email, no orkut, no msn, no facebook, no twitter, no skype, no spark, no ICQ e no google talk","id":41191038978752512,"from_user_id":94381536,"to_user":"TiiH13","geo":null,"iso_language_code":"en","to_user_id_str":"151926400","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"211858432","profile_image_url":"http://a3.twimg.com/profile_images/1231906180/JonasBrothers_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"OriginalJBfans","id_str":"41191038328651776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I literally forgot about this twitter... so whats occuring followers?","id":41191038328651776,"from_user_id":211858432,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90317132","profile_image_url":"http://a3.twimg.com/profile_images/1230085056/254101635_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"Just2smooth","id_str":"41191036936126464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wassup twitter","id":41191036936126464,"from_user_id":90317132,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"144771504","profile_image_url":"http://a1.twimg.com/profile_images/1243343836/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"ima_b_b_badman","id_str":"41191036638339072","metadata":{"result_type":"recent"},"to_user_id":null,"text":"i been M.I.A. all day twitter my bad","id":41191036638339072,"from_user_id":144771504,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207922664","profile_image_url":"http://a2.twimg.com/profile_images/1237106108/258356167_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"itsthecarter_","id_str":"41191036013391873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter is a stupid addiction.","id":41191036013391873,"from_user_id":207922664,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"150000649","profile_image_url":"http://a0.twimg.com/profile_images/1237789059/belllaa_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"angelicabrvo","id_str":"41191035707207680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"que hubo twitter? huy que feoxd","id":41191035707207680,"from_user_id":150000649,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"185713003","profile_image_url":"http://a2.twimg.com/profile_images/1191421540/163229_177015295661467_154687431227587_492170_2147500_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"downbytheshores","id_str":"41191033945595905","metadata":{"result_type":"recent"},"to_user_id":null,"text":"follow us on twitter\nwww.twitter.com/downbytheshores http://fb.me/DhDS915e","id":41191033945595905,"from_user_id":185713003,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"}],"max_id":41191052790603776,"since_id":38643906774044672,"refresh_url":"?since_id=41191052790603776&q=twitter","next_page":"?page=2&max_id=41191052790603776&rpp=20&lang=en&q=twitter","results_per_page":20,"page":1,"completed_in":0.128719,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41191052790603776","query":"twitter"}
+ benchmarks/json-data/twitter50.json view
@@ -0,0 +1,1 @@+{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=50&q=haskell","results_per_page":50,"page":1,"completed_in":0.291696,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"}
+ benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hs view
@@ -0,0 +1,72 @@+{-# LANGUAGE CPP #-}+{-# LANGUAGE OverloadedStrings #-}+{-# LANGUAGE MagicHash #-}+{-# LANGUAGE BangPatterns #-}++-- Copyright : Erik de Castro Lopo <erikd@mega-nerd.com>+-- License : BSD3++module Network.Wai.Handler.Warp.ReadInt (+ readInt+ , readInt64+ ) where++-- This function lives in its own file because the MagicHash pragma interacts+-- poorly with the CPP pragma.++import Data.ByteString (ByteString)+import qualified Data.ByteString as S+import Data.Int (Int64)+import GHC.Prim+import GHC.Types+import GHC.Word++{-# INLINE readInt #-}+readInt :: Integral a => ByteString -> a+readInt bs = fromIntegral $ readInt64 bs++-- This function is used to parse the Content-Length field of HTTP headers and+-- is a performance hot spot. It should only be replaced with something+-- significantly and provably faster.+--+-- It needs to be able work correctly on 32 bit CPUs for file sizes > 2G so we+-- use Int64 here and then make a generic 'readInt' that allows conversion to+-- Int and Integer.++{-# NOINLINE readInt64 #-}+readInt64 :: ByteString -> Int64+readInt64 bs = S.foldl' (\ !i !c -> i * 10 + fromIntegral (mhDigitToInt c)) 0+ $ S.takeWhile isDigit bs++data Table = Table !Addr#++{-# NOINLINE mhDigitToInt #-}+mhDigitToInt :: Word8 -> Int+#if MIN_VERSION_base(4,16,0)+mhDigitToInt (W8# i) = I# (word2Int# (word8ToWord# (indexWord8OffAddr# addr (word2Int# (word8ToWord# i)))))+#else+mhDigitToInt (W8# i) = I# (word2Int# (indexWord8OffAddr# addr (word2Int# i)))+#endif+ where+ !(Table addr) = table+ table :: Table+ table = Table+ "\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x01\x02\x03\x04\x05\x06\x07\x08\x09\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\+ \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00"#++isDigit :: Word8 -> Bool+isDigit w = w >= 48 && w <= 57
+ benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hs view
@@ -0,0 +1,172 @@+{-# LANGUAGE DeriveDataTypeable #-}+{-# LANGUAGE OverloadedStrings #-}+{-# LANGUAGE BangPatterns #-}++module Network.Wai.Handler.Warp.RequestHeader (+ parseHeaderLines+ , parseByteRanges+ ) where++import Control.Exception (Exception, throwIO)+import Control.Monad (when)+import Data.Typeable (Typeable)+import qualified Data.ByteString as S+import qualified Data.ByteString.Char8 as B (unpack, readInteger)+import Data.ByteString.Internal (ByteString(..), memchr)+import qualified Data.CaseInsensitive as CI+import Data.Word (Word8)+import Foreign.ForeignPtr (withForeignPtr)+import Foreign.Ptr (Ptr, plusPtr, minusPtr, nullPtr)+import Foreign.Storable (peek)+import qualified Network.HTTP.Types as H+-- import Network.Wai.Handler.Warp.Types+import qualified Network.HTTP.Types.Header as HH+-- $setup+-- >>> :set -XOverloadedStrings++data InvalidRequest = NotEnoughLines [String]+ | BadFirstLine String+ | NonHttp+ | IncompleteHeaders+ | ConnectionClosedByPeer+ | OverLargeHeader+ deriving (Eq, Typeable, Show)++instance Exception InvalidRequest++----------------------------------------------------------------++parseHeaderLines :: [ByteString]+ -> IO (H.Method+ ,ByteString -- Path+ ,ByteString -- Path, parsed+ ,ByteString -- Query+ ,H.HttpVersion+ ,H.RequestHeaders+ )+parseHeaderLines [] = throwIO $ NotEnoughLines []+parseHeaderLines (firstLine:otherLines) = do+ (method, path', query, httpversion) <- parseRequestLine firstLine+ let path = H.extractPath path'+ hdr = map parseHeader otherLines+ return (method, path', path, query, httpversion, hdr)++----------------------------------------------------------------++-- |+--+-- >>> parseRequestLine "GET / HTTP/1.1"+-- ("GET","/","",HTTP/1.1)+-- >>> parseRequestLine "POST /cgi/search.cgi?key=foo HTTP/1.0"+-- ("POST","/cgi/search.cgi","?key=foo",HTTP/1.0)+-- >>> parseRequestLine "GET "+-- *** Exception: Warp: Invalid first line of request: "GET "+-- >>> parseRequestLine "GET /NotHTTP UNKNOWN/1.1"+-- *** Exception: Warp: Request line specified a non-HTTP request+parseRequestLine :: ByteString+ -> IO (H.Method+ ,ByteString -- Path+ ,ByteString -- Query+ ,H.HttpVersion)+parseRequestLine requestLine@(PS fptr off len) = withForeignPtr fptr $ \ptr -> do+ when (len < 14) $ throwIO baderr+ let methodptr = ptr `plusPtr` off+ limptr = methodptr `plusPtr` len+ lim0 = fromIntegral len++ pathptr0 <- memchr methodptr 32 lim0 -- ' '+ when (pathptr0 == nullPtr || (limptr `minusPtr` pathptr0) < 11) $+ throwIO baderr+ let pathptr = pathptr0 `plusPtr` 1+ lim1 = fromIntegral (limptr `minusPtr` pathptr0)++ httpptr0 <- memchr pathptr 32 lim1 -- ' '+ when (httpptr0 == nullPtr || (limptr `minusPtr` httpptr0) < 9) $+ throwIO baderr+ let httpptr = httpptr0 `plusPtr` 1+ lim2 = fromIntegral (httpptr0 `minusPtr` pathptr)++ checkHTTP httpptr+ !hv <- httpVersion httpptr+ queryptr <- memchr pathptr 63 lim2 -- '?'++ let !method = bs ptr methodptr pathptr0+ !path+ | queryptr == nullPtr = bs ptr pathptr httpptr0+ | otherwise = bs ptr pathptr queryptr+ !query+ | queryptr == nullPtr = S.empty+ | otherwise = bs ptr queryptr httpptr0++ return (method,path,query,hv)+ where+ baderr = BadFirstLine $ B.unpack requestLine+ check :: Ptr Word8 -> Int -> Word8 -> IO ()+ check p n w = do+ w0 <- peek $ p `plusPtr` n+ when (w0 /= w) $ throwIO NonHttp+ checkHTTP httpptr = do+ check httpptr 0 72 -- 'H'+ check httpptr 1 84 -- 'T'+ check httpptr 2 84 -- 'T'+ check httpptr 3 80 -- 'P'+ check httpptr 4 47 -- '/'+ check httpptr 6 46 -- '.'+ httpVersion httpptr = do+ major <- peek $ httpptr `plusPtr` 5+ minor <- peek $ httpptr `plusPtr` 7+ return $ if major == (49 :: Word8) && minor == (49 :: Word8) then+ H.http11+ else+ H.http10+ bs ptr p0 p1 = PS fptr o l+ where+ o = p0 `minusPtr` ptr+ l = p1 `minusPtr` p0++----------------------------------------------------------------++-- |+--+-- >>> parseHeader "Content-Length:47"+-- ("Content-Length","47")+-- >>> parseHeader "Accept-Ranges: bytes"+-- ("Accept-Ranges","bytes")+-- >>> parseHeader "Host: example.com:8080"+-- ("Host","example.com:8080")+-- >>> parseHeader "NoSemiColon"+-- ("NoSemiColon","")++parseHeader :: ByteString -> H.Header+parseHeader s =+ let (k, rest) = S.break (== 58) s -- ':'+ rest' = S.dropWhile (\c -> c == 32 || c == 9) $ S.drop 1 rest+ in (CI.mk k, rest')++parseByteRanges :: S.ByteString -> Maybe HH.ByteRanges+parseByteRanges bs1 = do+ bs2 <- stripPrefix "bytes=" bs1+ (r, bs3) <- range bs2+ ranges (r:) bs3+ where+ range bs2 =+ case stripPrefix "-" bs2 of+ Just bs3 -> do+ (i, bs4) <- B.readInteger bs3+ Just (HH.ByteRangeSuffix i, bs4)+ Nothing -> do+ (i, bs3) <- B.readInteger bs2+ bs4 <- stripPrefix "-" bs3+ case B.readInteger bs4 of+ Nothing -> Just (HH.ByteRangeFrom i, bs4)+ Just (j, bs5) -> Just (HH.ByteRangeFromTo i j, bs5)+ ranges front bs3 =+ case stripPrefix "," bs3 of+ Nothing -> Just (front [])+ Just bs4 -> do+ (r, bs5) <- range bs4+ ranges (front . (r:)) bs5++ stripPrefix x y+ | x `S.isPrefixOf` y = Just (S.drop (S.length x) y)+ | otherwise = Nothing
+ changelog.md view
@@ -0,0 +1,136 @@+# 0.14.4++* Fix a segmentation fault when built against `text-2.0`+* Restructure project to allow more convenient usage of benchmark suite+* Allow benchmarks to build with GHC 9.2++# 0.14.3++* Support for GHC 9.2.1++# 0.14.2++* Support for GHC 9.2.1++# 0.14.1++* Added `Data.Attoparsec.ByteString.getChunk`.++# 0.14.0++* Added `Data.Attoparsec.ByteString.takeWhileIncluding`.+* Make `Data.Attoparsec.{Text,ByteString}.Lazy.parseOnly` accept lazy input.++# 0.13.2.1++* Improved performance of `Data.Attoparsec.Text.asciiCI`++# 0.13.2.0++* `pure` is now strict in `Position`++# 0.13.1.0++* `runScanner` now correctly returns the final state+ (https://github.com/bos/attoparsec/issues/105).+* `Parser`, `ZeptoT`, `Buffer`, and `More` now expose `Semigroup` instances.+* `Parser`, and `ZeptoT` now expose `MonadFail` instances.++# 0.13.0.2++* Restore the fast specialised character set implementation for Text+* Move testsuite from test-framework to tasty+* Performance optimization of takeWhile and takeWhile1++# 0.13.0.1++* Fixed a bug in the implementations of inClass and notInClass for+ Text (https://github.com/bos/attoparsec/issues/103)++# 0.13.0.0++* Made the parser type in the Zepto module a monad transformer+ (needed by aeson's string unescaping parser).++# 0.12.1.6++* Fixed a case folding bug in the ByteString version of stringCI.++# 0.12.1.5++* Fixed an indexing bug in the new Text implementation of string,+ reported by Michel Boucey.++# 0.12.1.4++* Fixed a case where the string parser would consume an unnecessary+ amount of input before failing a match, when it could bail much+ earlier (https://github.com/bos/attoparsec/issues/97)++* Added more context to error messages+ (https://github.com/bos/attoparsec/pull/79)++# 0.12.1.3++* Fixed incorrect tracking of Text lengths+ (https://github.com/bos/attoparsec/issues/80)++# 0.12.1.2++* Fixed the incorrect tracking of capacity if the initial buffer was+ empty (https://github.com/bos/attoparsec/issues/75)++# 0.12.1.1++* Fixed a data corruption bug that occurred under some circumstances+ if a buffer grew after prompting for more input+ (https://github.com/bos/attoparsec/issues/74)++# 0.12.1.0++* Now compatible with GHC 7.9++* Reintroduced the Chunk class, used by the parsers package++# 0.12.0.0++* A new internal representation makes almost all real-world parsers+ faster, sometimes by big margins. For example, parsing JSON data+ with aeson is now up to 70% faster. These performance improvements+ also come with reduced memory consumption and some new capabilities.++* The new match combinator gives both the result of a parse and the+ input that it matched.++* The test suite has doubled in size. This made it possible to switch+ to the new internal representation with a decent degree of+ confidence that everything was more or less working.++* The benchmark suite now contains a small family of benchmarks taken+ from real-world uses of attoparsec.++* A few types that ought to have been private now are.++* A few obsolete modules and functions have been marked as deprecated.+ They will be removed from the next major release.++# 0.11.3.0++* New function scientific is compatible with rational, but parses+ integers more efficiently (https://github.com/bos/aeson/issues/198)++# 0.11.2.0++* The new Chunk typeclass allows for some code sharing with Ed+ Kmett's parsers package: http://hackage.haskell.org/package/parsers++* New function runScanner generalises scan to return the final state+ of the scanner as well as the input consumed.++# 0.11.1.0++* New dependency: the scientific package. This allows us to parse+ numbers much more efficiently.++* peekWord8', peekChar': new primitive parsers that allow+ single-character lookahead.
+ examples/Atto_RFC2616.hs view
@@ -0,0 +1,45 @@+{-# LANGUAGE BangPatterns #-}++module Main (main) where++import Control.Applicative+import Control.Exception (bracket)+import Control.Monad (forM_)+import Data.Attoparsec.ByteString+import RFC2616+import System.Environment+import System.IO+import qualified Data.ByteString.Char8 as B++refill :: Handle -> IO B.ByteString+refill h = B.hGet h (80*1024)++listy :: FilePath -> Handle -> IO ()+listy file h = do+ r <- parseWith (refill h) (many request) =<< refill h+ case r of+ Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg+ Done _ reqs -> print (length reqs)++incrementy :: FilePath -> Handle -> IO ()+incrementy file h = go (0::Int) =<< refill h+ where+ go !n is = do+ r <- parseWith (refill h) request is+ case r of+ Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg+ Done bs _req+ | B.null bs -> do+ s <- refill h+ if B.null s+ then print (n+1)+ else go (n+1) s+ | otherwise -> go (n+1) bs++main :: IO ()+main = do+ args <- getArgs+ forM_ args $ \arg ->+ bracket (openFile arg ReadMode) hClose $+ -- listy arg+ incrementy arg
examples/Makefile view
@@ -1,4 +1,4 @@-CC := gcc+CC := cc CFLAGS := -O3 -Wall # To make the code about 6% faster: # CFLAGS += -fwhole-program --combine@@ -12,4 +12,8 @@ clean: rm -f *.hi *.o c-http -vpath %.c $(HOME)/hg/http-parser+http_parser.c: http_parser.h+ curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.c++http_parser.h:+ curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.h
examples/Parsec_RFC2616.hs view
@@ -23,15 +23,16 @@ token = satisfy $ \c -> S.notMember (fromEnum c) set where set = S.fromList . map fromEnum $ ['\0'..'\31'] ++ "()<>@,;:\\\"/[]?={} \t" ++ ['\128'..'\255'] +isHorizontalSpace :: Char -> Bool isHorizontalSpace c = c == ' ' || c == '\t' skipHSpaces :: Stream s m Char => ParsecT s u m () skipHSpaces = skipMany1 (satisfy isHorizontalSpace) data Request = Request {- requestMethod :: String- , requestUri :: String- , requestProtocol :: String+ _requestMethod :: String+ , _requestUri :: String+ , _requestProtocol :: String } deriving (Eq, Ord, Show) requestLine :: Stream s m Char => ParsecT s u m Request@@ -47,8 +48,8 @@ endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ()) data Header = Header {- headerName :: String- , headerValue :: [String]+ _headerName :: String+ , _headerValue :: [String] } deriving (Eq, Ord, Show) messageHeader :: Stream s m Char => ParsecT s u m Header@@ -61,14 +62,16 @@ request :: Stream s m Char => ParsecT s u m (Request, [Header]) request = (,) <$> requestLine <*> many messageHeader <* endOfLine +listy :: FilePath -> IO () listy arg = do r <- parseFromFile (many request) arg case r of Left err -> putStrLn $ arg ++ ": " ++ show err Right rs -> print (length rs) +chunky :: FilePath -> IO () chunky arg = bracket (openFile arg ReadMode) hClose $ \h ->- loop 0 =<< B.hGetContents h+ loop (0::Int) =<< B.hGetContents h where loop !n bs | B.null bs = print n
examples/RFC2616.hs view
@@ -5,86 +5,61 @@ Header(..) , Request(..) , Response(..)- , isToken- , messageHeader , request- , requestLine , response- , responseLine- , lowerHeader- , lookupHeader ) where -import Control.Applicative hiding (many)-import Data.Attoparsec as P-import qualified Data.Attoparsec.Char8 as P8-import Data.Attoparsec.Char8 (char8, endOfLine, isDigit_w8)+import Control.Applicative+import Data.Attoparsec.ByteString as P+import Data.Attoparsec.ByteString.Char8 (char8, endOfLine, isDigit_w8)+import Data.ByteString (ByteString) import Data.Word (Word8)-import qualified Data.ByteString.Char8 as B hiding (map)-import qualified Data.ByteString as B (map)+import Data.Attoparsec.ByteString.Char8 (isEndOfLine, isHorizontalSpace) isToken :: Word8 -> Bool isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w skipSpaces :: Parser ()-skipSpaces = satisfy P8.isHorizontalSpace *> skipWhile P8.isHorizontalSpace+skipSpaces = satisfy isHorizontalSpace *> skipWhile isHorizontalSpace data Request = Request {- requestMethod :: !B.ByteString- , requestUri :: !B.ByteString- , requestVersion :: !B.ByteString+ requestMethod :: ByteString+ , requestUri :: ByteString+ , requestVersion :: ByteString } deriving (Eq, Ord, Show) -httpVersion :: Parser B.ByteString-httpVersion = string "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46)+httpVersion :: Parser ByteString+httpVersion = "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46) requestLine :: Parser Request-requestLine = do- method <- P.takeWhile1 isToken <* char8 ' '- uri <- P.takeWhile1 (/=32) <* char8 ' '- version <- httpVersion <* endOfLine- return $! Request method uri version+requestLine = Request <$> (takeWhile1 isToken <* char8 ' ')+ <*> (takeWhile1 (/=32) <* char8 ' ')+ <*> (httpVersion <* endOfLine) data Header = Header {- headerName :: !B.ByteString- , headerValue :: [B.ByteString]+ headerName :: ByteString+ , headerValue :: [ByteString] } deriving (Eq, Ord, Show) messageHeader :: Parser Header-messageHeader = do- header <- P.takeWhile isToken <* char8 ':' <* skipWhile P8.isHorizontalSpace- body <- takeTill P8.isEndOfLine <* endOfLine- bodies <- many $ skipSpaces *> takeTill P8.isEndOfLine <* endOfLine- return $! Header header (body:bodies)+messageHeader = Header+ <$> (P.takeWhile isToken <* char8 ':' <* skipWhile isHorizontalSpace)+ <*> ((:) <$> (takeTill isEndOfLine <* endOfLine)+ <*> (many $ skipSpaces *> takeTill isEndOfLine <* endOfLine)) request :: Parser (Request, [Header]) request = (,) <$> requestLine <*> many messageHeader <* endOfLine data Response = Response {- responseVersion :: !B.ByteString- , responseCode :: !B.ByteString- , responseMsg :: !B.ByteString+ responseVersion :: ByteString+ , responseCode :: ByteString+ , responseMsg :: ByteString } deriving (Eq, Ord, Show) responseLine :: Parser Response-responseLine = do- version <- httpVersion <* char8 ' '- code <- P.takeWhile isDigit_w8 <* char8 ' '- msg <- P.takeTill P8.isEndOfLine <* endOfLine- return $! Response version code msg+responseLine = Response <$> (httpVersion <* char8 ' ')+ <*> (P.takeWhile isDigit_w8 <* char8 ' ')+ <*> (takeTill isEndOfLine <* endOfLine) response :: Parser (Response, [Header]) response = (,) <$> responseLine <*> many messageHeader <* endOfLine--lowerHeader :: Header -> Header-lowerHeader (Header n v) = Header (B.map toLower n) (map (B.map toLower) v)- where toLower w | w >= 65 && w <= 90 = w + 32- | otherwise = w--lookupHeader :: B.ByteString -> [Header] -> [B.ByteString]-lookupHeader k = go- where- go (Header n v:hs)- | k == n = v- | otherwise = go hs- go _ = []
− examples/TestRFC2616.hs
@@ -1,37 +0,0 @@-{-# LANGUAGE BangPatterns #-}-import RFC2616-import Control.Monad (forM_)-import System.IO-import Control.Exception (bracket)-import System.Environment-import qualified Data.ByteString.Char8 as B-import Data.Attoparsec--refill h = B.hGet h (4*1024)--listy file h = do- r <- parseWith (refill h) (many request) =<< refill h- case r of- Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg- Done _ reqs -> print (length reqs)- -incrementy file h = go 0 =<< refill h- where- go !n is = do- r <- parseWith (refill h) request is- case r of- Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg- Done bs _req- | B.null bs -> do- s <- refill h- if B.null s- then print (n+1)- else go (n+1) s- | otherwise -> go (n+1) bs- -main = do- args <- getArgs- forM_ args $ \arg ->- bracket (openFile arg ReadMode) hClose $- -- listy arg- incrementy arg
examples/rfc2616.c view
@@ -1,21 +1,22 @@ /*- * This is a simple driver for Ryan Dahl's hand-bummed C http-parser- * package. It is intended to read one HTTP request after another- * from a file, nothing more.+ * This is a simple driver for the http-parser package. It is+ * intended to read one HTTP request after another from a file,+ * nothing more. * * For "feature parity" with the Haskell code in RFC2616.hs, we * allocate and populate a simple structure describing each request, * since that's the sort of thing that many real applications would * themselves do and the library doesn't do this for us. *- * For the http-parser source, see http://github.com/ry/http-parser/+ * For the http-parser source, see+ * https://github.com/joyent/http-parser/blob/master/http_parser.c */ /* * Turn off this preprocessor symbol to have the callbacks do nothing * at all, which "improves performance" by about 50%. */-#define LOOK_BUSY+/*#define LOOK_BUSY*/ #include <assert.h> #include <fcntl.h>@@ -27,18 +28,18 @@ #include <unistd.h> #include "http_parser.h"- + struct http_string { size_t len; char value[0]; };- + struct http_header { struct http_string *name; struct http_string *value; struct http_header *next; };- + struct http_request { struct http_string *method; struct http_string *uri;@@ -49,7 +50,7 @@ size_t count; struct http_request req; };- + static void *xmalloc(size_t size) { void *ptr;@@ -78,7 +79,7 @@ *dst = xstrdup(src, len, 0); return; }- + p = xstrdup((*dst)->value, (*dst)->len, len); memcpy(p->value + (*dst)->len, src, len); p->len += len;@@ -98,7 +99,7 @@ static int url(http_parser *p, const char *at, size_t len) { #ifdef LOOK_BUSY- struct data *data = p->data; + struct data *data = p->data; xstrcat(&data->req.uri, at, len); #endif@@ -119,7 +120,7 @@ hdr->name = xstrdup(at, len, 0); hdr->value = NULL; hdr->next = NULL;- + if (data->req.last != NULL) data->req.last->next = hdr; data->req.last = hdr;@@ -150,7 +151,7 @@ free(data->req.method); free(data->req.uri);- + for (hdr = data->req.headers; hdr != NULL; hdr = next) { next = hdr->next; free(hdr->name);@@ -164,7 +165,7 @@ data->req.headers = NULL; data->req.last = NULL; #endif- + /* Bludgeon http_parser into understanding that we really want to * keep parsing after a request that in principle ought to close * the "connection". */@@ -180,16 +181,21 @@ static void parse(const char *path, int fd) { struct data data;+ http_parser_settings s; http_parser p; ssize_t nread; - http_parser_init(&p, HTTP_REQUEST);- p.on_message_begin = begin;- p.on_url = url;- p.on_header_field = header_field;- p.on_header_value = header_value;- p.on_message_complete = complete;+ memset(&s, 0, sizeof(s));+ s.on_message_begin = begin;+ s.on_url = url;+ s.on_header_field = header_field;+ s.on_header_value = header_value;+ s.on_message_complete = complete;+ p.data = &data;++ http_parser_init(&p, HTTP_REQUEST);+ data.count = 0; data.req.method = NULL; data.req.uri = NULL;@@ -202,7 +208,7 @@ nread = read(fd, buf, sizeof(buf)); - np = http_parser_execute(&p, buf, nread);+ np = http_parser_execute(&p, &s, buf, nread); if (np != nread) { fprintf(stderr, "%s: parse failed\n", path); break;
+ internal/Data/Attoparsec/ByteString/Buffer.hs view
@@ -0,0 +1,157 @@+{-# LANGUAGE BangPatterns #-}+-- |+-- Module : Data.Attoparsec.ByteString.Buffer+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : GHC+--+-- An "immutable" buffer that supports cheap appends.+--+-- A Buffer is divided into an immutable read-only zone, followed by a+-- mutable area that we've preallocated, but not yet written to.+--+-- We overallocate at the end of a Buffer so that we can cheaply+-- append. Since a user of an existing Buffer cannot see past the end+-- of its immutable zone into the data that will change during an+-- append, this is safe.+--+-- Once we run out of space at the end of a Buffer, we do the usual+-- doubling of the buffer size.+--+-- The fact of having a mutable buffer really helps with performance,+-- but it does have a consequence: if someone misuses the Partial API+-- that attoparsec uses by calling the same continuation repeatedly+-- (which never makes sense in practice), they could overwrite data.+--+-- Since the API *looks* pure, it should *act* pure, too, so we use+-- two generation counters (one mutable, one immutable) to track the+-- number of appends to a mutable buffer. If the counters ever get out+-- of sync, someone is appending twice to a mutable buffer, so we+-- duplicate the entire buffer in order to preserve the immutability+-- of its older self.+--+-- While we could go a step further and gain protection against API+-- abuse on a multicore system, by use of an atomic increment+-- instruction to bump the mutable generation counter, that would be+-- very expensive, and feels like it would also be in the realm of the+-- ridiculous. Clients should never call a continuation more than+-- once; we lack a linear type system that could enforce this; and+-- there's only so far we should go to accommodate broken uses.++module Data.Attoparsec.ByteString.Buffer+ (+ Buffer+ , buffer+ , unbuffer+ , pappend+ , length+ , unsafeIndex+ , substring+ , unsafeDrop+ ) where++import Control.Exception (assert)+import Data.ByteString.Internal (ByteString(..), memcpy, nullForeignPtr)+import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)+import Data.Attoparsec.Internal.Compat+import Data.List (foldl1')+import Data.Monoid as Mon (Monoid(..))+import Data.Semigroup (Semigroup(..))+import Data.Word (Word8)+import Foreign.ForeignPtr (ForeignPtr, withForeignPtr)+import Foreign.Ptr (castPtr, plusPtr)+import Foreign.Storable (peek, peekByteOff, poke, sizeOf)+import GHC.ForeignPtr (mallocPlainForeignPtrBytes)+import Prelude hiding (length)++-- If _cap is zero, this buffer is empty.+data Buffer = Buf {+ _fp :: {-# UNPACK #-} !(ForeignPtr Word8)+ , _off :: {-# UNPACK #-} !Int+ , _len :: {-# UNPACK #-} !Int+ , _cap :: {-# UNPACK #-} !Int+ , _gen :: {-# UNPACK #-} !Int+ }++instance Show Buffer where+ showsPrec p = showsPrec p . unbuffer++-- | The initial 'Buffer' has no mutable zone, so we can avoid all+-- copies in the (hopefully) common case of no further input being fed+-- to us.+buffer :: ByteString -> Buffer+buffer bs = withPS bs $ \fp off len -> Buf fp off len len 0++unbuffer :: Buffer -> ByteString+unbuffer (Buf fp off len _ _) = mkPS fp off len++instance Semigroup Buffer where+ (Buf _ _ _ 0 _) <> b = b+ a <> (Buf _ _ _ 0 _) = a+ buf <> (Buf fp off len _ _) = append buf fp off len++instance Monoid Buffer where+ mempty = Buf nullForeignPtr 0 0 0 0++ mappend = (<>)++ mconcat [] = Mon.mempty+ mconcat xs = foldl1' mappend xs++pappend :: Buffer -> ByteString -> Buffer+pappend (Buf _ _ _ 0 _) bs = buffer bs+pappend buf bs = withPS bs $ \fp off len -> append buf fp off len++append :: Buffer -> ForeignPtr a -> Int -> Int -> Buffer+append (Buf fp0 off0 len0 cap0 gen0) !fp1 !off1 !len1 =+ inlinePerformIO . withForeignPtr fp0 $ \ptr0 ->+ withForeignPtr fp1 $ \ptr1 -> do+ let genSize = sizeOf (0::Int)+ newlen = len0 + len1+ gen <- if gen0 == 0+ then return 0+ else peek (castPtr ptr0)+ if gen == gen0 && newlen <= cap0+ then do+ let newgen = gen + 1+ poke (castPtr ptr0) newgen+ memcpy (ptr0 `plusPtr` (off0+len0))+ (ptr1 `plusPtr` off1)+ (fromIntegral len1)+ return (Buf fp0 off0 newlen cap0 newgen)+ else do+ let newcap = newlen * 2+ fp <- mallocPlainForeignPtrBytes (newcap + genSize)+ withForeignPtr fp $ \ptr_ -> do+ let ptr = ptr_ `plusPtr` genSize+ newgen = 1+ poke (castPtr ptr_) newgen+ memcpy ptr (ptr0 `plusPtr` off0) (fromIntegral len0)+ memcpy (ptr `plusPtr` len0) (ptr1 `plusPtr` off1)+ (fromIntegral len1)+ return (Buf fp genSize newlen newcap newgen)++length :: Buffer -> Int+length (Buf _ _ len _ _) = len+{-# INLINE length #-}++unsafeIndex :: Buffer -> Int -> Word8+unsafeIndex (Buf fp off len _ _) i = assert (i >= 0 && i < len) .+ inlinePerformIO . withForeignPtr fp $ flip peekByteOff (off+i)+{-# INLINE unsafeIndex #-}++substring :: Int -> Int -> Buffer -> ByteString+substring s l (Buf fp off len _ _) =+ assert (s >= 0 && s <= len) .+ assert (l >= 0 && l <= len-s) $+ mkPS fp (off+s) l+{-# INLINE substring #-}++unsafeDrop :: Int -> Buffer -> ByteString+unsafeDrop s (Buf fp off len _ _) =+ assert (s >= 0 && s <= len) $+ mkPS fp (off+s) (len-s)+{-# INLINE unsafeDrop #-}
+ internal/Data/Attoparsec/ByteString/FastSet.hs view
@@ -0,0 +1,112 @@+{-# LANGUAGE BangPatterns, MagicHash #-}++-----------------------------------------------------------------------------+-- |+-- Module : Data.Attoparsec.ByteString.FastSet+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : unknown+--+-- Fast set membership tests for 'Word8' and 8-bit 'Char' values. The+-- set representation is unboxed for efficiency. For small sets, we+-- test for membership using a binary search. For larger sets, we use+-- a lookup table.+--+-----------------------------------------------------------------------------+module Data.Attoparsec.ByteString.FastSet+ (+ -- * Data type+ FastSet+ -- * Construction+ , fromList+ , set+ -- * Lookup+ , memberChar+ , memberWord8+ -- * Debugging+ , fromSet+ -- * Handy interface+ , charClass+ ) where++import Data.Bits ((.&.), (.|.), unsafeShiftL)+import Foreign.Storable (peekByteOff, pokeByteOff)+import GHC.Exts (Int(I#), iShiftRA#)+import GHC.Word (Word8)+import qualified Data.ByteString as B+import qualified Data.ByteString.Char8 as B8+import qualified Data.ByteString.Internal as I+import qualified Data.ByteString.Unsafe as U++data FastSet = Sorted { fromSet :: !B.ByteString }+ | Table { fromSet :: !B.ByteString }+ deriving (Eq, Ord)++instance Show FastSet where+ show (Sorted s) = "FastSet Sorted " ++ show (B8.unpack s)+ show (Table _) = "FastSet Table"++-- | The lower bound on the size of a lookup table. We choose this to+-- balance table density against performance.+tableCutoff :: Int+tableCutoff = 8++-- | Create a set.+set :: B.ByteString -> FastSet+set s | B.length s < tableCutoff = Sorted . B.sort $ s+ | otherwise = Table . mkTable $ s++fromList :: [Word8] -> FastSet+fromList = set . B.pack++data I = I {-# UNPACK #-} !Int {-# UNPACK #-} !Word8++shiftR :: Int -> Int -> Int+shiftR (I# x#) (I# i#) = I# (x# `iShiftRA#` i#)++index :: Int -> I+index i = I (i `shiftR` 3) (1 `unsafeShiftL` (i .&. 7))+{-# INLINE index #-}++-- | Check the set for membership.+memberWord8 :: Word8 -> FastSet -> Bool+memberWord8 w (Table t) =+ let I byte bit = index (fromIntegral w)+ in U.unsafeIndex t byte .&. bit /= 0+memberWord8 w (Sorted s) = search 0 (B.length s - 1)+ where search lo hi+ | hi < lo = False+ | otherwise =+ let mid = (lo + hi) `quot` 2+ in case compare w (U.unsafeIndex s mid) of+ GT -> search (mid + 1) hi+ LT -> search lo (mid - 1)+ _ -> True++-- | Check the set for membership. Only works with 8-bit characters:+-- characters above code point 255 will give wrong answers.+memberChar :: Char -> FastSet -> Bool+memberChar c = memberWord8 (I.c2w c)+{-# INLINE memberChar #-}++mkTable :: B.ByteString -> B.ByteString+mkTable s = I.unsafeCreate 32 $ \t -> do+ _ <- I.memset t 0 32+ U.unsafeUseAsCStringLen s $ \(p, l) ->+ let loop n | n == l = return ()+ | otherwise = do+ c <- peekByteOff p n :: IO Word8+ let I byte bit = index (fromIntegral c)+ prev <- peekByteOff t byte :: IO Word8+ pokeByteOff t byte (prev .|. bit)+ loop (n + 1)+ in loop 0++charClass :: String -> FastSet+charClass = set . B8.pack . go+ where go (a:'-':b:xs) = [a..b] ++ go xs+ go (x:xs) = x : go xs+ go _ = ""
+ internal/Data/Attoparsec/Internal/Compat.hs view
@@ -0,0 +1,27 @@+{-# LANGUAGE CPP #-}+{-# LANGUAGE MagicHash #-}+module Data.Attoparsec.Internal.Compat where++import Data.ByteString.Internal (ByteString(..))+import Data.Word (Word8)+import Foreign.ForeignPtr (ForeignPtr)++#if MIN_VERSION_bytestring(0,11,0)+import Data.ByteString.Internal (plusForeignPtr)+#endif++withPS :: ByteString -> (ForeignPtr Word8 -> Int -> Int -> r) -> r+#if MIN_VERSION_bytestring(0,11,0)+withPS (BS fp len) kont = kont fp 0 len+#else+withPS (PS fp off len) kont = kont fp off len+#endif+{-# INLINE withPS #-}++mkPS :: ForeignPtr Word8 -> Int -> Int -> ByteString+#if MIN_VERSION_bytestring(0,11,0)+mkPS fp off len = BS (plusForeignPtr fp off) len+#else+mkPS fp off len = PS fp off len+#endif+{-# INLINE mkPS #-}
+ internal/Data/Attoparsec/Internal/Fhthagn.hs view
@@ -0,0 +1,18 @@+{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings,+ RecordWildCards, MagicHash, UnboxedTuples #-}++module Data.Attoparsec.Internal.Fhthagn+ (+ inlinePerformIO+ ) where++import GHC.Exts (realWorld#)+import GHC.IO (IO(IO))++-- | Just like unsafePerformIO, but we inline it. Big performance gains as+-- it exposes lots of things to further inlining. /Very unsafe/. In+-- particular, you should do no memory allocation inside an+-- 'inlinePerformIO' block. On Hugs this is just @unsafePerformIO@.+inlinePerformIO :: IO a -> a+inlinePerformIO (IO m) = case m realWorld# of (# _, r #) -> r+{-# INLINE inlinePerformIO #-}
+ internal/Data/Attoparsec/Text/Buffer.hs view
@@ -0,0 +1,235 @@+{-# LANGUAGE BangPatterns, CPP, MagicHash, RankNTypes, RecordWildCards,+ UnboxedTuples #-}++-- |+-- Module : Data.Attoparsec.Text.Buffer+-- Copyright : Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : bos@serpentine.com+-- Stability : experimental+-- Portability : GHC+--+-- An immutable buffer that supports cheap appends.++-- A Buffer is divided into an immutable read-only zone, followed by a+-- mutable area that we've preallocated, but not yet written to.+--+-- We overallocate at the end of a Buffer so that we can cheaply+-- append. Since a user of an existing Buffer cannot see past the end+-- of its immutable zone into the data that will change during an+-- append, this is safe.+--+-- Once we run out of space at the end of a Buffer, we do the usual+-- doubling of the buffer size.++module Data.Attoparsec.Text.Buffer+ (+ Buffer+ , buffer+ , unbuffer+ , unbufferAt+ , length+ , pappend+ , iter+ , iter_+ , substring+ , lengthCodeUnits+ , dropCodeUnits+ ) where++import Control.Exception (assert)+import Data.List (foldl1')+import Data.Monoid as Mon (Monoid(..))+import Data.Semigroup (Semigroup(..))+import Data.Text ()+import Data.Text.Internal (Text(..))+#if MIN_VERSION_text(2,0,0)+import Data.Text.Internal.Encoding.Utf8 (utf8LengthByLeader)+import Data.Text.Unsafe (iterArray, lengthWord8)+#else+import Data.Bits (shiftR)+import Data.Text.Internal.Encoding.Utf16 (chr2)+import Data.Text.Internal.Unsafe.Char (unsafeChr)+import Data.Text.Unsafe (lengthWord16)+#endif+import Data.Text.Unsafe (Iter(..))+import Foreign.Storable (sizeOf)+import GHC.Exts (Int(..), indexIntArray#, unsafeCoerce#, writeIntArray#)+import GHC.ST (ST(..), runST)+import Prelude hiding (length)+import qualified Data.Text.Array as A++-- If _cap is zero, this buffer is empty.+data Buffer = Buf {+ _arr :: {-# UNPACK #-} !A.Array+ , _off :: {-# UNPACK #-} !Int+ , _len :: {-# UNPACK #-} !Int+ , _cap :: {-# UNPACK #-} !Int+ , _gen :: {-# UNPACK #-} !Int+ }++instance Show Buffer where+ showsPrec p = showsPrec p . unbuffer++-- | The initial 'Buffer' has no mutable zone, so we can avoid all+-- copies in the (hopefully) common case of no further input being fed+-- to us.+buffer :: Text -> Buffer+buffer (Text arr off len) = Buf arr off len len 0++unbuffer :: Buffer -> Text+unbuffer (Buf arr off len _ _) = Text arr off len++unbufferAt :: Int -> Buffer -> Text+unbufferAt s (Buf arr off len _ _) =+ assert (s >= 0 && s <= len) $+ Text arr (off+s) (len-s)++instance Semigroup Buffer where+ (Buf _ _ _ 0 _) <> b = b+ a <> (Buf _ _ _ 0 _) = a+ buf <> (Buf arr off len _ _) = append buf arr off len+ {-# INLINE (<>) #-}++instance Monoid Buffer where+ mempty = Buf A.empty 0 0 0 0+ {-# INLINE mempty #-}++ mappend = (<>)++ mconcat [] = Mon.mempty+ mconcat xs = foldl1' (<>) xs++pappend :: Buffer -> Text -> Buffer+pappend (Buf _ _ _ 0 _) t = buffer t+pappend buf (Text arr off len) = append buf arr off len++append :: Buffer -> A.Array -> Int -> Int -> Buffer+append (Buf arr0 off0 len0 cap0 gen0) !arr1 !off1 !len1 = runST $ do+#if MIN_VERSION_text(2,0,0)+ let woff = sizeOf (0::Int)+#else+ let woff = sizeOf (0::Int) `shiftR` 1+#endif+ newlen = len0 + len1+ !gen = if gen0 == 0 then 0 else readGen arr0+ if gen == gen0 && newlen <= cap0+ then do+ let newgen = gen + 1+ marr <- unsafeThaw arr0+ writeGen marr newgen+#if MIN_VERSION_text(2,0,0)+ A.copyI len1 marr (off0+len0) arr1 off1+#else+ A.copyI marr (off0+len0) arr1 off1 (off0+newlen)+#endif+ arr2 <- A.unsafeFreeze marr+ return (Buf arr2 off0 newlen cap0 newgen)+ else do+ let newcap = newlen * 2+ newgen = 1+ marr <- A.new (newcap + woff)+ writeGen marr newgen+#if MIN_VERSION_text(2,0,0)+ A.copyI len0 marr woff arr0 off0+ A.copyI len1 marr (woff+len0) arr1 off1+#else+ A.copyI marr woff arr0 off0 (woff+len0)+ A.copyI marr (woff+len0) arr1 off1 (woff+newlen)+#endif+ arr2 <- A.unsafeFreeze marr+ return (Buf arr2 woff newlen newcap newgen)++length :: Buffer -> Int+length (Buf _ _ len _ _) = len+{-# INLINE length #-}++substring :: Int -> Int -> Buffer -> Text+substring s l (Buf arr off len _ _) =+ assert (s >= 0 && s <= len) .+ assert (l >= 0 && l <= len-s) $+ Text arr (off+s) l+{-# INLINE substring #-}++#if MIN_VERSION_text(2,0,0)++lengthCodeUnits :: Text -> Int+lengthCodeUnits = lengthWord8++dropCodeUnits :: Int -> Buffer -> Text+dropCodeUnits s (Buf arr off len _ _) =+ assert (s >= 0 && s <= len) $+ Text arr (off+s) (len-s)+{-# INLINE dropCodeUnits #-}++-- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-8+-- array, returning the current character and the delta to add to give+-- the next offset to iterate at.+iter :: Buffer -> Int -> Iter+iter (Buf arr off _ _ _) i = iterArray arr (off + i)+{-# INLINE iter #-}++-- | /O(1)/ Iterate one step through a UTF-8 array, returning the+-- delta to add to give the next offset to iterate at.+iter_ :: Buffer -> Int -> Int+iter_ (Buf arr off _ _ _) i = utf8LengthByLeader $ A.unsafeIndex arr (off+i)+{-# INLINE iter_ #-}++unsafeThaw :: A.Array -> ST s (A.MArray s)+unsafeThaw (A.ByteArray a) = ST $ \s# ->+ (# s#, A.MutableByteArray (unsafeCoerce# a) #)++readGen :: A.Array -> Int+readGen (A.ByteArray a) = case indexIntArray# a 0# of r# -> I# r#++writeGen :: A.MArray s -> Int -> ST s ()+writeGen (A.MutableByteArray a) (I# gen#) = ST $ \s0# ->+ case writeIntArray# a 0# gen# s0# of+ s1# -> (# s1#, () #)++#else++lengthCodeUnits :: Text -> Int+lengthCodeUnits = lengthWord16++dropCodeUnits :: Int -> Buffer -> Text+dropCodeUnits s (Buf arr off len _ _) =+ assert (s >= 0 && s <= len) $+ Text arr (off+s) (len-s)+{-# INLINE dropCodeUnits #-}++-- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-16+-- array, returning the current character and the delta to add to give+-- the next offset to iterate at.+iter :: Buffer -> Int -> Iter+iter (Buf arr off _ _ _) i+ | m < 0xD800 || m > 0xDBFF = Iter (unsafeChr m) 1+ | otherwise = Iter (chr2 m n) 2+ where m = A.unsafeIndex arr j+ n = A.unsafeIndex arr k+ j = off + i+ k = j + 1+{-# INLINE iter #-}++-- | /O(1)/ Iterate one step through a UTF-16 array, returning the+-- delta to add to give the next offset to iterate at.+iter_ :: Buffer -> Int -> Int+iter_ (Buf arr off _ _ _) i | m < 0xD800 || m > 0xDBFF = 1+ | otherwise = 2+ where m = A.unsafeIndex arr (off+i)+{-# INLINE iter_ #-}++unsafeThaw :: A.Array -> ST s (A.MArray s)+unsafeThaw A.Array{..} = ST $ \s# ->+ (# s#, A.MArray (unsafeCoerce# aBA) #)++readGen :: A.Array -> Int+readGen a = case indexIntArray# (A.aBA a) 0# of r# -> I# r#++writeGen :: A.MArray s -> Int -> ST s ()+writeGen a (I# gen#) = ST $ \s0# ->+ case writeIntArray# (A.maBA a) 0# gen# s0# of+ s1# -> (# s1#, () #)++#endif
+ internal/Data/Attoparsec/Text/FastSet.hs view
@@ -0,0 +1,121 @@+{-# LANGUAGE BangPatterns #-}++------------------------------------------------------------------------------+-- |+-- Module : Data.Attoparsec.FastSet+-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015+-- License : BSD3+--+-- Maintainer : felipe.lessa@gmail.com+-- Stability : experimental+-- Portability : unknown+--+-- Fast set membership tests for 'Char' values. We test for+-- membership using a hashtable implemented with Robin Hood+-- collision resolution. The set representation is unboxed,+-- and the characters and hashes interleaved, for efficiency.+--+--+-----------------------------------------------------------------------------+module Data.Attoparsec.Text.FastSet+ (+ -- * Data type+ FastSet+ -- * Construction+ , fromList+ , set+ -- * Lookup+ , member+ -- * Handy interface+ , charClass+ ) where++import Data.Bits ((.|.), (.&.), shiftR)+import Data.Function (on)+import Data.List (sort, sortBy)+import qualified Data.Array.Base as AB+import qualified Data.Array.Unboxed as A+import qualified Data.Text as T++data FastSet = FastSet {+ table :: {-# UNPACK #-} !(A.UArray Int Int)+ , mask :: {-# UNPACK #-} !Int+ }++data Entry = Entry {+ key :: {-# UNPACK #-} !Char+ , initialIndex :: {-# UNPACK #-} !Int+ , index :: {-# UNPACK #-} !Int+ }++offset :: Entry -> Int+offset e = index e - initialIndex e++resolveCollisions :: [Entry] -> [Entry]+resolveCollisions [] = []+resolveCollisions [e] = [e]+resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries)+ where (a', b')+ | index a < index b = (a, b)+ | offset a < offset b = (b { index=index a }, a { index=index a + 1 })+ | otherwise = (a, b { index=index a + 1 })++pad :: Int -> [Entry] -> [Entry]+pad = go 0+ where -- ensure that we pad enough so that lookups beyond the+ -- last hash in the table fall within the array+ go !_ !m [] = replicate (max 1 m + 1) empty+ go k m (e:entries) = map (const empty) [k..i - 1] ++ e :+ go (i + 1) (m + i - k - 1) entries+ where i = index e+ empty = Entry '\0' maxBound 0++nextPowerOf2 :: Int -> Int+nextPowerOf2 0 = 1+nextPowerOf2 x = go (x - 1) 1+ where go y 32 = y + 1+ go y k = go (y .|. (y `shiftR` k)) $ k * 2++fastHash :: Char -> Int+fastHash = fromEnum++fromList :: String -> FastSet+fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved)+ mask'+ where s' = ordNub (sort s)+ l = length s'+ mask' = nextPowerOf2 ((5 * l) `div` 4) - 1+ entries = pad mask' .+ resolveCollisions .+ sortBy (compare `on` initialIndex) .+ zipWith (\c i -> Entry c i i) s' .+ map ((.&. mask') . fastHash) $ s'+ interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e])+ entries++ordNub :: Eq a => [a] -> [a]+ordNub [] = []+ordNub (y:ys) = go y ys+ where go x (z:zs)+ | x == z = go x zs+ | otherwise = x : go z zs+ go x [] = [x]++set :: T.Text -> FastSet+set = fromList . T.unpack++-- | Check the set for membership.+member :: Char -> FastSet -> Bool+member c a = go (2 * i)+ where i = fastHash c .&. mask a+ lookupAt j b = (i' <= i) && (c == c' || b)+ where c' = toEnum $ AB.unsafeAt (table a) j+ i' = AB.unsafeAt (table a) $ j + 1+ go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) .+ lookupAt (j + 6) . go $ j + 8++charClass :: String -> FastSet+charClass = fromList . go+ where go (a:'-':b:xs) = [a..b] ++ go xs+ go (x:xs) = x : go xs+ go _ = ""
− tests/Makefile
@@ -1,14 +0,0 @@-all: TestFastSet.out qc.out--%.out: %.exe- ./$< | tee $<.tmp- mv $<.tmp $@--qc.exe: QC.hs- ghc -O -fno-warn-orphans --make -o $@ $<--%.exe: %.hs- ghc -O -fno-warn-orphans --make -o $@ $<--clean:- -rm -f *.hi *.o *.exe *.out
tests/QC.hs view
@@ -1,116 +1,19 @@-{-# LANGUAGE OverloadedStrings #-}+{-# OPTIONS_GHC -fno-warn-missing-signatures #-} module Main (main) where -import Control.Monad (forM_)-import Data.Maybe (isJust)-import Data.Word (Word8)-import Prelude hiding (takeWhile)-import QCSupport-import Test.Framework (defaultMain, testGroup)-import Test.Framework.Providers.QuickCheck2 (testProperty)-import Test.QuickCheck hiding (NonEmpty)-import qualified Data.Attoparsec as P-import qualified Data.ByteString as B-import qualified Data.ByteString.Char8 as C---- Make sure that structures whose types claim they are non-empty--- really are.--nonEmptyList l = length (nonEmpty l) > 0- where types = l :: NonEmpty [Int]-nonEmptyBS l = B.length (nonEmpty l) > 0---- Naming.--{--label (NonEmpty s) = case parse (anyWord8 <?> s) B.empty of- (_, Left err) -> s `isInfixOf` err- _ -> False--}---- Basic byte-level combinators.--maybeP p s = case P.parse p s `P.feed` B.empty of- P.Done _ i -> Just i- _ -> Nothing--defP p s = P.parse p s `P.feed` B.empty--satisfy w s = maybeP (P.satisfy (<=w)) (B.cons w s) == Just w--word8 w s = maybeP (P.word8 w) (B.cons w s) == Just w--anyWord8 s = maybeP P.anyWord8 s == if B.null s- then Nothing- else Just (B.head s)--notWord8 w (NonEmpty s) = maybeP (P.notWord8 w) s == if v == w- then Nothing- else Just v- where v = B.head s--string s = maybeP (P.string s) s == Just s--skipWhile w s =- let t = B.dropWhile (<=w) s- in case defP (P.skipWhile (<=w)) s of- P.Done t' () -> t == t'- _ -> False--takeCount (Positive k) s =- case maybeP (P.take k) s of- Nothing -> k > B.length s- Just s' -> k <= B.length s--takeWhile w s =- let (h,t) = B.span (==w) s- in case defP (P.takeWhile (==w)) s of- P.Done t' h' -> t == t' && h == h'- _ -> False--takeWhile1 w s =- let s' = B.cons w s- (h,t) = B.span (<=w) s'- in case defP (P.takeWhile1 (<=w)) s' of- P.Done t' h' -> t == t' && h == h'- _ -> False--takeTill w s =- let (h,t) = B.break (==w) s- in case defP (P.takeTill (==w)) s of- P.Done t' h' -> t == t' && h == h'- _ -> False--ensure n s = case defP (P.ensure m) s of- P.Done _ () -> B.length s >= m- _ -> B.length s < m- where m = (n `mod` 220) - 20--takeWhile1_empty = maybeP (P.takeWhile1 undefined) B.empty == Nothing--endOfInput s = maybeP P.endOfInput s == if B.null s- then Just ()- else Nothing+import qualified QC.Buffer as Buffer+import qualified QC.ByteString as ByteString+import qualified QC.Combinator as Combinator+import qualified QC.Simple as Simple+import qualified QC.Text as Text+import Test.Tasty (defaultMain, testGroup) main = defaultMain tests -tests = [- testGroup "fnord" [- testProperty "nonEmptyList" nonEmptyList,- testProperty "nonEmptyBS" nonEmptyBS,- testProperty "satisfy" satisfy,- testProperty "word8" word8,- testProperty "notWord8" notWord8,- testProperty "anyWord8" anyWord8,- testProperty "string" string,- testProperty "skipWhile" skipWhile,- testProperty "takeCount" takeCount,- testProperty "takeWhile" takeWhile,- testProperty "takeWhile1" takeWhile1,- testProperty "takeWhile1_empty" takeWhile1_empty,- testProperty "takeTill" takeTill,- testProperty "endOfInput" endOfInput,- testProperty "ensure" ensure- ]-+tests = testGroup "tests" [+ testGroup "bs" ByteString.tests+ , testGroup "buf" Buffer.tests+ , testGroup "combinator" Combinator.tests+ , testGroup "simple" Simple.tests+ , testGroup "text" Text.tests ]
+ tests/QC/Buffer.hs view
@@ -0,0 +1,111 @@+{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, OverloadedStrings,+ TypeSynonymInstances #-}++module QC.Buffer (tests) where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((<$>))+import Data.Monoid (Monoid(mconcat))+#endif+import QC.Common ()+import Test.Tasty (TestTree)+import Test.Tasty.QuickCheck (testProperty)+import Test.QuickCheck+import qualified Data.Attoparsec.ByteString.Buffer as BB+import qualified Data.Attoparsec.Text.Buffer as BT+import qualified Data.ByteString as B+import qualified Data.ByteString.Unsafe as B+import qualified Data.Text as T+import qualified Data.Text.Unsafe as T++data BP t b = BP [t] !t !b+ deriving (Eq, Show)++type BPB = BP B.ByteString BB.Buffer+type BPT = BP T.Text BT.Buffer++instance Arbitrary BPB where+ arbitrary = do+ bss <- arbitrary+ return $! toBP BB.buffer bss++ shrink (BP bss _ _) = toBP BB.buffer <$> shrink bss++instance Arbitrary BPT where+ arbitrary = do+ bss <- arbitrary+ return $! toBP BT.buffer bss++ shrink (BP bss _ _) = toBP BT.buffer <$> shrink bss++toBP :: (Monoid a, Monoid b) => (a -> b) -> [a] -> BP a b+toBP buf bss = BP bss (mconcat bss) (mconcat (map buf bss))++b_unbuffer :: BPB -> Property+b_unbuffer (BP _ts t buf) = t === BB.unbuffer buf++t_unbuffer :: BPT -> Property+t_unbuffer (BP _ts t buf) = t === BT.unbuffer buf++-- This test triggers both branches in Data.Attoparsec.Text.Buffer.append+-- and checks that Data.Text.Array.copyI manipulations are correct.+t_unbuffer_three :: Property+t_unbuffer_three = t_unbuffer $ toBP BT.buffer [t, t, t]+ where+ -- Make it long enough to increase chances of a segmentation fault+ t = T.replicate 1000 "\0"++b_length :: BPB -> Property+b_length (BP _ts t buf) = B.length t === BB.length buf++t_length :: BPT -> Property+t_length (BP _ts t buf) = BT.lengthCodeUnits t === BT.length buf++b_unsafeIndex :: BPB -> Gen Property+b_unsafeIndex (BP _ts t buf) = do+ let l = B.length t+ i <- choose (0,l-1)+ return $ l === 0 .||. B.unsafeIndex t i === BB.unsafeIndex buf i++t_iter :: BPT -> Gen Property+t_iter (BP _ts t buf) = do+ let l = BT.lengthCodeUnits t+ i <- choose (0,l-1)+ let it (T.Iter c q) = (c,q)+ return $ l === 0 .||. it (T.iter t i) === it (BT.iter buf i)++t_iter_ :: BPT -> Gen Property+t_iter_ (BP _ts t buf) = do+ let l = BT.lengthCodeUnits t+ i <- choose (0,l-1)+ return $ l === 0 .||. T.iter_ t i === BT.iter_ buf i++b_unsafeDrop :: BPB -> Gen Property+b_unsafeDrop (BP _ts t buf) = do+ i <- choose (0, B.length t)+ return $ B.unsafeDrop i t === BB.unsafeDrop i buf++t_dropCodeUnits :: BPT -> Gen Property+t_dropCodeUnits (BP _ts t buf) = do+ i <- choose (0, BT.lengthCodeUnits t)+ return $ dropCodeUnits i t === BT.dropCodeUnits i buf+ where+#if MIN_VERSION_text(2,0,0)+ dropCodeUnits = T.dropWord8+#else+ dropCodeUnits = T.dropWord16+#endif++tests :: [TestTree]+tests = [+ testProperty "b_unbuffer" b_unbuffer+ , testProperty "t_unbuffer" t_unbuffer+ , testProperty "t_unbuffer_three" t_unbuffer_three+ , testProperty "b_length" b_length+ , testProperty "t_length" t_length+ , testProperty "b_unsafeIndex" b_unsafeIndex+ , testProperty "t_iter" t_iter+ , testProperty "t_iter_" t_iter_+ , testProperty "b_unsafeDrop" b_unsafeDrop+ , testProperty "t_dropCodeUnits" t_dropCodeUnits+ ]
+ tests/QC/ByteString.hs view
@@ -0,0 +1,214 @@+{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}+module QC.ByteString (tests) where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((<*>), (<$>))+#endif+import Data.Char (chr, ord, toUpper)+import Data.Int (Int64)+import Data.Word (Word8)+import Prelude hiding (take, takeWhile)+import QC.Common (ASCII(..), liftOp, parseBS, toStrictBS)+import Test.Tasty (TestTree)+import Test.Tasty.QuickCheck (testProperty)+import Test.QuickCheck+import qualified Data.Attoparsec.ByteString as P+import qualified Data.Attoparsec.ByteString.Char8 as P8+import qualified Data.Attoparsec.ByteString.FastSet as S+import qualified Data.Attoparsec.ByteString.Lazy as PL+import qualified Data.ByteString as B+import qualified Data.ByteString.Char8 as B8+import qualified Data.ByteString.Lazy as L+import qualified Data.ByteString.Lazy.Char8 as L8++-- Basic byte-level combinators.++satisfy :: Word8 -> L.ByteString -> Property+satisfy w s = parseBS (P.satisfy (<=w)) (L.cons w s) === Just w++satisfyWith :: Word8 -> L.ByteString -> Property+satisfyWith w s = parseBS (P.satisfyWith (chr . fromIntegral) (<=c))+ (L.cons (fromIntegral (ord c)) s) === Just c+ where+ c = chr (fromIntegral w)++word8 :: Word8 -> L.ByteString -> Property+word8 w s = parseBS (P.word8 w) (L.cons w s) === Just w++skip :: Word8 -> L.ByteString -> Property+skip w s =+ case (parseBS (P.skip (<w)) s, L.uncons s) of+ (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs+ (Just _, mcs) -> maybe (property False) it mcs+ where it cs = liftOp "<" (<) (fst cs) w++anyWord8 :: L.ByteString -> Property+anyWord8 s+ | L.null s = p === Nothing+ | otherwise = p === Just (L.head s)+ where p = parseBS P.anyWord8 s++notWord8 :: Word8 -> NonEmptyList Word8 -> Property+notWord8 w (NonEmpty s) = parseBS (P.notWord8 w) bs === if v == w+ then Nothing+ else Just v+ where v = L.head bs+ bs = L.pack s++peekWord8 :: L.ByteString -> Property+peekWord8 s+ | L.null s = p === Just (Nothing, s)+ | otherwise = p === Just (Just (L.head s), s)+ where p = parseBS ((,) <$> P.peekWord8 <*> P.takeLazyByteString) s++peekWord8' :: L.ByteString -> Property+peekWord8' s = parseBS P.peekWord8' s === (fst <$> L.uncons s)++string :: L.ByteString -> L.ByteString -> Property+string s t = parseBS (P.string s') (s `L.append` t) === Just s'+ where s' = toStrictBS s++stringCI :: ASCII L.ByteString -> ASCII L.ByteString -> Property+stringCI (ASCII s) (ASCII t) =+ parseBS (P8.stringCI up) (s `L.append` t) === Just s'+ where s' = toStrictBS s+ up = B8.map toUpper s'++strings :: L.ByteString -> L.ByteString -> L.ByteString -> Property+strings s t u =+ parseBS (P.string (toStrictBS s) >> P.string t') (L.concat [s,t,u])+ === Just t'+ where t' = toStrictBS t++skipWhile :: Word8 -> L.ByteString -> Property+skipWhile w s =+ let t = L.dropWhile (<=w) s+ in case PL.parse (P.skipWhile (<=w)) s of+ PL.Done t' () -> t === t'+ _ -> property False++takeCount :: Positive Int -> L.ByteString -> Property+takeCount (Positive k) s =+ case parseBS (P.take k) s of+ Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)+ Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)++takeWhile :: Word8 -> L.ByteString -> Property+takeWhile w s =+ let (h,t) = L.span (==w) s+ in case PL.parse (P.takeWhile (==w)) s of+ PL.Done t' h' -> t === t' .&&. toStrictBS h === h'+ _ -> property False++take :: Int -> L.ByteString -> Property+take n s = maybe (property $ L.length s < fromIntegral n)+ (=== B.take n (toStrictBS s)) $+ parseBS (P.take n) s++takeByteString :: L.ByteString -> Property+takeByteString s = maybe (property False) (=== toStrictBS s) .+ parseBS P.takeByteString $ s++takeLazyByteString :: L.ByteString -> Property+takeLazyByteString s = maybe (property False) (=== s) .+ parseBS P.takeLazyByteString $ s++takeWhile1 :: Word8 -> L.ByteString -> Property+takeWhile1 w s =+ let s' = L.cons w s+ (h,t) = L.span (<=w) s'+ in case PL.parse (P.takeWhile1 (<=w)) s' of+ PL.Done t' h' -> t === t' .&&. toStrictBS h === h'+ _ -> property False++takeWhileIncluding :: Word8 -> L.ByteString -> Property+takeWhileIncluding w s =+ let s' = L.cons w $ L.snoc s (w+1)+ (h_,t_) = L.span (<=w) s'+ (h,t) =+ case L.uncons t_ of+ Nothing -> (h_, t_)+ Just (n, nt) -> (h_ `L.snoc` n, nt)+ in w < 255 ==> case PL.parse (P.takeWhileIncluding (<=w)) s' of+ PL.Done t' h' -> t === t' .&&. toStrictBS h === h'+ _ -> property False++takeTill :: Word8 -> L.ByteString -> Property+takeTill w s =+ let (h,t) = L.break (==w) s+ in case PL.parse (P.takeTill (==w)) s of+ PL.Done t' h' -> t === t' .&&. toStrictBS h === h'+ _ -> property False++takeWhile1_empty :: Property+takeWhile1_empty = parseBS (P.takeWhile1 undefined) L.empty === Nothing++getChunk :: L.ByteString -> Property+getChunk s =+ maybe (property False) (=== L.toChunks s) $+ parseBS getChunks s+ where getChunks = go []+ go res = do+ mchunk <- P.getChunk+ case mchunk of+ Nothing -> return (reverse res)+ Just chunk -> do+ _ <- P.take (B.length chunk)+ go (chunk:res)++endOfInput :: L.ByteString -> Property+endOfInput s = parseBS P.endOfInput s === if L.null s+ then Just ()+ else Nothing++endOfLine :: L.ByteString -> Property+endOfLine s =+ case (parseBS P8.endOfLine s, L8.uncons s) of+ (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs+ (Just _, mcs) -> maybe (property False) eol mcs+ where eol (c,s') = c === '\n' .||.+ (c, fst <$> L8.uncons s') === ('\r', Just '\n')++scan :: L.ByteString -> Positive Int64 -> Property+scan s (Positive k) = parseBS p s === Just (toStrictBS $ L.take k s)+ where p = P.scan k $ \ n _ ->+ if n > 0 then let !n' = n - 1 in Just n' else Nothing++members :: [Word8] -> Property+members s = property $ all (`S.memberWord8` set) s+ where set = S.fromList s++nonmembers :: [Word8] -> [Word8] -> Property+nonmembers s s' = property . not . any (`S.memberWord8` set) $ filter (not . (`elem` s)) s'+ where set = S.fromList s++tests :: [TestTree]+tests = [+ testProperty "anyWord8" anyWord8+ , testProperty "endOfInput" endOfInput+ , testProperty "endOfLine" endOfLine+ , testProperty "notWord8" notWord8+ , testProperty "peekWord8" peekWord8+ , testProperty "peekWord8'" peekWord8'+ , testProperty "satisfy" satisfy+ , testProperty "satisfyWith" satisfyWith+ , testProperty "scan" scan+ , testProperty "skip" skip+ , testProperty "skipWhile" skipWhile+ , testProperty "string" string+ , testProperty "stringCI" stringCI+ , testProperty "strings" strings+ , testProperty "take" take+ , testProperty "takeByteString" takeByteString+ , testProperty "takeCount" takeCount+ , testProperty "takeLazyByteString" takeLazyByteString+ , testProperty "takeTill" takeTill+ , testProperty "takeWhile" takeWhile+ , testProperty "takeWhile1" takeWhile1+ , testProperty "takeWhile1_empty" takeWhile1_empty+ , testProperty "takeWhileIncluding" takeWhileIncluding+ , testProperty "getChunk" getChunk+ , testProperty "word8" word8+ , testProperty "members" members+ , testProperty "nonmembers" nonmembers+ ]
+ tests/QC/Combinator.hs view
@@ -0,0 +1,52 @@+{-# LANGUAGE CPP, OverloadedStrings #-}++module QC.Combinator where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((<*>), (<$>), (<*), (*>))+#endif+import Data.Maybe (fromJust, isJust)+import Data.Word (Word8)+import QC.Common (Repack, parseBS, repackBS, toLazyBS)+import Test.Tasty (TestTree)+import Test.Tasty.QuickCheck (testProperty)+import Test.QuickCheck+import qualified Data.Attoparsec.ByteString.Char8 as P+import qualified Data.Attoparsec.Combinator as C+import qualified Data.ByteString as B+import qualified Data.ByteString.Char8 as B8++choice :: NonEmptyList (NonEmptyList Word8) -> Gen Property+choice (NonEmpty xs) = do+ let ys = map (B.pack . getNonEmpty) xs+ return . forAll (repackBS <$> arbitrary <*> elements ys) $+ maybe False (`elem` ys) . parseBS (C.choice (map P.string ys))++count :: Positive (Small Int) -> Repack -> B.ByteString -> Bool+count (Positive (Small n)) rs s =+ (length <$> parseBS (C.count n (P.string s)) input) == Just n+ where input = repackBS rs (B.concat (replicate (n+1) s))++lookAhead :: NonEmptyList Word8 -> Bool+lookAhead (NonEmpty xs) =+ let ys = B.pack xs+ withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys+ mr = parseBS withLookAheadThenConsume $ toLazyBS ys+ in isJust mr && fst (fromJust mr) == snd (fromJust mr)++match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool+match n (NonNegative x) (NonNegative y) rs =+ parseBS (P.match parser) (repackBS rs input) == Just (input, n)+ where parser = P.skipWhile (=='x') *> P.signed P.decimal <*+ P.skipWhile (=='y')+ input = B.concat [+ B8.replicate x 'x', B8.pack (show n), B8.replicate y 'y'+ ]++tests :: [TestTree]+tests = [+ testProperty "choice" choice+ , testProperty "count" count+ , testProperty "lookAhead" lookAhead+ , testProperty "match" match+ ]
+ tests/QC/Common.hs view
@@ -0,0 +1,113 @@+{-# LANGUAGE CPP, FlexibleInstances #-}+{-# OPTIONS_GHC -fno-warn-orphans #-}+module QC.Common+ (+ ASCII(..)+ , parseBS+ , parseT+ , toLazyBS+ , toStrictBS+ , Repack+ , repackBS+ , repackBS_+ , repackT+ , repackT_+ , liftOp+ ) where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((<*>), (<$>))+#endif+import Data.Char (isAlpha)+import Test.QuickCheck+import Test.QuickCheck.Unicode (shrinkChar, string)+import qualified Data.ByteString as B+import qualified Data.ByteString.Lazy as BL+import qualified Data.Text as T+import qualified Data.Text.Lazy as TL+import qualified Data.Attoparsec.ByteString.Lazy as BL+import qualified Data.Attoparsec.Text.Lazy as TL++#if !MIN_VERSION_base(4,4,0)+-- This should really be a dependency on the random package :-(+instance Random Word8 where+ randomR = integralRandomR+ random = randomR (minBound,maxBound)++instance Arbitrary Word8 where+ arbitrary = choose (minBound, maxBound)+#endif++parseBS :: BL.Parser r -> BL.ByteString -> Maybe r+parseBS p = BL.maybeResult . BL.parse p++parseT :: TL.Parser r -> TL.Text -> Maybe r+parseT p = TL.maybeResult . TL.parse p++toStrictBS :: BL.ByteString -> B.ByteString+toStrictBS = B.concat . BL.toChunks++toLazyBS :: B.ByteString -> BL.ByteString+toLazyBS = BL.fromChunks . (:[])++instance Arbitrary B.ByteString where+ arbitrary = B.pack <$> arbitrary+ shrink = map B.pack . shrink . B.unpack++instance Arbitrary BL.ByteString where+ arbitrary = repackBS <$> arbitrary <*> arbitrary+ shrink = map BL.pack . shrink . BL.unpack++newtype ASCII a = ASCII { fromASCII :: a }+ deriving (Eq, Ord, Show)++instance Arbitrary (ASCII B.ByteString) where+ arbitrary = (ASCII . B.pack) <$> listOf (choose (0,127))+ shrink = map (ASCII . B.pack) . shrink . B.unpack . fromASCII++instance Arbitrary (ASCII BL.ByteString) where+ arbitrary = ASCII <$> (repackBS <$> arbitrary <*> (fromASCII <$> arbitrary))+ shrink = map (ASCII . BL.pack) . shrink . BL.unpack . fromASCII++type Repack = NonEmptyList (Positive (Small Int))++repackBS :: Repack -> B.ByteString -> BL.ByteString+repackBS (NonEmpty bs) =+ BL.fromChunks . repackBS_ (map (getSmall . getPositive) bs)++repackBS_ :: [Int] -> B.ByteString -> [B.ByteString]+repackBS_ = go . cycle+ where go (b:bs) s+ | B.null s = []+ | otherwise = let (h,t) = B.splitAt b s+ in h : go bs t+ go _ _ = error "unpossible"++instance Arbitrary T.Text where+ arbitrary = T.pack <$> string+ shrink = map T.pack . shrinkList shrinkChar . T.unpack++instance Arbitrary TL.Text where+ arbitrary = TL.pack <$> string+ shrink = map TL.pack . shrinkList shrinkChar . TL.unpack++repackT :: Repack -> T.Text -> TL.Text+repackT (NonEmpty bs) =+ TL.fromChunks . repackT_ (map (getSmall . getPositive) bs)++repackT_ :: [Int] -> T.Text -> [T.Text]+repackT_ = go . cycle+ where go (b:bs) s+ | T.null s = []+ | otherwise = let (h,t) = T.splitAt b s+ in h : go bs t+ go _ _ = error "unpossible"++liftOp :: (Show a, Testable prop) =>+ String -> (a -> a -> prop) -> a -> a -> Property+liftOp name f x y = counterexample desc (f x y)+ where op = case name of+ (c:_) | isAlpha c -> " `" ++ name ++ "` "+ | otherwise -> " " ++ name ++ " "+ _ -> " ??? "+ desc = "not (" ++ show x ++ op ++ show y ++ ")"
+ tests/QC/IPv6/Internal.hs view
@@ -0,0 +1,316 @@+-- -----------------------------------------------------------------------------++-- |+-- Module : Text.IPv6Addr+-- Copyright : Copyright © Michel Boucey 2011-2015+-- License : BSD-Style+-- Maintainer : michel.boucey@gmail.com+--+-- Dealing with IPv6 address text representations, canonization and manipulations.+--++-- -----------------------------------------------------------------------------++{-# LANGUAGE OverloadedStrings #-}++module QC.IPv6.Internal where {-+ ( expandTokens+ , macAddr+ , maybeIPv6AddrTokens+ , ipv4AddrToIPv6AddrTokens+ , ipv6TokensToText+ , ipv6TokensToIPv6Addr+ , isIPv6Addr+ , maybeTokIPv6Addr+ , maybeTokPureIPv6Addr+ , fromDoubleColon+ , fromIPv6Addr+ , toDoubleColon+ ) where -}++import Debug.Trace+import Control.Monad (replicateM)+import Data.Attoparsec.Text+import Data.Char (isDigit,isHexDigit,toLower)+import Data.Monoid ((<>))+import Control.Applicative ((<|>),(<*))+import Data.List (group,isSuffixOf,elemIndex,elemIndices,intersperse)+import Data.Word (Word32)+import Numeric (showHex)+import qualified Data.Text as T+import qualified Data.Text.Read as R (decimal)+import Data.Maybe (fromJust)++import QC.IPv6.Types++tok0 = "0"++-- | Returns the 'T.Text' of an IPv6 address.+fromIPv6Addr :: IPv6Addr -> T.Text+fromIPv6Addr (IPv6Addr t) = t++-- | Given an arbitrary list of 'IPv6AddrToken', returns the corresponding 'T.Text'.+ipv6TokensToText :: [IPv6AddrToken] -> T.Text+ipv6TokensToText l = T.concat $ map ipv6TokenToText l++-- | Returns the corresponding 'T.Text' of an IPv6 address token.+ipv6TokenToText :: IPv6AddrToken -> T.Text+ipv6TokenToText (SixteenBit s) = s+ipv6TokenToText Colon = ":"+ipv6TokenToText DoubleColon = "::"+ipv6TokenToText AllZeros = tok0 -- "A single 16-bit 0000 field MUST be represented as 0" (RFC 5952, 4.1)+ipv6TokenToText (IPv4Addr a) = a++-- | Returns 'True' if a list of 'IPv6AddrToken' constitutes a valid IPv6 Address.+isIPv6Addr :: [IPv6AddrToken] -> Bool+isIPv6Addr [] = False+isIPv6Addr [DoubleColon] = True+isIPv6Addr [DoubleColon,SixteenBit tok1] = True+isIPv6Addr tks =+ diffNext tks && (do+ let cdctks = countDoubleColon tks+ let lentks = length tks+ let lasttk = last tks+ let lenconst = (lentks == 15 && cdctks == 0) || (lentks < 15 && cdctks == 1)+ firstValidToken tks &&+ (case countIPv4Addr tks of+ 0 -> case lasttk of+ SixteenBit _ -> lenconst+ DoubleColon -> lenconst+ AllZeros -> lenconst+ _ -> False+ 1 -> case lasttk of+ IPv4Addr _ -> (lentks == 13 && cdctks == 0) || (lentks < 12 && cdctks == 1)+ _ -> False+ otherwise -> False))+ where diffNext [] = False+ diffNext [_] = True+ diffNext (t:ts) = do+ let h = head ts+ case t of+ SixteenBit _ -> case h of+ SixteenBit _ -> False+ AllZeros -> False+ _ -> diffNext ts+ AllZeros -> case h of+ SixteenBit _ -> False+ AllZeros -> False+ _ -> diffNext ts+ _ -> diffNext ts+ firstValidToken l =+ case head l of+ SixteenBit _ -> True+ DoubleColon -> True+ AllZeros -> True+ _ -> False+ countDoubleColon l = length $ elemIndices DoubleColon l+ tok1 = "1"++countIPv4Addr = foldr oneMoreIPv4Addr 0+ where+ oneMoreIPv4Addr t c = case t of+ IPv4Addr _ -> c + 1+ otherwise -> c++-- | This is the main function which returns 'Just' the list of a tokenized IPv6+-- address text representation validated against RFC 4291 and canonized+-- in conformation with RFC 5952, or 'Nothing'.+maybeTokIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]+maybeTokIPv6Addr t =+ case maybeIPv6AddrTokens t of+ Just ltks -> if isIPv6Addr ltks+ then Just $ (ipv4AddrReplacement . toDoubleColon . fromDoubleColon) ltks+ else Nothing+ Nothing -> Nothing+ where+ ipv4AddrReplacement ltks =+ if ipv4AddrRewrite ltks+ then init ltks ++ ipv4AddrToIPv6AddrTokens (last ltks)+ else ltks++-- | Returns 'Just' the list of tokenized pure IPv6 address, always rewriting an+-- embedded IPv4 address if present.+maybeTokPureIPv6Addr :: T.Text -> Maybe [IPv6AddrToken]+maybeTokPureIPv6Addr t = do+ ltks <- maybeIPv6AddrTokens t+ if isIPv6Addr ltks+ then Just $ (toDoubleColon . ipv4AddrReplacement . fromDoubleColon) ltks+ else Nothing+ where+ ipv4AddrReplacement ltks' = init ltks' ++ ipv4AddrToIPv6AddrTokens (last ltks')++-- | Tokenize a 'T.Text' into 'Just' a list of 'IPv6AddrToken', or 'Nothing'.+maybeIPv6AddrTokens :: T.Text -> Maybe [IPv6AddrToken]+maybeIPv6AddrTokens s =+ case readText s of+ Done r l -> traceShow (r,l) $ if r==T.empty then Just l else Nothing+ Fail {} -> Nothing+ where+ readText s = feed (parse (many1 $ ipv4Addr <|> sixteenBit <|> doubleColon <|> colon) s) T.empty++-- | An embedded IPv4 address have to be rewritten to output a pure IPv6 Address+-- text representation in hexadecimal digits. But some well-known prefixed IPv6+-- addresses have to keep visible in their text representation the fact that+-- they deals with IPv4 to IPv6 transition process (RFC 5952 Section 5):+--+-- IPv4-compatible IPv6 address like "::1.2.3.4"+--+-- IPv4-mapped IPv6 address like "::ffff:1.2.3.4"+--+-- IPv4-translated address like "::ffff:0:1.2.3.4"+--+-- IPv4-translatable address like "64:ff9b::1.2.3.4"+--+-- ISATAP address like "fe80::5efe:1.2.3.4"+--+ipv4AddrRewrite :: [IPv6AddrToken] -> Bool+ipv4AddrRewrite tks =+ case last tks of+ IPv4Addr _ -> do+ let itks = init tks+ not (itks == [DoubleColon]+ || itks == [DoubleColon,SixteenBit tokffff,Colon]+ || itks == [DoubleColon,SixteenBit tokffff,Colon,AllZeros,Colon]+ || itks == [SixteenBit "64",Colon,SixteenBit "ff9b",DoubleColon]+ || [SixteenBit "200",Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks+ || [AllZeros,Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks+ || [DoubleColon,SixteenBit tok5efe,Colon] `isSuffixOf` itks)+ _ -> False+ where+ tokffff = "ffff"+ tok5efe = "5efe"++-- | Rewrites an embedded 'IPv4Addr' into the corresponding list of pure 'IPv6Addr' tokens.+--+-- > ipv4AddrToIPv6AddrTokens (IPv4Addr "127.0.0.1") == [SixteenBits "7f0",Colon,SixteenBits "1"]+--+ipv4AddrToIPv6AddrTokens :: IPv6AddrToken -> [IPv6AddrToken]+ipv4AddrToIPv6AddrTokens t =+ case t of+ IPv4Addr a -> do+ let m = toHex a+ [ SixteenBit ((!!) m 0 <> addZero ((!!) m 1))+ , Colon+ , SixteenBit ((!!) m 2 <> addZero ((!!) m 3)) ]+ _ -> [t]+ where+ toHex a = map (\x -> T.pack $ showHex (read (T.unpack x)::Int) "") $ T.split (=='.') a+ addZero d = if T.length d == 1 then tok0 <> d else d++expandTokens :: [IPv6AddrToken] -> [IPv6AddrToken]+expandTokens = map expandToken+ where expandToken (SixteenBit s) = SixteenBit $ T.justifyRight 4 '0' s+ expandToken AllZeros = SixteenBit "0000"+ expandToken t = t++fromDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]+fromDoubleColon tks =+ if DoubleColon `notElem` tks+ then tks+ else do let s = splitAt (fromJust $ elemIndex DoubleColon tks) tks+ let fsts = fst s+ let snds = if not (null (snd s)) then tail(snd s) else []+ let fste = if null fsts then [] else fsts ++ [Colon]+ let snde = if null snds then [] else Colon : snds+ fste ++ allZerosTokensReplacement(quantityOfAllZerosTokenToReplace tks) ++ snde+ where+ allZerosTokensReplacement x = intersperse Colon (replicate x AllZeros)+ quantityOfAllZerosTokenToReplace x =+ ntks tks - foldl (\c x -> if (x /= DoubleColon) && (x /= Colon) then c+1 else c) 0 x+ where+ ntks tks = if countIPv4Addr tks == 1 then 7 else 8++toDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken]+toDoubleColon tks =+ zerosToDoubleColon tks (zerosRunToReplace $ zerosRunsList tks)+ where+ zerosToDoubleColon :: [IPv6AddrToken] -> (Int,Int) -> [IPv6AddrToken]+ -- No all zeros token, so no double colon replacement...+ zerosToDoubleColon ls (_,0) = ls+ -- "The symbol '::' MUST NOT be used to shorten just one 16-bit 0 field" (RFC 5952 4.2.2)+ zerosToDoubleColon ls (_,1) = ls+ zerosToDoubleColon ls (i,l) =+ let ls' = filter (/= Colon) ls+ in intersperse Colon (Prelude.take i ls') ++ [DoubleColon] ++ intersperse Colon (drop (i+l) ls')+ zerosRunToReplace t =+ let l = longestLengthZerosRun t+ in (firstLongestZerosRunIndex t l,l)+ where+ firstLongestZerosRunIndex x y = sum . snd . unzip $ Prelude.takeWhile (/=(True,y)) x+ longestLengthZerosRun x =+ maximum $ map longest x+ where longest t = case t of+ (True,i) -> i+ _ -> 0+ zerosRunsList x = map helper $ groupZerosRuns x+ where+ helper h = (head h == AllZeros, lh) where lh = length h+ groupZerosRuns = group . filter (/= Colon)++ipv6TokensToIPv6Addr :: [IPv6AddrToken] -> Maybe IPv6Addr+ipv6TokensToIPv6Addr l = Just $ IPv6Addr $ ipv6TokensToText l++fullSixteenBit :: T.Text -> Maybe IPv6AddrToken+fullSixteenBit t =+ case parse ipv6AddrFullChunk t of+ Done a b -> if a==T.empty then Just $ SixteenBit $ T.pack b else Nothing+ _ -> Nothing++macAddr :: Parser (Maybe [IPv6AddrToken])+macAddr = do+ n1 <- count 2 hexaChar <* ":"+ n2 <- count 2 hexaChar <* ":"+ n3 <- count 2 hexaChar <* ":"+ n4 <- count 2 hexaChar <* ":"+ n5 <- count 2 hexaChar <* ":"+ n6 <- count 2 hexaChar+ return $ maybeIPv6AddrTokens $ T.pack $ concat [n1,n2,n3,n4,n5,n6]++sixteenBit :: Parser IPv6AddrToken+sixteenBit = do+ r <- ipv6AddrFullChunk <|> count 3 hexaChar <|> count 2 hexaChar <|> count 1 hexaChar+ -- "Leading zeros MUST be suppressed" (RFC 5952, 4.1)+ let r' = T.dropWhile (=='0') $ T.pack r+ return $ if T.null r'+ then AllZeros+ -- Hexadecimal digits MUST be in lowercase (RFC 5952 4.3)+ else SixteenBit $ T.toLower r'++ipv4Addr :: Parser IPv6AddrToken+ipv4Addr = do+ n1 <- manyDigits <* "."+ if n1 /= T.empty+ then do n2 <- manyDigits <* "."+ if n2 /= T.empty+ then do n3 <- manyDigits <* "."+ if n3 /= T.empty+ then do n4 <- manyDigits+ if n4 /= T.empty+ then return $ IPv4Addr $ T.intercalate "." [n1,n2,n3,n4]+ else parserFailure+ else parserFailure+ else parserFailure+ else parserFailure+ where+ parserFailure = fail "ipv4Addr parsing failure"+ manyDigits = do+ ds <- takeWhile1 isDigit+ case R.decimal ds of+ Right (n,_) -> return (if n < 256 then T.pack $ show n else T.empty)+ Left _ -> return T.empty++doubleColon :: Parser IPv6AddrToken+doubleColon = do+ string "::"+ return DoubleColon++colon :: Parser IPv6AddrToken+colon = do+ string ":"+ return Colon++ipv6AddrFullChunk :: Parser String+ipv6AddrFullChunk = count 4 hexaChar++hexaChar :: Parser Char+hexaChar = satisfy (inClass "0-9a-fA-F")
+ tests/QC/IPv6/Types.hs view
@@ -0,0 +1,29 @@+-- -----------------------------------------------------------------------------++-- |+-- Module : Text.IPv6Addr+-- Copyright : Copyright © Michel Boucey 2011-2015+-- License : BSD-Style+-- Maintainer : michel.boucey@gmail.com+--+-- Dealing with IPv6 address text representations, canonization and manipulations.+--++-- -----------------------------------------------------------------------------++module QC.IPv6.Types where++import qualified Data.Text as T++data IPv6Addr = IPv6Addr T.Text++instance Show IPv6Addr where+ show (IPv6Addr addr) = T.unpack addr++data IPv6AddrToken+ = SixteenBit T.Text -- ^ A four hexadecimal digits group representing a 16-Bit chunk+ | AllZeros -- ^ An all zeros 16-Bit chunk+ | Colon -- ^ A separator between 16-Bit chunks+ | DoubleColon -- ^ A double-colon stands for a unique compression of many consecutive 16-Bit chunks+ | IPv4Addr T.Text -- ^ An embedded IPv4 address as representation of the last 32-Bit+ deriving (Eq,Show)
+ tests/QC/Rechunked.hs view
@@ -0,0 +1,56 @@+{-# LANGUAGE BangPatterns #-}++module QC.Rechunked (+ rechunkBS+ , rechunkT+ ) where++import Control.Monad (forM, forM_)+import Control.Monad.ST (ST, runST)+import Data.List (unfoldr)+import Test.QuickCheck (Gen, choose)+import qualified Data.ByteString as B+import qualified Data.Text as T+import qualified Data.Vector as V+import qualified Data.Vector.Generic as G+import qualified Data.Vector.Generic.Mutable as M++rechunkBS :: B.ByteString -> Gen [B.ByteString]+rechunkBS = fmap (map B.copy) . rechunk_ B.splitAt B.length++rechunkT :: T.Text -> Gen [T.Text]+rechunkT = fmap (map T.copy) . rechunk_ T.splitAt T.length++rechunk_ :: (Int -> a -> (a,a)) -> (a -> Int) -> a -> Gen [a]+rechunk_ split len xs = (unfoldr go . (,) xs) `fmap` rechunkSizes (len xs)+ where go (b,r:rs) = Just (h, (t,rs))+ where (h,t) = split r b+ go (_,_) = Nothing++rechunkSizes :: Int -> Gen [Int]+rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0+ where loop _ [] _ = error "it's 2015, where's my Stream type?"+ loop acc (lb:lbs) n+ | n <= 0 = shuffle (reverse acc)+ | otherwise = do+ !i <- choose (lb,n)+ loop (i:acc) lbs (n-i)++shuffle :: [Int] -> Gen [Int]+shuffle (0:xs) = (0:) `fmap` shuffle xs+shuffle xs = fisherYates xs++fisherYates :: [a] -> Gen [a]+fisherYates xs = (V.toList . V.backpermute v) `fmap` swapIndices (G.length v)+ where+ v = V.fromList xs+ swapIndices n0 = do+ swaps <- forM [0..n] $ \i -> ((,) i) `fmap` choose (i,n)+ return (runST (swapAll swaps))+ where+ n = n0 - 1+ swapAll :: [(Int,Int)] -> ST s (V.Vector Int)+ swapAll ijs = do+ mv <- G.unsafeThaw (G.enumFromTo 0 n :: V.Vector Int)+ forM_ ijs $ uncurry (M.swap mv)+ G.unsafeFreeze mv
+ tests/QC/Simple.hs view
@@ -0,0 +1,37 @@+{-# LANGUAGE OverloadedStrings #-}+{-# OPTIONS_GHC -fno-warn-missing-signatures #-}++module QC.Simple (+ tests+ ) where++import Control.Applicative ((<|>))+import Data.ByteString (ByteString)+import Data.List (foldl')+import Data.Maybe (fromMaybe)+import QC.Rechunked (rechunkBS)+import Test.Tasty (TestTree)+import Test.Tasty.QuickCheck (testProperty)+import Test.QuickCheck (Property, counterexample, forAll)+import qualified Data.Attoparsec.ByteString.Char8 as A++t_issue75 = expect issue75 "ab" (A.Done "" "b")++issue75 :: A.Parser ByteString+issue75 = "a" >> ("b" <|> "")++expect :: (Show r, Eq r) => A.Parser r -> ByteString -> A.Result r -> Property+expect p input wanted =+ forAll (rechunkBS input) $ \in' ->+ let result = parse p in'+ in counterexample (show result ++ " /= " ++ show wanted) $+ fromMaybe False (A.compareResults result wanted)++parse :: A.Parser r -> [ByteString] -> A.Result r+parse p (x:xs) = foldl' A.feed (A.parse p x) xs+parse p [] = A.parse p ""++tests :: [TestTree]+tests = [+ testProperty "issue75" t_issue75+ ]
+ tests/QC/Text.hs view
@@ -0,0 +1,203 @@+{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-}+{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}+module QC.Text (tests) where++#if !MIN_VERSION_base(4,8,0)+import Control.Applicative ((<*>), (<$>))+#endif+import Data.Int (Int64)+import Data.Word (Word8)+import Prelude hiding (take, takeWhile)+import QC.Common (liftOp, parseT)+import qualified QC.Text.FastSet as FastSet+import qualified QC.Text.Regressions as Regressions+import Test.Tasty (TestTree, testGroup)+import Test.Tasty.QuickCheck (testProperty)+import Test.QuickCheck+import qualified Data.Attoparsec.Text as P+import qualified Data.Attoparsec.Text.Lazy as PL+import qualified Data.Attoparsec.Text.FastSet as S+import qualified Data.ByteString as BS+import qualified Data.Char as Char+import qualified Data.Text as T+import qualified Data.Text.Encoding as TE+import qualified Data.Text.Lazy as L++-- Basic byte-level combinators.++satisfy :: Char -> L.Text -> Property+satisfy w s = parseT (P.satisfy (<=w)) (L.cons w s) === Just w++satisfyWith :: Char -> L.Text -> Property+satisfyWith c s = parseT (P.satisfyWith id (<=c)) (L.cons c s) === Just c++char :: Char -> L.Text -> Property+char w s = parseT (P.char w) (L.cons w s) === Just w++skip :: Char -> L.Text -> Property+skip w s =+ case (parseT (P.skip (<w)) s, L.uncons s) of+ (Nothing, mcs) -> maybe (property True) (expectFailure . it) mcs+ (Just _, mcs) -> maybe (property False) it mcs+ where it cs = liftOp "<" (<) (fst cs) w++anyChar :: L.Text -> Property+anyChar s+ | L.null s = p === Nothing+ | otherwise = p === Just (L.head s)+ where p = parseT P.anyChar s++notChar :: Char -> NonEmptyList Char -> Property+notChar w (NonEmpty s) = parseT (P.notChar w) bs === if v == w+ then Nothing+ else Just v+ where v = L.head bs+ bs = L.pack s++peekChar :: L.Text -> Property+peekChar s+ | L.null s = p === Just (Nothing, s)+ | otherwise = p === Just (Just (L.head s), s)+ where p = parseT ((,) <$> P.peekChar <*> P.takeLazyText) s++peekChar' :: L.Text -> Property+peekChar' s = parseT P.peekChar' s === (fst <$> L.uncons s)++string :: L.Text -> L.Text -> Property+string s t = parseT (P.string s') (s `L.append` t) === Just s'+ where s' = toStrict s++strings :: L.Text -> L.Text -> L.Text -> Property+strings s t u =+ parseT (P.string (toStrict s) >> P.string t') (L.concat [s,t,u])+ === Just t'+ where t' = toStrict t++-- | Note: "simple, and efficient" works for well formed input...+-- i.e. e.g. Latin1 texts+stringCI :: [Word8] -> Property+stringCI ws = P.parseOnly (P.stringCI fs) s === Right s+ where fs = T.toCaseFold s+ s = TE.decodeLatin1 (BS.pack ws)++asciiCI :: T.Text -> Gen Bool+asciiCI x =+ (\s i -> P.parseOnly (P.asciiCI s) i == Right i)+ <$> maybeModifyCase x+ <*> maybeModifyCase x+ where+ maybeModifyCase s = elements [s, toLower s, toUpper s]+ toLower = T.map (\c -> if c < Char.chr 127 then Char.toLower c else c)+ toUpper = T.map (\c -> if c < Char.chr 127 then Char.toUpper c else c)++toStrict :: L.Text -> T.Text+toStrict = T.concat . L.toChunks++skipWhile :: Char -> L.Text -> Property+skipWhile w s =+ let t = L.dropWhile (<=w) s+ in case PL.parse (P.skipWhile (<=w)) s of+ PL.Done t' () -> t === t'+ _ -> property False++take :: Int -> L.Text -> Property+take n s = maybe (liftOp "<" (<) (L.length s) (fromIntegral n))+ (=== T.take n (toStrict s)) $+ parseT (P.take n) s++takeText :: L.Text -> Property+takeText s = maybe (property False) (=== toStrict s) . parseT P.takeText $ s++takeLazyText :: L.Text -> Property+takeLazyText s = maybe (property False) (=== s) . parseT P.takeLazyText $ s++takeCount :: Positive Int -> L.Text -> Property+takeCount (Positive k) s =+ case parseT (P.take k) s of+ Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s)+ Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s)++takeWhile :: Char -> L.Text -> Property+takeWhile w s =+ let (h,t) = L.span (==w) s+ in case PL.parse (P.takeWhile (==w)) s of+ PL.Done t' h' -> t === t' .&&. toStrict h === h'+ _ -> property False++takeWhile1 :: Char -> L.Text -> Property+takeWhile1 w s =+ let s' = L.cons w s+ (h,t) = L.span (<=w) s'+ in case PL.parse (P.takeWhile1 (<=w)) s' of+ PL.Done t' h' -> t === t' .&&. toStrict h === h'+ _ -> property False++takeTill :: Char -> L.Text -> Property+takeTill w s =+ let (h,t) = L.break (==w) s+ in case PL.parse (P.takeTill (==w)) s of+ PL.Done t' h' -> t === t' .&&. toStrict h === h'+ _ -> property False++takeWhile1_empty :: Property+takeWhile1_empty = parseT (P.takeWhile1 undefined) L.empty === Nothing++endOfInput :: L.Text -> Property+endOfInput s = parseT P.endOfInput s === if L.null s+ then Just ()+ else Nothing++endOfLine :: L.Text -> Property+endOfLine s =+ case (parseT P.endOfLine s, L.uncons s) of+ (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs+ (Just _, mcs) -> maybe (property False) eol mcs+ where eol (c,s') = c === '\n' .||.+ (c, fst <$> L.uncons s') === ('\r', Just '\n')++scan :: L.Text -> Positive Int64 -> Property+-- for some reason, if counterexample is removed, this test fails?+scan s (Positive k) = counterexample (show s)+ $ parseT p s === Just (toStrict $ L.take k s)+ where p = P.scan k $ \ n _ ->+ if n > 0 then let !n' = n - 1 in Just n' else Nothing++members :: String -> Property+members s = property $ all (`S.member` set) s+ where set = S.fromList s++nonmembers :: String -> String -> Property+nonmembers s s' = property . not . any (`S.member` set) $ filter (not . (`elem` s)) s'+ where set = S.fromList s++tests :: [TestTree]+tests = [+ testProperty "anyChar" anyChar+ , testProperty "asciiCI" asciiCI+ , testProperty "char" char+ , testProperty "endOfInput" endOfInput+ , testProperty "endOfLine" endOfLine+ , testProperty "notChar" notChar+ , testProperty "peekChar" peekChar+ , testProperty "peekChar'" peekChar'+ , testProperty "satisfy" satisfy+ , testProperty "satisfyWith" satisfyWith+ , testProperty "scan" scan+ , testProperty "skip" skip+ , testProperty "skipWhile" skipWhile+ , testProperty "string" string+ , testProperty "strings" strings+ , testProperty "stringCI" stringCI+ , testProperty "take" take+ , testProperty "takeText" takeText+ , testProperty "takeCount" takeCount+ , testProperty "takeLazyText" takeLazyText+ , testProperty "takeTill" takeTill+ , testProperty "takeWhile" takeWhile+ , testProperty "takeWhile1" takeWhile1+ , testProperty "takeWhile1_empty" takeWhile1_empty+ , testProperty "members" members+ , testProperty "nonmembers" nonmembers+ , testGroup "FastSet" FastSet.tests+ , testGroup "Regressions" Regressions.tests+ ]
+ tests/QC/Text/FastSet.hs view
@@ -0,0 +1,15 @@+module QC.Text.FastSet where++import Test.Tasty (TestTree)+import Test.Tasty.QuickCheck (testProperty)+import Test.QuickCheck+import qualified Data.Attoparsec.Text.FastSet as FastSet++membershipCorrect :: String -> String -> Property+membershipCorrect members others =+ let fs = FastSet.fromList members+ correct c = (c `FastSet.member` fs) == (c `elem` members)+ in property $ all correct (members ++ others)++tests :: [TestTree]+tests = [ testProperty "membership is correct" membershipCorrect ]
+ tests/QC/Text/Regressions.hs view
@@ -0,0 +1,54 @@+{-# LANGUAGE OverloadedStrings #-}++module QC.Text.Regressions (+ tests+ ) where++import Data.Text (Text)+import qualified Data.Text as T+import Data.List (foldl')+import Data.Maybe (fromMaybe)+import Data.Char (isLower)+import Data.Monoid ((<>))+import QC.Rechunked (rechunkT)+import Test.Tasty (TestTree)+import Test.Tasty.QuickCheck (testProperty)+import Test.QuickCheck (Property, counterexample, forAll)+import qualified Data.Attoparsec.Text as A+++--------------------------------------------------------------------------------+-- 105 was about runScanner not always returning the final state. The result+-- did depend on how the data was fed to the parser.++t_issue105 :: Property+t_issue105 = expect issue105 "lowER" (A.Done "ER" "low")++issue105 :: A.Parser Text+issue105 = do+ (_, firstFourLowercaseLetters) <- A.runScanner "" f+ return $ firstFourLowercaseLetters++ where+ f :: Text -> Char -> Maybe Text+ f acc c = if T.length acc < 4 && isLower c+ then Just $ acc <> T.singleton c+ else Nothing+++expect :: (Show r, Eq r) => A.Parser r -> Text -> A.Result r -> Property+expect p input wanted =+ forAll (rechunkT input) $ \in' ->+ let result = parse p in'+ in counterexample (show result ++ " /= " ++ show wanted) $+ fromMaybe False (A.compareResults result wanted)++parse :: A.Parser r -> [Text] -> A.Result r+parse p (x:xs) = foldl' A.feed (A.parse p x) xs+parse p [] = A.parse p ""+++tests :: [TestTree]+tests = [+ testProperty "issue105" t_issue105+ ]
− tests/QCSupport.hs
@@ -1,52 +0,0 @@-{-# LANGUAGE FlexibleContexts, FlexibleInstances #-}-module QCSupport- (- NonEmpty(..)- ) where--import Control.Applicative-import Data.Attoparsec-import Data.Word (Word8)-import System.Random (RandomGen, Random(..))-import Test.QuickCheck hiding (NonEmpty)-import qualified Data.ByteString as S-import qualified Data.ByteString.Lazy as L--integralRandomR :: (Integral a, RandomGen g) => (a,a) -> g -> (a,g)-integralRandomR (a,b) g = case randomR (fromIntegral a :: Integer,- fromIntegral b :: Integer) g of- (x,g') -> (fromIntegral x, g')--newtype NonEmpty a = NonEmpty { nonEmpty :: a }- deriving (Eq, Ord, Read, Show)--instance Functor NonEmpty where- fmap f (NonEmpty a) = NonEmpty (f a)--instance Applicative NonEmpty where- NonEmpty f <*> NonEmpty a = NonEmpty (f a)- pure a = NonEmpty a--instance Arbitrary a => Arbitrary (NonEmpty [a]) where- arbitrary = NonEmpty <$> sized (\n -> choose (1,n+1) >>= vector)--instance Arbitrary S.ByteString where- arbitrary = S.pack <$> arbitrary--instance Arbitrary (NonEmpty S.ByteString) where- arbitrary = fmap S.pack <$> arbitrary--instance Arbitrary L.ByteString where- arbitrary = sized $ \n -> resize (round (sqrt (toEnum n :: Double)))- ((L.fromChunks . map nonEmpty) <$> arbitrary)--instance Arbitrary (NonEmpty L.ByteString) where- arbitrary = sized $ \n -> resize (round (sqrt (toEnum n :: Double)))- (fmap (L.fromChunks . map nonEmpty) <$> arbitrary)--instance Random Word8 where- randomR = integralRandomR- random = randomR (minBound,maxBound)--instance Arbitrary Word8 where- arbitrary = choose (minBound, maxBound)
− tests/TestFastSet.hs
@@ -1,25 +0,0 @@-module Main (main) where--import Data.Word (Word8)-import qualified Data.Attoparsec.FastSet as F-import System.Random (Random(..), RandomGen)-import Test.QuickCheck--integralRandomR :: (Integral a, RandomGen g) => (a, a) -> g -> (a, g)-integralRandomR (a,b) g = case randomR (fromIntegral a :: Int,- fromIntegral b :: Int) g- of (x,g') -> (fromIntegral x, g')--instance Random Word8 where- randomR = integralRandomR- random = randomR (minBound,maxBound)--instance Arbitrary Word8 where- arbitrary = choose (minBound, maxBound)--prop_AllMembers s =- let set = F.fromList s- in all (`F.memberWord8` set) s--main = do- quickCheck prop_AllMembers