diff --git a/Data/Attoparsec.hs b/Data/Attoparsec.hs --- a/Data/Attoparsec.hs +++ b/Data/Attoparsec.hs @@ -1,221 +1,23 @@ -- | -- Module : Data.Attoparsec --- Copyright : Bryan O'Sullivan 2007-2011 +-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 --- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- --- Simple, efficient combinator parsing for 'B.ByteString' strings, --- loosely based on the Parsec library. +-- Simple, efficient combinator parsing for +-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec +-- library. +-- +-- This module is deprecated. Use "Data.Attoparsec.ByteString" +-- instead. module Data.Attoparsec + {-# DEPRECATED "This module will be removed in the next major release." #-} ( - -- * Differences from Parsec - -- $parsec - - -- * Incremental input - -- $incremental - - -- * Performance considerations - -- $performance - - -- * Parser types - I.Parser - , Result(..) - - -- ** Typeclass instances - -- $instances - - -- * Running parsers - , parse - , feed - , I.parseOnly - , parseWith - , parseTest - - -- ** Result conversion - , maybeResult - , eitherResult - - -- * Combinators - , (I.) - , I.try - , module Data.Attoparsec.Combinator - - -- * Parsing individual bytes - , I.word8 - , I.anyWord8 - , I.notWord8 - , I.satisfy - , I.satisfyWith - , I.skip - - -- ** Byte classes - , I.inClass - , I.notInClass - - -- * Efficient string handling - , I.string - , I.skipWhile - , I.take - , I.scan - , I.takeWhile - , I.takeWhile1 - , I.takeTill - - -- ** Consume all remaining input - , I.takeByteString - , I.takeLazyByteString - - -- * State observation and manipulation functions - , I.endOfInput - , I.atEnd + module Data.Attoparsec.ByteString ) where -import Data.Attoparsec.Combinator -import qualified Data.Attoparsec.Internal as I -import qualified Data.ByteString as B -import Data.Attoparsec.Internal (Result(..), parse) - --- $parsec --- --- Compared to Parsec 3, Attoparsec makes several tradeoffs. It is --- not intended for, or ideal for, all possible uses. --- --- * While Attoparsec can consume input incrementally, Parsec cannot. --- Incremental input is a huge deal for efficient and secure network --- and system programming, since it gives much more control to users --- of the library over matters such as resource usage and the I/O --- model to use. --- --- * Much of the performance advantage of Attoparsec is gained via --- high-performance parsers such as 'I.takeWhile' and 'I.string'. --- If you use complicated combinators that return lists of bytes or --- characters, there is less performance difference between the two --- libraries. --- --- * Unlike Parsec 3, Attoparsec does not support being used as a --- monad transformer. --- --- * Attoparsec is specialised to deal only with strict 'B.ByteString' --- input. Efficiency concerns rule out both lists and lazy --- bytestrings. The usual use for lazy bytestrings would be to --- allow consumption of very large input without a large footprint. --- For this need, Attoparsec's incremental input provides an --- excellent substitute, with much more control over when input --- takes place. If you must use lazy bytestrings, see the 'Lazy' --- module, which feeds lazy chunks to a regular parser. --- --- * Parsec parsers can produce more helpful error messages than --- Attoparsec parsers. This is a matter of focus: Attoparsec avoids --- the extra book-keeping in favour of higher performance. - --- $incremental --- --- Attoparsec supports incremental input, meaning that you can feed it --- a bytestring that represents only part of the expected total amount --- of data to parse. If your parser reaches the end of a fragment of --- input and could consume more input, it will suspend parsing and --- return a 'Partial' continuation. --- --- Supplying the 'Partial' continuation with another bytestring will --- resume parsing at the point where it was suspended. You must be --- prepared for the result of the resumed parse to be another --- 'Partial' continuation. --- --- To indicate that you have no more input, supply the 'Partial' --- continuation with an empty bytestring. --- --- Remember that some parsing combinators will not return a result --- until they reach the end of input. They may thus cause 'Partial' --- results to be returned. --- --- If you do not need support for incremental input, consider using --- the 'I.parseOnly' function to run your parser. It will never --- prompt for more input. - --- $performance --- --- If you write an Attoparsec-based parser carefully, it can be --- realistic to expect it to perform within a factor of 2 of a --- hand-rolled C parser (measuring megabytes parsed per second). --- --- To actually achieve high performance, there are a few guidelines --- that it is useful to follow. --- --- Use the 'B.ByteString'-oriented parsers whenever possible, --- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyWord8'. There is --- about a factor of 100 difference in performance between the two --- kinds of parser. --- --- For very simple byte-testing predicates, write them by hand instead --- of using 'I.inClass' or 'I.notInClass'. For instance, both of --- these predicates test for an end-of-line byte, but the first is --- much faster than the second: --- --- >endOfLine_fast w = w == 13 || w == 10 --- >endOfLine_slow = inClass "\r\n" --- --- Make active use of benchmarking and profiling tools to measure, --- find the problems with, and improve the performance of your parser. - --- $instances --- --- The 'I.Parser' type is an instance of the following classes: --- --- * 'Monad', where 'fail' throws an exception (i.e. fails) with an --- error message. --- --- * 'Functor' and 'Applicative', which follow the usual definitions. --- --- * 'MonadPlus', where 'mzero' fails (with no error message) and --- 'mplus' executes the right-hand parser if the left-hand one --- fails. --- --- * 'Alternative', which follows 'MonadPlus'. --- --- The 'Result' type is an instance of 'Functor', where 'fmap' --- transforms the value in a 'Done' result. - --- | If a parser has returned a 'Partial' result, supply it with more --- input. -feed :: Result r -> B.ByteString -> Result r -feed f@(Fail _ _ _) _ = f -feed (Partial k) d = k d -feed (Done bs r) d = Done (B.append bs d) r -{-# INLINE feed #-} - --- | Run a parser and print its result to standard output. -parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO () -parseTest p s = print (parse p s) - --- | Run a parser with an initial input string, and a monadic action --- that can supply more input if needed. -parseWith :: Monad m => - (m B.ByteString) - -- ^ An action that will be executed to provide the parser - -- with more input, if necessary. The action must return an - -- 'B.empty' string when there is no more input available. - -> I.Parser a - -> B.ByteString - -- ^ Initial input for the parser. - -> m (Result a) -parseWith refill p s = step $ parse p s - where step (Partial k) = (step . k) =<< refill - step r = return r -{-# INLINE parseWith #-} - --- | Convert a 'Result' value to a 'Maybe' value. A 'Partial' result --- is treated as failure. -maybeResult :: Result r -> Maybe r -maybeResult (Done _ r) = Just r -maybeResult _ = Nothing - --- | Convert a 'Result' value to an 'Either' value. A 'Partial' result --- is treated as failure. -eitherResult :: Result r -> Either String r -eitherResult (Done _ r) = Right r -eitherResult (Fail _ _ msg) = Left msg -eitherResult _ = Left "Result: incomplete input" +import Data.Attoparsec.ByteString diff --git a/Data/Attoparsec/ByteString.hs b/Data/Attoparsec/ByteString.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/ByteString.hs @@ -0,0 +1,232 @@ +{-# LANGUAGE CPP #-} +#if __GLASGOW_HASKELL__ >= 702 +{-# LANGUAGE Trustworthy #-} +#endif +-- | +-- Module : Data.Attoparsec.ByteString +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient combinator parsing for 'B.ByteString' strings, +-- loosely based on the Parsec library. + +module Data.Attoparsec.ByteString + ( + -- * Differences from Parsec + -- $parsec + + -- * Incremental input + -- $incremental + + -- * Performance considerations + -- $performance + + -- * Parser types + I.Parser + , Result + , T.IResult(..) + , I.compareResults + + -- * Running parsers + , parse + , feed + , I.parseOnly + , parseWith + , parseTest + + -- ** Result conversion + , maybeResult + , eitherResult + + -- * Parsing individual bytes + , I.word8 + , I.anyWord8 + , I.notWord8 + , I.satisfy + , I.satisfyWith + , I.skip + + -- ** Lookahead + , I.peekWord8 + , I.peekWord8' + + -- ** Byte classes + , I.inClass + , I.notInClass + + -- * Efficient string handling + , I.string + , I.skipWhile + , I.take + , I.scan + , I.runScanner + , I.takeWhile + , I.takeWhile1 + , I.takeWhileIncluding + , I.takeTill + , I.getChunk + + -- ** Consume all remaining input + , I.takeByteString + , I.takeLazyByteString + + -- * Combinators + , try + , () + , choice + , count + , option + , many' + , many1 + , many1' + , manyTill + , manyTill' + , sepBy + , sepBy' + , sepBy1 + , sepBy1' + , skipMany + , skipMany1 + , eitherP + , I.match + -- * State observation and manipulation functions + , I.endOfInput + , I.atEnd + ) where + +import Data.Attoparsec.Combinator +import Data.List (intercalate) +import qualified Data.Attoparsec.ByteString.Internal as I +import qualified Data.Attoparsec.Internal as I +import qualified Data.ByteString as B +import Data.Attoparsec.ByteString.Internal (Result, parse) +import qualified Data.Attoparsec.Internal.Types as T + +-- $parsec +-- +-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is +-- not intended for, or ideal for, all possible uses. +-- +-- * While attoparsec can consume input incrementally, Parsec cannot. +-- Incremental input is a huge deal for efficient and secure network +-- and system programming, since it gives much more control to users +-- of the library over matters such as resource usage and the I/O +-- model to use. +-- +-- * Much of the performance advantage of attoparsec is gained via +-- high-performance parsers such as 'I.takeWhile' and 'I.string'. +-- If you use complicated combinators that return lists of bytes or +-- characters, there is less performance difference between the two +-- libraries. +-- +-- * Unlike Parsec 3, attoparsec does not support being used as a +-- monad transformer. +-- +-- * attoparsec is specialised to deal only with strict 'B.ByteString' +-- input. Efficiency concerns rule out both lists and lazy +-- bytestrings. The usual use for lazy bytestrings would be to +-- allow consumption of very large input without a large footprint. +-- For this need, attoparsec's incremental input provides an +-- excellent substitute, with much more control over when input +-- takes place. If you must use lazy bytestrings, see the +-- "Data.Attoparsec.ByteString.Lazy" module, which feeds lazy chunks +-- to a regular parser. +-- +-- * Parsec parsers can produce more helpful error messages than +-- attoparsec parsers. This is a matter of focus: attoparsec avoids +-- the extra book-keeping in favour of higher performance. + +-- $incremental +-- +-- attoparsec supports incremental input, meaning that you can feed it +-- a bytestring that represents only part of the expected total amount +-- of data to parse. If your parser reaches the end of a fragment of +-- input and could consume more input, it will suspend parsing and +-- return a 'T.Partial' continuation. +-- +-- Supplying the 'T.Partial' continuation with a bytestring will +-- resume parsing at the point where it was suspended, with the +-- bytestring you supplied used as new input at the end of the +-- existing input. You must be prepared for the result of the resumed +-- parse to be another 'T.Partial' continuation. +-- +-- To indicate that you have no more input, supply the 'T.Partial' +-- continuation with an empty bytestring. +-- +-- Remember that some parsing combinators will not return a result +-- until they reach the end of input. They may thus cause 'T.Partial' +-- results to be returned. +-- +-- If you do not need support for incremental input, consider using +-- the 'I.parseOnly' function to run your parser. It will never +-- prompt for more input. +-- +-- /Note/: incremental input does /not/ imply that attoparsec will +-- release portions of its internal state for garbage collection as it +-- proceeds. Its internal representation is equivalent to a single +-- 'ByteString': if you feed incremental input to a parser, it will +-- require memory proportional to the amount of input you supply. +-- (This is necessary to support arbitrary backtracking.) + +-- $performance +-- +-- If you write an attoparsec-based parser carefully, it can be +-- realistic to expect it to perform similarly to a hand-rolled C +-- parser (measuring megabytes parsed per second). +-- +-- To actually achieve high performance, there are a few guidelines +-- that it is useful to follow. +-- +-- Use the 'B.ByteString'-oriented parsers whenever possible, +-- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyWord8'. There is +-- about a factor of 100 difference in performance between the two +-- kinds of parser. +-- +-- For very simple byte-testing predicates, write them by hand instead +-- of using 'I.inClass' or 'I.notInClass'. For instance, both of +-- these predicates test for an end-of-line byte, but the first is +-- much faster than the second: +-- +-- >endOfLine_fast w = w == 13 || w == 10 +-- >endOfLine_slow = inClass "\r\n" +-- +-- Make active use of benchmarking and profiling tools to measure, +-- find the problems with, and improve the performance of your parser. + +-- | Run a parser and print its result to standard output. +parseTest :: (Show a) => I.Parser a -> B.ByteString -> IO () +parseTest p s = print (parse p s) + +-- | Run a parser with an initial input string, and a monadic action +-- that can supply more input if needed. +parseWith :: Monad m => + (m B.ByteString) + -- ^ An action that will be executed to provide the parser + -- with more input, if necessary. The action must return an + -- 'B.empty' string when there is no more input available. + -> I.Parser a + -> B.ByteString + -- ^ Initial input for the parser. + -> m (Result a) +parseWith refill p s = step $ parse p s + where step (T.Partial k) = (step . k) =<< refill + step r = return r +{-# INLINE parseWith #-} + +-- | Convert a 'Result' value to a 'Maybe' value. A 'T.Partial' result +-- is treated as failure. +maybeResult :: Result r -> Maybe r +maybeResult (T.Done _ r) = Just r +maybeResult _ = Nothing + +-- | Convert a 'Result' value to an 'Either' value. A 'T.Partial' +-- result is treated as failure. +eitherResult :: Result r -> Either String r +eitherResult (T.Done _ r) = Right r +eitherResult (T.Fail _ [] msg) = Left msg +eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) +eitherResult _ = Left "Result: incomplete input" diff --git a/Data/Attoparsec/ByteString/Char8.hs b/Data/Attoparsec/ByteString/Char8.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/ByteString/Char8.hs @@ -0,0 +1,581 @@ +{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeFamilies, + TypeSynonymInstances, GADTs #-} +#if __GLASGOW_HASKELL__ >= 702 +{-# LANGUAGE Trustworthy #-} -- Imports internal modules +#endif +{-# OPTIONS_GHC -fno-warn-orphans -fno-warn-warnings-deprecations #-} + +-- | +-- Module : Data.Attoparsec.ByteString.Char8 +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient, character-oriented combinator parsing for +-- 'B.ByteString' strings, loosely based on the Parsec library. + +module Data.Attoparsec.ByteString.Char8 + ( + -- * Character encodings + -- $encodings + + -- * Parser types + Parser + , A.Result + , A.IResult(..) + , I.compareResults + + -- * Running parsers + , A.parse + , A.feed + , A.parseOnly + , A.parseWith + , A.parseTest + + -- ** Result conversion + , A.maybeResult + , A.eitherResult + + -- * Parsing individual characters + , char + , char8 + , anyChar + , notChar + , satisfy + + -- ** Lookahead + , peekChar + , peekChar' + + -- ** Special character parsers + , digit + , letter_iso8859_15 + , letter_ascii + , space + + -- ** Fast predicates + , isDigit + , isDigit_w8 + , isAlpha_iso8859_15 + , isAlpha_ascii + , isSpace + , isSpace_w8 + + -- *** Character classes + , inClass + , notInClass + + -- * Efficient string handling + , I.string + , I.stringCI + , skipSpace + , skipWhile + , I.take + , scan + , takeWhile + , takeWhile1 + , takeTill + + -- ** String combinators + -- $specalt + , (.*>) + , (<*.) + + -- ** Consume all remaining input + , I.takeByteString + , I.takeLazyByteString + + -- * Text parsing + , I.endOfLine + , isEndOfLine + , isHorizontalSpace + + -- * Numeric parsers + , decimal + , hexadecimal + , signed + , double + , Number(..) + , number + , rational + , scientific + + -- * Combinators + , try + , () + , choice + , count + , option + , many' + , many1 + , many1' + , manyTill + , manyTill' + , sepBy + , sepBy' + , sepBy1 + , sepBy1' + , skipMany + , skipMany1 + , eitherP + , I.match + -- * State observation and manipulation functions + , I.endOfInput + , I.atEnd + ) where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative (pure, (*>), (<*), (<$>)) +import Data.Word (Word) +#endif +import Control.Applicative ((<|>)) +import Control.Monad (void, when) +import Data.Attoparsec.ByteString.FastSet (charClass, memberChar) +import Data.Attoparsec.ByteString.Internal (Parser) +import Data.Attoparsec.Combinator +import Data.Attoparsec.Number (Number(..)) +import Data.Bits (Bits, (.|.), shiftL) +import Data.ByteString.Internal (c2w, w2c) +import Data.Int (Int8, Int16, Int32, Int64) +import Data.String (IsString(..)) +import Data.Scientific (Scientific) +import qualified Data.Scientific as Sci +import Data.Word (Word8, Word16, Word32, Word64) +import Prelude hiding (takeWhile) +import qualified Data.Attoparsec.ByteString as A +import qualified Data.Attoparsec.ByteString.Internal as I +import qualified Data.Attoparsec.Internal as I +import qualified Data.ByteString as B8 +import qualified Data.ByteString.Char8 as B + +instance (a ~ B.ByteString) => IsString (Parser a) where + fromString = I.string . B.pack + +-- $encodings +-- +-- This module is intended for parsing text that is +-- represented using an 8-bit character set, e.g. ASCII or +-- ISO-8859-15. It /does not/ make any attempt to deal with character +-- encodings, multibyte characters, or wide characters. In +-- particular, all attempts to use characters above code point U+00FF +-- will give wrong answers. +-- +-- Code points below U+0100 are simply translated to and from their +-- numeric values, so e.g. the code point U+00A4 becomes the byte +-- @0xA4@ (which is the Euro symbol in ISO-8859-15, but the generic +-- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF +-- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@. + +-- | Consume input as long as the predicate returns 'True', and return +-- the consumed input. +-- +-- This parser requires the predicate to succeed on at least one byte +-- of input: it will fail if the predicate never returns 'True' or if +-- there is no input left. +takeWhile1 :: (Char -> Bool) -> Parser B.ByteString +takeWhile1 p = I.takeWhile1 (p . w2c) +{-# INLINE takeWhile1 #-} + +-- | The parser @satisfy p@ succeeds for any byte for which the +-- predicate @p@ returns 'True'. Returns the byte that is actually +-- parsed. +-- +-- >digit = satisfy isDigit +-- > where isDigit c = c >= '0' && c <= '9' +satisfy :: (Char -> Bool) -> Parser Char +satisfy = I.satisfyWith w2c +{-# INLINE satisfy #-} + +-- | Match a letter, in the ISO-8859-15 encoding. +letter_iso8859_15 :: Parser Char +letter_iso8859_15 = satisfy isAlpha_iso8859_15 "letter_iso8859_15" +{-# INLINE letter_iso8859_15 #-} + +-- | Match a letter, in the ASCII encoding. +letter_ascii :: Parser Char +letter_ascii = satisfy isAlpha_ascii "letter_ascii" +{-# INLINE letter_ascii #-} + +-- | A fast alphabetic predicate for the ISO-8859-15 encoding +-- +-- /Note/: For all character encodings other than ISO-8859-15, and +-- almost all Unicode code points above U+00A3, this predicate gives +-- /wrong answers/. +isAlpha_iso8859_15 :: Char -> Bool +isAlpha_iso8859_15 c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') || + (c >= '\166' && moby c) + where moby = notInClass "\167\169\171-\179\182\183\185\187\191\215\247" + {-# NOINLINE moby #-} +{-# INLINE isAlpha_iso8859_15 #-} + +-- | A fast alphabetic predicate for the ASCII encoding +-- +-- /Note/: For all character encodings other than ASCII, and +-- almost all Unicode code points above U+007F, this predicate gives +-- /wrong answers/. +isAlpha_ascii :: Char -> Bool +isAlpha_ascii c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') +{-# INLINE isAlpha_ascii #-} + +-- | Parse a single digit. +digit :: Parser Char +digit = satisfy isDigit "digit" +{-# INLINE digit #-} + +-- | A fast digit predicate. +isDigit :: Char -> Bool +isDigit c = c >= '0' && c <= '9' +{-# INLINE isDigit #-} + +-- | A fast digit predicate. +isDigit_w8 :: Word8 -> Bool +isDigit_w8 w = w - 48 <= 9 +{-# INLINE isDigit_w8 #-} + +-- | Match any character. +anyChar :: Parser Char +anyChar = satisfy $ const True +{-# INLINE anyChar #-} + +-- | Match any character, to perform lookahead. Returns 'Nothing' if +-- end of input has been reached. Does not consume any input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'many', because such parsers loop until a +-- failure occurs. Careless use will thus result in an infinite loop. +peekChar :: Parser (Maybe Char) +peekChar = (fmap w2c) `fmap` I.peekWord8 +{-# INLINE peekChar #-} + +-- | Match any character, to perform lookahead. Does not consume any +-- input, but will fail if end of input has been reached. +peekChar' :: Parser Char +peekChar' = w2c `fmap` I.peekWord8' +{-# INLINE peekChar' #-} + +-- | Fast predicate for matching ASCII space characters. +-- +-- /Note/: This predicate only gives correct answers for the ASCII +-- encoding. For instance, it does not recognise U+00A0 (non-breaking +-- space) as a space character, even though it is a valid ISO-8859-15 +-- byte. For a Unicode-aware and only slightly slower predicate, +-- use 'Data.Char.isSpace' +isSpace :: Char -> Bool +isSpace c = (c == ' ') || ('\t' <= c && c <= '\r') +{-# INLINE isSpace #-} + +-- | Fast 'Word8' predicate for matching ASCII space characters. +isSpace_w8 :: Word8 -> Bool +isSpace_w8 w = w == 32 || w - 9 <= 4 +{-# INLINE isSpace_w8 #-} + + +-- | Parse a space character. +-- +-- /Note/: This parser only gives correct answers for the ASCII +-- encoding. For instance, it does not recognise U+00A0 (non-breaking +-- space) as a space character, even though it is a valid ISO-8859-15 +-- byte. +space :: Parser Char +space = satisfy isSpace "space" +{-# INLINE space #-} + +-- | Match a specific character. +char :: Char -> Parser Char +char c = satisfy (== c) [c] +{-# INLINE char #-} + +-- | Match a specific character, but return its 'Word8' value. +char8 :: Char -> Parser Word8 +char8 c = I.satisfy (== c2w c) [c] +{-# INLINE char8 #-} + +-- | Match any character except the given one. +notChar :: Char -> Parser Char +notChar c = satisfy (/= c) "not " ++ [c] +{-# INLINE notChar #-} + +-- | Match any character in a set. +-- +-- >vowel = inClass "aeiou" +-- +-- Range notation is supported. +-- +-- >halfAlphabet = inClass "a-nA-N" +-- +-- To add a literal \'-\' to a set, place it at the beginning or end +-- of the string. +inClass :: String -> Char -> Bool +inClass s = (`memberChar` mySet) + where mySet = charClass s +{-# INLINE inClass #-} + +-- | Match any character not in a set. +notInClass :: String -> Char -> Bool +notInClass s = not . inClass s +{-# INLINE notInClass #-} + +-- | Consume input as long as the predicate returns 'True', and return +-- the consumed input. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'False' on the first byte of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'many', because such parsers loop until a +-- failure occurs. Careless use will thus result in an infinite loop. +takeWhile :: (Char -> Bool) -> Parser B.ByteString +takeWhile p = I.takeWhile (p . w2c) +{-# INLINE takeWhile #-} + +-- | A stateful scanner. The predicate consumes and transforms a +-- state argument, and each transformed state is passed to successive +-- invocations of the predicate on each byte of the input until one +-- returns 'Nothing' or the input ends. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'Nothing' on the first byte of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'many', because such parsers loop until a +-- failure occurs. Careless use will thus result in an infinite loop. +scan :: s -> (s -> Char -> Maybe s) -> Parser B.ByteString +scan s0 p = I.scan s0 (\s -> p s . w2c) +{-# INLINE scan #-} + +-- | Consume input as long as the predicate returns 'False' +-- (i.e. until it returns 'True'), and return the consumed input. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'True' on the first byte of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'many', because such parsers loop until a +-- failure occurs. Careless use will thus result in an infinite loop. +takeTill :: (Char -> Bool) -> Parser B.ByteString +takeTill p = I.takeTill (p . w2c) +{-# INLINE takeTill #-} + +-- | Skip past input for as long as the predicate returns 'True'. +skipWhile :: (Char -> Bool) -> Parser () +skipWhile p = I.skipWhile (p . w2c) +{-# INLINE skipWhile #-} + +-- | Skip over white space. +skipSpace :: Parser () +skipSpace = I.skipWhile isSpace_w8 +{-# INLINE skipSpace #-} + +-- $specalt +-- +-- If you enable the @OverloadedStrings@ language extension, you can +-- use the '*>' and '<*' combinators to simplify the common task of +-- matching a statically known string, then immediately parsing +-- something else. +-- +-- Instead of writing something like this: +-- +-- @ +--'I.string' \"foo\" '*>' wibble +-- @ +-- +-- Using @OverloadedStrings@, you can omit the explicit use of +-- 'I.string', and write a more compact version: +-- +-- @ +-- \"foo\" '*>' wibble +-- @ +-- +-- (Note: the '.*>' and '<*.' combinators that were originally +-- provided for this purpose are obsolete and unnecessary, and will be +-- removed in the next major version.) + +-- | /Obsolete/. A type-specialized version of '*>' for +-- 'B.ByteString'. Use '*>' instead. +(.*>) :: B.ByteString -> Parser a -> Parser a +s .*> f = I.string s *> f +{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-} + +-- | /Obsolete/. A type-specialized version of '<*' for +-- 'B.ByteString'. Use '<*' instead. +(<*.) :: Parser a -> B.ByteString -> Parser a +f <*. s = f <* I.string s +{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-} + +-- | A predicate that matches either a carriage return @\'\\r\'@ or +-- newline @\'\\n\'@ character. +isEndOfLine :: Word8 -> Bool +isEndOfLine w = w == 13 || w == 10 +{-# INLINE isEndOfLine #-} + +-- | A predicate that matches either a space @\' \'@ or horizontal tab +-- @\'\\t\'@ character. +isHorizontalSpace :: Word8 -> Bool +isHorizontalSpace w = w == 32 || w == 9 +{-# INLINE isHorizontalSpace #-} + +-- | Parse and decode an unsigned hexadecimal number. The hex digits +-- @\'a\'@ through @\'f\'@ may be upper or lower case. +-- +-- This parser does not accept a leading @\"0x\"@ string. +hexadecimal :: (Integral a, Bits a) => Parser a +hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit + where + isHexDigit w = (w >= 48 && w <= 57) || + (w >= 97 && w <= 102) || + (w >= 65 && w <= 70) + step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48) + | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87) + | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55) +{-# SPECIALISE hexadecimal :: Parser Int #-} +{-# SPECIALISE hexadecimal :: Parser Int8 #-} +{-# SPECIALISE hexadecimal :: Parser Int16 #-} +{-# SPECIALISE hexadecimal :: Parser Int32 #-} +{-# SPECIALISE hexadecimal :: Parser Int64 #-} +{-# SPECIALISE hexadecimal :: Parser Integer #-} +{-# SPECIALISE hexadecimal :: Parser Word #-} +{-# SPECIALISE hexadecimal :: Parser Word8 #-} +{-# SPECIALISE hexadecimal :: Parser Word16 #-} +{-# SPECIALISE hexadecimal :: Parser Word32 #-} +{-# SPECIALISE hexadecimal :: Parser Word64 #-} + +-- | Parse and decode an unsigned decimal number. +decimal :: Integral a => Parser a +decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDigit_w8 + where step a w = a * 10 + fromIntegral (w - 48) +{-# SPECIALISE decimal :: Parser Int #-} +{-# SPECIALISE decimal :: Parser Int8 #-} +{-# SPECIALISE decimal :: Parser Int16 #-} +{-# SPECIALISE decimal :: Parser Int32 #-} +{-# SPECIALISE decimal :: Parser Int64 #-} +{-# SPECIALISE decimal :: Parser Integer #-} +{-# SPECIALISE decimal :: Parser Word #-} +{-# SPECIALISE decimal :: Parser Word8 #-} +{-# SPECIALISE decimal :: Parser Word16 #-} +{-# SPECIALISE decimal :: Parser Word32 #-} +{-# SPECIALISE decimal :: Parser Word64 #-} + +-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign +-- character. +signed :: Num a => Parser a -> Parser a +{-# SPECIALISE signed :: Parser Int -> Parser Int #-} +{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-} +{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-} +{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-} +{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-} +{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-} +signed p = (negate <$> (char8 '-' *> p)) + <|> (char8 '+' *> p) + <|> p + +-- | Parse a rational number. +-- +-- The syntax accepted by this parser is the same as for 'double'. +-- +-- /Note/: this parser is not safe for use with inputs from untrusted +-- sources. An input with a suitably large exponent such as +-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated, +-- resulting in what is effectively a denial-of-service attack. +-- +-- In most cases, it is better to use 'double' or 'scientific' +-- instead. +rational :: Fractional a => Parser a +{-# SPECIALIZE rational :: Parser Double #-} +{-# SPECIALIZE rational :: Parser Float #-} +{-# SPECIALIZE rational :: Parser Rational #-} +{-# SPECIALIZE rational :: Parser Scientific #-} +rational = scientifically realToFrac + +-- | Parse a 'Double'. +-- +-- This parser accepts an optional leading sign character, followed by +-- at most one decimal digit. The syntax is similar to that accepted by +-- the 'read' function, with the exception that a trailing @\'.\'@ is +-- consumed. +-- +-- === Examples +-- +-- These examples use this helper: +-- +-- @ +-- r :: 'Parser' a -> 'Data.ByteString.ByteString' -> 'Data.Attoparsec.ByteString.Result' a +-- r p s = 'feed' ('Data.Attoparsec.parse' p s) 'mempty' +-- @ +-- +-- Examples with behaviour identical to 'read', if you feed an empty +-- continuation to the first result: +-- +-- > double "3" == Done "" 3.0 +-- > double "3.1" == Done "" 3.1 +-- > double "3e4" == Done "" 30000.0 +-- > double "3.1e4" == Done "" 31000.0 +-- > double "3e" == Done "e" 3.0 +-- +-- Examples with behaviour identical to 'read': +-- +-- > double ".3" == Fail ".3" _ _ +-- > double "e3" == Fail "e3" _ _ +-- +-- Example of difference from 'read': +-- +-- > double "3.foo" == Done "foo" 3.0 +-- +-- This function does not accept string representations of \"NaN\" or +-- \"Infinity\". +double :: Parser Double +double = scientifically Sci.toRealFloat + +-- | Parse a number, attempting to preserve both speed and precision. +-- +-- The syntax accepted by this parser is the same as for 'double'. +number :: Parser Number +number = scientifically $ \s -> + let e = Sci.base10Exponent s + c = Sci.coefficient s + in if e >= 0 + then I (c * 10 ^ e) + else D (Sci.toRealFloat s) +{-# DEPRECATED number "Use 'scientific' instead." #-} + +-- | Parse a scientific number. +-- +-- The syntax accepted by this parser is the same as for 'double'. +scientific :: Parser Scientific +scientific = scientifically id + +-- A strict pair +data SP = SP !Integer {-# UNPACK #-}!Int + +{-# INLINE scientifically #-} +scientifically :: (Scientific -> a) -> Parser a +scientifically h = do + let minus = 45 + plus = 43 + sign <- I.peekWord8' + let !positive = sign == plus || sign /= minus + when (sign == plus || sign == minus) $ + void $ I.anyWord8 + + n <- decimal + + let f fracDigits = SP (B8.foldl' step n fracDigits) + (negate $ B8.length fracDigits) + step a w = a * 10 + fromIntegral (w - 48) + + dotty <- I.peekWord8 + -- '.' -> ascii 46 + SP c e <- case dotty of + Just 46 -> I.anyWord8 *> (f <$> I.takeWhile isDigit_w8) + _ -> pure (SP n 0) + + let !signedCoeff | positive = c + | otherwise = -c + + let littleE = 101 + bigE = 69 + (I.satisfy (\ex -> ex == littleE || ex == bigE) *> + fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|> + return (h $ Sci.scientific signedCoeff e) diff --git a/Data/Attoparsec/ByteString/Internal.hs b/Data/Attoparsec/ByteString/Internal.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/ByteString/Internal.hs @@ -0,0 +1,590 @@ +{-# LANGUAGE BangPatterns, CPP, GADTs, OverloadedStrings, RankNTypes, + RecordWildCards #-} +-- | +-- Module : Data.Attoparsec.ByteString.Internal +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient parser combinators for 'ByteString' strings, +-- loosely based on the Parsec library. + +module Data.Attoparsec.ByteString.Internal + ( + -- * Parser types + Parser + , Result + + -- * Running parsers + , parse + , parseOnly + + -- * Combinators + , module Data.Attoparsec.Combinator + + -- * Parsing individual bytes + , satisfy + , satisfyWith + , anyWord8 + , skip + , word8 + , notWord8 + + -- ** Lookahead + , peekWord8 + , peekWord8' + + -- ** Byte classes + , inClass + , notInClass + + -- * Parsing more complicated structures + , storable + + -- * Efficient string handling + , skipWhile + , string + , stringCI + , take + , scan + , runScanner + , takeWhile + , takeWhile1 + , takeWhileIncluding + , takeTill + , getChunk + + -- ** Consume all remaining input + , takeByteString + , takeLazyByteString + + -- * Utilities + , endOfLine + , endOfInput + , match + , atEnd + ) where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((<$>)) +#endif +import Control.Applicative ((<|>)) +import Control.Monad (when) +import Data.Attoparsec.ByteString.Buffer (Buffer, buffer) +import Data.Attoparsec.ByteString.FastSet (charClass, memberWord8) +import Data.Attoparsec.Combinator (()) +import Data.Attoparsec.Internal +import Data.Attoparsec.Internal.Compat +import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO) +import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success) +import Data.ByteString (ByteString) +import Data.List (intercalate) +import Data.Word (Word8) +import Foreign.ForeignPtr (withForeignPtr) +import Foreign.Ptr (castPtr, minusPtr, plusPtr) +import Foreign.Storable (Storable(peek, sizeOf)) +import Prelude hiding (getChar, succ, take, takeWhile) +import qualified Data.Attoparsec.ByteString.Buffer as Buf +import qualified Data.Attoparsec.Internal.Types as T +import qualified Data.ByteString as B8 +import qualified Data.ByteString.Char8 as B +import qualified Data.ByteString.Internal as B +import qualified Data.ByteString.Lazy as L +import qualified Data.ByteString.Unsafe as B + +type Parser = T.Parser ByteString +type Result = IResult ByteString +type Failure r = T.Failure ByteString Buffer r +type Success a r = T.Success ByteString Buffer a r + +-- | The parser @satisfy p@ succeeds for any byte for which the +-- predicate @p@ returns 'True'. Returns the byte that is actually +-- parsed. +-- +-- >digit = satisfy isDigit +-- > where isDigit w = w >= 48 && w <= 57 +satisfy :: (Word8 -> Bool) -> Parser Word8 +satisfy p = do + h <- peekWord8' + if p h + then advance 1 >> return h + else fail "satisfy" +{-# INLINE satisfy #-} + +-- | The parser @skip p@ succeeds for any byte for which the predicate +-- @p@ returns 'True'. +-- +-- >skipDigit = skip isDigit +-- > where isDigit w = w >= 48 && w <= 57 +skip :: (Word8 -> Bool) -> Parser () +skip p = do + h <- peekWord8' + if p h + then advance 1 + else fail "skip" + +-- | The parser @satisfyWith f p@ transforms a byte, and succeeds if +-- the predicate @p@ returns 'True' on the transformed value. The +-- parser returns the transformed byte that was parsed. +satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a +satisfyWith f p = do + h <- peekWord8' + let c = f h + if p c + then advance 1 >> return c + else fail "satisfyWith" +{-# INLINE satisfyWith #-} + +storable :: Storable a => Parser a +storable = hack undefined + where + hack :: Storable b => b -> Parser b + hack dummy = do + (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy) + return . inlinePerformIO . withForeignPtr fp $ \p -> + peek (castPtr $ p `plusPtr` o) + +-- | Consume exactly @n@ bytes of input. +take :: Int -> Parser ByteString +take n0 = do + let n = max n0 0 + s <- ensure n + advance n >> return s +{-# INLINE take #-} + +-- | @string s@ parses a sequence of bytes that identically match +-- @s@. Returns the parsed string (i.e. @s@). This parser consumes no +-- input if it fails (even if a partial match). +-- +-- /Note/: The behaviour of this parser is different to that of the +-- similarly-named parser in Parsec, as this one is all-or-nothing. +-- To illustrate the difference, the following parser will fail under +-- Parsec given an input of @\"for\"@: +-- +-- >string "foo" <|> string "for" +-- +-- The reason for its failure is that the first branch is a +-- partial match, and will consume the letters @\'f\'@ and @\'o\'@ +-- before failing. In attoparsec, the above parser will /succeed/ on +-- that input, because the failed first branch will consume nothing. +string :: ByteString -> Parser ByteString +string s = string_ (stringSuspended id) id s +{-# INLINE string #-} + +-- ASCII-specific but fast, oh yes. +toLower :: Word8 -> Word8 +toLower w | w >= 65 && w <= 90 = w + 32 + | otherwise = w + +-- | Satisfy a literal string, ignoring case. +stringCI :: ByteString -> Parser ByteString +stringCI s = string_ (stringSuspended lower) lower s + where lower = B8.map toLower +{-# INLINE stringCI #-} + +string_ :: (forall r. ByteString -> ByteString -> Buffer -> Pos -> More + -> Failure r -> Success ByteString r -> Result r) + -> (ByteString -> ByteString) + -> ByteString -> Parser ByteString +string_ suspended f s0 = T.Parser $ \t pos more lose succ -> + let n = B.length s + s = f s0 + in if lengthAtLeast pos n t + then let t' = substring pos (Pos n) t + in if s == f t' + then succ t (pos + Pos n) more t' + else lose t pos more [] "string" + else let t' = Buf.unsafeDrop (fromPos pos) t + in if f t' `B.isPrefixOf` s + then suspended s (B.drop (B.length t') s) t pos more lose succ + else lose t pos more [] "string" +{-# INLINE string_ #-} + +stringSuspended :: (ByteString -> ByteString) + -> ByteString -> ByteString -> Buffer -> Pos -> More + -> Failure r + -> Success ByteString r + -> Result r +stringSuspended f s0 s t pos more lose succ = + runParser (demandInput_ >>= go) t pos more lose succ + where go s'0 = T.Parser $ \t' pos' more' lose' succ' -> + let m = B.length s + s' = f s'0 + n = B.length s' + in if n >= m + then if B.unsafeTake m s' == s + then let o = Pos (B.length s0) + in succ' t' (pos' + o) more' + (substring pos' o t') + else lose' t' pos' more' [] "string" + else if s' == B.unsafeTake n s + then stringSuspended f s0 (B.unsafeDrop n s) + t' pos' more' lose' succ' + else lose' t' pos' more' [] "string" + +-- | Skip past input for as long as the predicate returns 'True'. +skipWhile :: (Word8 -> Bool) -> Parser () +skipWhile p = go + where + go = do + t <- B8.takeWhile p <$> get + continue <- inputSpansChunks (B.length t) + when continue go +{-# INLINE skipWhile #-} + +-- | Consume input as long as the predicate returns 'False' +-- (i.e. until it returns 'True'), and return the consumed input. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'True' on the first byte of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +takeTill :: (Word8 -> Bool) -> Parser ByteString +takeTill p = takeWhile (not . p) +{-# INLINE takeTill #-} + +-- | Consume input as long as the predicate returns 'True', and return +-- the consumed input. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'False' on the first byte of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +takeWhile :: (Word8 -> Bool) -> Parser ByteString +takeWhile p = do + s <- B8.takeWhile p <$> get + continue <- inputSpansChunks (B.length s) + if continue + then takeWhileAcc p [s] + else return s +{-# INLINE takeWhile #-} + +takeWhileAcc :: (Word8 -> Bool) -> [ByteString] -> Parser ByteString +takeWhileAcc p = go + where + go acc = do + s <- B8.takeWhile p <$> get + continue <- inputSpansChunks (B.length s) + if continue + then go (s:acc) + else return $ concatReverse (s:acc) +{-# INLINE takeWhileAcc #-} + +-- | Consume input until immediately after the predicate returns 'True', and return +-- the consumed input. +-- +-- This parser will consume at least one 'Word8' or fail. +takeWhileIncluding :: (Word8 -> Bool) -> Parser B.ByteString +takeWhileIncluding p = do + (s', t) <- B8.span p <$> get + case B8.uncons t of + -- Since we reached a break point and managed to get the next byte, + -- input can not have been exhausted thus we succed and advance unconditionally. + Just (h, _) -> do + let s = s' `B8.snoc` h + advance (B8.length s) + return s + -- The above isn't true so either we ran out of input or we need to process the next chunk. + Nothing -> do + continue <- inputSpansChunks (B8.length s') + if continue + then takeWhileIncAcc p [s'] + -- Our spec says that if we run out of input we fail. + else fail "takeWhileIncluding reached end of input" +{-# INLINE takeWhileIncluding #-} + +takeWhileIncAcc :: (Word8 -> Bool) -> [B.ByteString] -> Parser B.ByteString +takeWhileIncAcc p = go + where + go acc = do + (s', t) <- B8.span p <$> get + case B8.uncons t of + Just (h, _) -> do + let s = s' `B8.snoc` h + advance (B8.length s) + return (concatReverse $ s:acc) + Nothing -> do + continue <- inputSpansChunks (B8.length s') + if continue + then go (s':acc) + else fail "takeWhileIncAcc reached end of input" +{-# INLINE takeWhileIncAcc #-} + +takeRest :: Parser [ByteString] +takeRest = go [] + where + go acc = do + input <- wantInput + if input + then do + s <- get + advance (B.length s) + go (s:acc) + else return (reverse acc) + +-- | Consume all remaining input and return it as a single string. +takeByteString :: Parser ByteString +takeByteString = B.concat `fmap` takeRest + +-- | Consume all remaining input and return it as a single string. +takeLazyByteString :: Parser L.ByteString +takeLazyByteString = L.fromChunks `fmap` takeRest + +-- | Return the rest of the current chunk without consuming anything. +-- +-- If the current chunk is empty, then ask for more input. +-- If there is no more input, then return 'Nothing' +getChunk :: Parser (Maybe ByteString) +getChunk = do + input <- wantInput + if input + then Just <$> get + else return Nothing + +data T s = T {-# UNPACK #-} !Int s + +scan_ :: (s -> [ByteString] -> Parser r) -> s -> (s -> Word8 -> Maybe s) + -> Parser r +scan_ f s0 p = go [] s0 + where + go acc s1 = do + let scanner bs = withPS bs $ \fp off len -> + withForeignPtr fp $ \ptr0 -> do + let start = ptr0 `plusPtr` off + end = start `plusPtr` len + inner ptr !s + | ptr < end = do + w <- peek ptr + case p s w of + Just s' -> inner (ptr `plusPtr` 1) s' + _ -> done (ptr `minusPtr` start) s + | otherwise = done (ptr `minusPtr` start) s + done !i !s = return (T i s) + inner start s1 + bs <- get + let T i s' = inlinePerformIO $ scanner bs + !h = B.unsafeTake i bs + continue <- inputSpansChunks i + if continue + then go (h:acc) s' + else f s' (h:acc) +{-# INLINE scan_ #-} + +-- | A stateful scanner. The predicate consumes and transforms a +-- state argument, and each transformed state is passed to successive +-- invocations of the predicate on each byte of the input until one +-- returns 'Nothing' or the input ends. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'Nothing' on the first byte of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +scan :: s -> (s -> Word8 -> Maybe s) -> Parser ByteString +scan = scan_ $ \_ chunks -> return $! concatReverse chunks +{-# INLINE scan #-} + +-- | Like 'scan', but generalized to return the final state of the +-- scanner. +runScanner :: s -> (s -> Word8 -> Maybe s) -> Parser (ByteString, s) +runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s) +{-# INLINE runScanner #-} + +-- | Consume input as long as the predicate returns 'True', and return +-- the consumed input. +-- +-- This parser requires the predicate to succeed on at least one byte +-- of input: it will fail if the predicate never returns 'True' or if +-- there is no input left. +takeWhile1 :: (Word8 -> Bool) -> Parser ByteString +takeWhile1 p = do + (`when` demandInput) =<< endOfChunk + s <- B8.takeWhile p <$> get + let len = B.length s + if len == 0 + then fail "takeWhile1" + else do + advance len + eoc <- endOfChunk + if eoc + then takeWhileAcc p [s] + else return s +{-# INLINE takeWhile1 #-} + +-- | Match any byte in a set. +-- +-- >vowel = inClass "aeiou" +-- +-- Range notation is supported. +-- +-- >halfAlphabet = inClass "a-nA-N" +-- +-- To add a literal @\'-\'@ to a set, place it at the beginning or end +-- of the string. +inClass :: String -> Word8 -> Bool +inClass s = (`memberWord8` mySet) + where mySet = charClass s + {-# NOINLINE mySet #-} +{-# INLINE inClass #-} + +-- | Match any byte not in a set. +notInClass :: String -> Word8 -> Bool +notInClass s = not . inClass s +{-# INLINE notInClass #-} + +-- | Match any byte. +anyWord8 :: Parser Word8 +anyWord8 = satisfy $ const True +{-# INLINE anyWord8 #-} + +-- | Match a specific byte. +word8 :: Word8 -> Parser Word8 +word8 c = satisfy (== c) show c +{-# INLINE word8 #-} + +-- | Match any byte except the given one. +notWord8 :: Word8 -> Parser Word8 +notWord8 c = satisfy (/= c) "not " ++ show c +{-# INLINE notWord8 #-} + +-- | Match any byte, to perform lookahead. Returns 'Nothing' if end of +-- input has been reached. Does not consume any input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +peekWord8 :: Parser (Maybe Word8) +peekWord8 = T.Parser $ \t pos@(Pos pos_) more _lose succ -> + case () of + _| pos_ < Buf.length t -> + let !w = Buf.unsafeIndex t pos_ + in succ t pos more (Just w) + | more == Complete -> + succ t pos more Nothing + | otherwise -> + let succ' t' pos' more' = let !w = Buf.unsafeIndex t' pos_ + in succ t' pos' more' (Just w) + lose' t' pos' more' = succ t' pos' more' Nothing + in prompt t pos more lose' succ' +{-# INLINE peekWord8 #-} + +-- | Match any byte, to perform lookahead. Does not consume any +-- input, but will fail if end of input has been reached. +peekWord8' :: Parser Word8 +peekWord8' = T.Parser $ \t pos more lose succ -> + if lengthAtLeast pos 1 t + then succ t pos more (Buf.unsafeIndex t (fromPos pos)) + else let succ' t' pos' more' bs' = succ t' pos' more' $! B.unsafeHead bs' + in ensureSuspended 1 t pos more lose succ' +{-# INLINE peekWord8' #-} + +-- | Match either a single newline character @\'\\n\'@, or a carriage +-- return followed by a newline character @\"\\r\\n\"@. +endOfLine :: Parser () +endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ()) + +-- | Terminal failure continuation. +failK :: Failure a +failK t (Pos pos) _more stack msg = Fail (Buf.unsafeDrop pos t) stack msg +{-# INLINE failK #-} + +-- | Terminal success continuation. +successK :: Success a a +successK t (Pos pos) _more a = Done (Buf.unsafeDrop pos t) a +{-# INLINE successK #-} + +-- | Run a parser. +parse :: Parser a -> ByteString -> Result a +parse m s = T.runParser m (buffer s) (Pos 0) Incomplete failK successK +{-# INLINE parse #-} + +-- | Run a parser that cannot be resupplied via a 'Partial' result. +-- +-- This function does not force a parser to consume all of its input. +-- Instead, any residual input will be discarded. To force a parser +-- to consume all of its input, use something like this: +-- +-- @ +--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput') +-- @ +parseOnly :: Parser a -> ByteString -> Either String a +parseOnly m s = case T.runParser m (buffer s) (Pos 0) Complete failK successK of + Fail _ [] err -> Left err + Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err) + Done _ a -> Right a + _ -> error "parseOnly: impossible error!" +{-# INLINE parseOnly #-} + +get :: Parser ByteString +get = T.Parser $ \t pos more _lose succ -> + succ t pos more (Buf.unsafeDrop (fromPos pos) t) +{-# INLINE get #-} + +endOfChunk :: Parser Bool +endOfChunk = T.Parser $ \t pos more _lose succ -> + succ t pos more (fromPos pos == Buf.length t) +{-# INLINE endOfChunk #-} + +inputSpansChunks :: Int -> Parser Bool +inputSpansChunks i = T.Parser $ \t pos_ more _lose succ -> + let pos = pos_ + Pos i + in if fromPos pos < Buf.length t || more == Complete + then succ t pos more False + else let lose' t' pos' more' = succ t' pos' more' False + succ' t' pos' more' = succ t' pos' more' True + in prompt t pos more lose' succ' +{-# INLINE inputSpansChunks #-} + +advance :: Int -> Parser () +advance n = T.Parser $ \t pos more _lose succ -> + succ t (pos + Pos n) more () +{-# INLINE advance #-} + +ensureSuspended :: Int -> Buffer -> Pos -> More + -> Failure r + -> Success ByteString r + -> Result r +ensureSuspended n t pos more lose succ = + runParser (demandInput >> go) t pos more lose succ + where go = T.Parser $ \t' pos' more' lose' succ' -> + if lengthAtLeast pos' n t' + then succ' t' pos' more' (substring pos (Pos n) t') + else runParser (demandInput >> go) t' pos' more' lose' succ' + +-- | If at least @n@ elements of input are available, return the +-- current input, otherwise fail. +ensure :: Int -> Parser ByteString +ensure n = T.Parser $ \t pos more lose succ -> + if lengthAtLeast pos n t + then succ t pos more (substring pos (Pos n) t) + -- The uncommon case is kept out-of-line to reduce code size: + else ensureSuspended n t pos more lose succ +{-# INLINE ensure #-} + +-- | Return both the result of a parse and the portion of the input +-- that was consumed while it was being parsed. +match :: Parser a -> Parser (ByteString, a) +match p = T.Parser $ \t pos more lose succ -> + let succ' t' pos' more' a = + succ t' pos' more' (substring pos (pos'-pos) t', a) + in runParser p t pos more lose succ' + +lengthAtLeast :: Pos -> Int -> Buffer -> Bool +lengthAtLeast (Pos pos) n bs = Buf.length bs >= pos + n +{-# INLINE lengthAtLeast #-} + +substring :: Pos -> Pos -> Buffer -> ByteString +substring (Pos pos) (Pos n) = Buf.substring pos n +{-# INLINE substring #-} diff --git a/Data/Attoparsec/ByteString/Lazy.hs b/Data/Attoparsec/ByteString/Lazy.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/ByteString/Lazy.hs @@ -0,0 +1,124 @@ +{-# LANGUAGE CPP #-} +#if __GLASGOW_HASKELL__ >= 702 +{-# LANGUAGE Trustworthy #-} -- Imports internal modules +#endif + +-- | +-- Module : Data.Attoparsec.ByteString.Lazy +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient combinator parsing that can consume lazy +-- 'ByteString' strings, loosely based on the Parsec library. +-- +-- This is essentially the same code as in the 'Data.Attoparsec' +-- module, only with a 'parse' function that can consume a lazy +-- 'ByteString' incrementally, and a 'Result' type that does not allow +-- more input to be fed in. Think of this as suitable for use with a +-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'. +-- +-- /Note:/ The various parser functions and combinators such as +-- 'string' still expect /strict/ 'B.ByteString' parameters, and +-- return strict 'B.ByteString' results. Behind the scenes, strict +-- 'B.ByteString' values are still used internally to store parser +-- input and manipulate it efficiently. + +module Data.Attoparsec.ByteString.Lazy + ( + Result(..) + , module Data.Attoparsec.ByteString + -- * Running parsers + , parse + , parseOnly + , parseTest + -- ** Result conversion + , maybeResult + , eitherResult + ) where + +import Control.DeepSeq (NFData(rnf)) +import Data.ByteString.Lazy.Internal (ByteString(..), chunk) +import Data.List (intercalate) +import qualified Data.ByteString as B +import qualified Data.Attoparsec.ByteString as A +import qualified Data.Attoparsec.Internal.Types as T +import Data.Attoparsec.ByteString + hiding (IResult(..), Result, eitherResult, maybeResult, + parse, parseOnly, parseWith, parseTest) + +-- | The result of a parse. +data Result r = Fail ByteString [String] String + -- ^ The parse failed. The 'ByteString' is the input + -- that had not yet been consumed when the failure + -- occurred. The @[@'String'@]@ is a list of contexts + -- in which the error occurred. The 'String' is the + -- message describing the error, if any. + | Done ByteString r + -- ^ The parse succeeded. The 'ByteString' is the + -- input that had not yet been consumed (if any) when + -- the parse succeeded. + +instance NFData r => NFData (Result r) where + rnf (Fail bs ctxs msg) = rnfBS bs `seq` rnf ctxs `seq` rnf msg + rnf (Done bs r) = rnfBS bs `seq` rnf r + {-# INLINE rnf #-} + +rnfBS :: ByteString -> () +rnfBS (Chunk _ xs) = rnfBS xs +rnfBS Empty = () +{-# INLINE rnfBS #-} + +instance Show r => Show (Result r) where + show (Fail bs stk msg) = + "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg + show (Done bs r) = "Done " ++ show bs ++ " " ++ show r + +fmapR :: (a -> b) -> Result a -> Result b +fmapR _ (Fail st stk msg) = Fail st stk msg +fmapR f (Done bs r) = Done bs (f r) + +instance Functor Result where + fmap = fmapR + +-- | Run a parser and return its result. +parse :: A.Parser a -> ByteString -> Result a +parse p s = case s of + Chunk x xs -> go (A.parse p x) xs + empty -> go (A.parse p B.empty) empty + where + go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg + go (T.Done x r) ys = Done (chunk x ys) r + go (T.Partial k) (Chunk y ys) = go (k y) ys + go (T.Partial k) empty = go (k B.empty) empty + +-- | Run a parser and print its result to standard output. +parseTest :: (Show a) => A.Parser a -> ByteString -> IO () +parseTest p s = print (parse p s) + +-- | Convert a 'Result' value to a 'Maybe' value. +maybeResult :: Result r -> Maybe r +maybeResult (Done _ r) = Just r +maybeResult _ = Nothing + +-- | Convert a 'Result' value to an 'Either' value. +eitherResult :: Result r -> Either String r +eitherResult (Done _ r) = Right r +eitherResult (Fail _ [] msg) = Left msg +eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) + +-- | Run a parser that cannot be resupplied via a 'T.Partial' result. +-- +-- This function does not force a parser to consume all of its input. +-- Instead, any residual input will be discarded. To force a parser +-- to consume all of its input, use something like this: +-- +-- @ +--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput') +-- @ +parseOnly :: A.Parser a -> ByteString -> Either String a +parseOnly p = eitherResult . parse p +{-# INLINE parseOnly #-} diff --git a/Data/Attoparsec/Char8.hs b/Data/Attoparsec/Char8.hs --- a/Data/Attoparsec/Char8.hs +++ b/Data/Attoparsec/Char8.hs @@ -1,502 +1,23 @@ -{-# LANGUAGE BangPatterns, FlexibleInstances #-} -{-# OPTIONS_GHC -fno-warn-orphans #-} - -- | -- Module : Data.Attoparsec.Char8 --- Copyright : Bryan O'Sullivan 2007-2010 +-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 --- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- -- Simple, efficient, character-oriented combinator parsing for --- 'B.ByteString' strings, loosely based on the Parsec library. +-- 'Data.ByteString.ByteString' strings, loosely based on the Parsec +-- library. +-- +-- This module is deprecated. Use "Data.Attoparsec.ByteString.Char8" +-- instead. module Data.Attoparsec.Char8 + {-# DEPRECATED "This module will be removed in the next major release." #-} ( - -- * Character encodings - -- $encodings - - -- * Parser types - Parser - , A.Result(..) - - -- * Running parsers - , A.parse - , A.feed - , A.parseOnly - , A.parseTest - , A.parseWith - - -- ** Result conversion - , A.maybeResult - , A.eitherResult - - -- * Combinators - , (I.) - , I.try - , module Data.Attoparsec.Combinator - - -- * Parsing individual characters - , char - , char8 - , anyChar - , notChar - , satisfy - - -- ** Special character parsers - , digit - , letter_iso8859_15 - , letter_ascii - , space - - -- ** Fast predicates - , isDigit - , isDigit_w8 - , isAlpha_iso8859_15 - , isAlpha_ascii - , isSpace - , isSpace_w8 - - -- *** Character classes - , inClass - , notInClass - - -- * Efficient string handling - , I.string - , stringCI - , skipSpace - , skipWhile - , I.take - , scan - , takeWhile - , takeWhile1 - , takeTill - - -- ** Consume all remaining input - , I.takeByteString - , I.takeLazyByteString - - -- * Text parsing - , I.endOfLine - , isEndOfLine - , isHorizontalSpace - - -- * Numeric parsers - , decimal - , hexadecimal - , signed - , double - , Number(..) - , number - , rational - - -- * State observation and manipulation functions - , I.endOfInput - , I.atEnd + module Data.Attoparsec.ByteString.Char8 ) where -import Control.Applicative ((*>), (<$>), (<|>)) -import Data.Attoparsec.Combinator -import Data.Attoparsec.FastSet (charClass, memberChar) -import Data.Attoparsec.Internal (Parser, ()) -import Data.Attoparsec.Number (Number(..)) -import Data.Bits (Bits, (.|.), shiftL) -import Data.ByteString.Internal (c2w, w2c) -import Data.Int (Int8, Int16, Int32, Int64) -import Data.Ratio ((%)) -import Data.String (IsString(..)) -import Data.Word (Word8, Word16, Word32, Word64, Word) -import Prelude hiding (takeWhile) -import qualified Data.Attoparsec as A -import qualified Data.Attoparsec.Internal as I -import qualified Data.ByteString as B8 -import qualified Data.ByteString.Char8 as B - -instance IsString (Parser B.ByteString) where - fromString = I.string . B.pack - --- $encodings --- --- This module is intended for parsing text that is --- represented using an 8-bit character set, e.g. ASCII or --- ISO-8859-15. It /does not/ make any attempt to deal with character --- encodings, multibyte characters, or wide characters. In --- particular, all attempts to use characters above code point U+00FF --- will give wrong answers. --- --- Code points below U+0100 are simply translated to and from their --- numeric values, so e.g. the code point U+00A4 becomes the byte --- @0xA4@ (which is the Euro symbol in ISO-8859-15, but the generic --- currency sign in ISO-8859-1). Haskell 'Char' values above U+00FF --- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@. - --- ASCII-specific but fast, oh yes. -toLower :: Word8 -> Word8 -toLower w | w >= 65 && w <= 90 = w + 32 - | otherwise = w - --- | Satisfy a literal string, ignoring case. -stringCI :: B.ByteString -> Parser B.ByteString -stringCI = I.stringTransform (B8.map toLower) -{-# INLINE stringCI #-} - --- | Consume input as long as the predicate returns 'True', and return --- the consumed input. --- --- This parser requires the predicate to succeed on at least one byte --- of input: it will fail if the predicate never returns 'True' or if --- there is no input left. -takeWhile1 :: (Char -> Bool) -> Parser B.ByteString -takeWhile1 p = I.takeWhile1 (p . w2c) -{-# INLINE takeWhile1 #-} - --- | The parser @satisfy p@ succeeds for any byte for which the --- predicate @p@ returns 'True'. Returns the byte that is actually --- parsed. --- --- >digit = satisfy isDigit --- > where isDigit c = c >= '0' && c <= '9' -satisfy :: (Char -> Bool) -> Parser Char -satisfy = I.satisfyWith w2c -{-# INLINE satisfy #-} - --- | Match a letter, in the ISO-8859-15 encoding. -letter_iso8859_15 :: Parser Char -letter_iso8859_15 = satisfy isAlpha_iso8859_15 "letter_iso8859_15" -{-# INLINE letter_iso8859_15 #-} - --- | Match a letter, in the ASCII encoding. -letter_ascii :: Parser Char -letter_ascii = satisfy isAlpha_ascii "letter_ascii" -{-# INLINE letter_ascii #-} - --- | A fast alphabetic predicate for the ISO-8859-15 encoding --- --- /Note/: For all character encodings other than ISO-8859-15, and --- almost all Unicode code points above U+00A3, this predicate gives --- /wrong answers/. -isAlpha_iso8859_15 :: Char -> Bool -isAlpha_iso8859_15 c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') || - (c >= '\166' && moby c) - where moby = notInClass "\167\169\171-\179\182\183\185\187\191\215\247" - {-# NOINLINE moby #-} -{-# INLINE isAlpha_iso8859_15 #-} - --- | A fast alphabetic predicate for the ASCII encoding --- --- /Note/: For all character encodings other than ASCII, and --- almost all Unicode code points above U+007F, this predicate gives --- /wrong answers/. -isAlpha_ascii :: Char -> Bool -isAlpha_ascii c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') -{-# INLINE isAlpha_ascii #-} - --- | Parse a single digit. -digit :: Parser Char -digit = satisfy isDigit "digit" -{-# INLINE digit #-} - --- | A fast digit predicate. -isDigit :: Char -> Bool -isDigit c = c >= '0' && c <= '9' -{-# INLINE isDigit #-} - --- | A fast digit predicate. -isDigit_w8 :: Word8 -> Bool -isDigit_w8 w = w >= 48 && w <= 57 -{-# INLINE isDigit_w8 #-} - --- | Match any character. -anyChar :: Parser Char -anyChar = satisfy $ const True -{-# INLINE anyChar #-} - --- | Fast predicate for matching ASCII space characters. --- --- /Note/: This predicate only gives correct answers for the ASCII --- encoding. For instance, it does not recognise U+00A0 (non-breaking --- space) as a space character, even though it is a valid ISO-8859-15 --- byte. For a Unicode-aware and only slightly slower predicate, --- use 'Data.Char.isSpace' -isSpace :: Char -> Bool -isSpace c = (c == ' ') || ('\t' <= c && c <= '\r') -{-# INLINE isSpace #-} - --- | Fast 'Word8' predicate for matching ASCII space characters. -isSpace_w8 :: Word8 -> Bool -isSpace_w8 w = (w == 32) || (9 <= w && w <= 13) -{-# INLINE isSpace_w8 #-} - - --- | Parse a space character. --- --- /Note/: This parser only gives correct answers for the ASCII --- encoding. For instance, it does not recognise U+00A0 (non-breaking --- space) as a space character, even though it is a valid ISO-8859-15 --- byte. -space :: Parser Char -space = satisfy isSpace "space" -{-# INLINE space #-} - --- | Match a specific character. -char :: Char -> Parser Char -char c = satisfy (== c) [c] -{-# INLINE char #-} - --- | Match a specific character, but return its 'Word8' value. -char8 :: Char -> Parser Word8 -char8 c = I.satisfy (== c2w c) [c] -{-# INLINE char8 #-} - --- | Match any character except the given one. -notChar :: Char -> Parser Char -notChar c = satisfy (/= c) "not " ++ [c] -{-# INLINE notChar #-} - --- | Match any character in a set. --- --- >vowel = inClass "aeiou" --- --- Range notation is supported. --- --- >halfAlphabet = inClass "a-nA-N" --- --- To add a literal \'-\' to a set, place it at the beginning or end --- of the string. -inClass :: String -> Char -> Bool -inClass s = (`memberChar` mySet) - where mySet = charClass s -{-# INLINE inClass #-} - --- | Match any character not in a set. -notInClass :: String -> Char -> Bool -notInClass s = not . inClass s -{-# INLINE notInClass #-} - --- | Consume input as long as the predicate returns 'True', and return --- the consumed input. --- --- This parser does not fail. It will return an empty string if the --- predicate returns 'False' on the first byte of input. --- --- /Note/: Because this parser does not fail, do not use it with --- combinators such as 'many', because such parsers loop until a --- failure occurs. Careless use will thus result in an infinite loop. -takeWhile :: (Char -> Bool) -> Parser B.ByteString -takeWhile p = I.takeWhile (p . w2c) -{-# INLINE takeWhile #-} - --- | A stateful scanner. The predicate consumes and transforms a --- state argument, and each transformed state is passed to successive --- invocations of the predicate on each byte of the input until one --- returns 'Nothing' or the input ends. --- --- This parser does not fail. It will return an empty string if the --- predicate returns 'Nothing' on the first byte of input. --- --- /Note/: Because this parser does not fail, do not use it with --- combinators such as 'many', because such parsers loop until a --- failure occurs. Careless use will thus result in an infinite loop. -scan :: s -> (s -> Char -> Maybe s) -> Parser B.ByteString -scan s0 p = I.scan s0 (\s -> p s . w2c) -{-# INLINE scan #-} - --- | Consume input as long as the predicate returns 'False' --- (i.e. until it returns 'True'), and return the consumed input. --- --- This parser does not fail. It will return an empty string if the --- predicate returns 'True' on the first byte of input. --- --- /Note/: Because this parser does not fail, do not use it with --- combinators such as 'many', because such parsers loop until a --- failure occurs. Careless use will thus result in an infinite loop. -takeTill :: (Char -> Bool) -> Parser B.ByteString -takeTill p = I.takeTill (p . w2c) -{-# INLINE takeTill #-} - --- | Skip past input for as long as the predicate returns 'True'. -skipWhile :: (Char -> Bool) -> Parser () -skipWhile p = I.skipWhile (p . w2c) -{-# INLINE skipWhile #-} - --- | Skip over white space. -skipSpace :: Parser () -skipSpace = I.skipWhile isSpace_w8 -{-# INLINE skipSpace #-} - --- | A predicate that matches either a carriage return @\'\\r\'@ or --- newline @\'\\n\'@ character. -isEndOfLine :: Word8 -> Bool -isEndOfLine w = w == 13 || w == 10 -{-# INLINE isEndOfLine #-} - --- | A predicate that matches either a space @\' \'@ or horizontal tab --- @\'\\t\'@ character. -isHorizontalSpace :: Word8 -> Bool -isHorizontalSpace w = w == 32 || w == 9 -{-# INLINE isHorizontalSpace #-} - --- | Parse and decode an unsigned hexadecimal number. The hex digits --- @\'a\'@ through @\'f\'@ may be upper or lower case. --- --- This parser does not accept a leading @\"0x\"@ string. -hexadecimal :: (Integral a, Bits a) => Parser a -hexadecimal = B8.foldl' step 0 `fmap` I.takeWhile1 isHexDigit - where - isHexDigit w = (w >= 48 && w <= 57) || - (w >= 97 && w <= 102) || - (w >= 65 && w <= 90) - step a w | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48) - | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87) - | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55) -{-# SPECIALISE hexadecimal :: Parser Int #-} -{-# SPECIALISE hexadecimal :: Parser Int8 #-} -{-# SPECIALISE hexadecimal :: Parser Int16 #-} -{-# SPECIALISE hexadecimal :: Parser Int32 #-} -{-# SPECIALISE hexadecimal :: Parser Int64 #-} -{-# SPECIALISE hexadecimal :: Parser Integer #-} -{-# SPECIALISE hexadecimal :: Parser Word #-} -{-# SPECIALISE hexadecimal :: Parser Word8 #-} -{-# SPECIALISE hexadecimal :: Parser Word16 #-} -{-# SPECIALISE hexadecimal :: Parser Word32 #-} -{-# SPECIALISE hexadecimal :: Parser Word64 #-} - --- | Parse and decode an unsigned decimal number. -decimal :: Integral a => Parser a -decimal = B8.foldl' step 0 `fmap` I.takeWhile1 isDig - where isDig w = w >= 48 && w <= 57 - step a w = a * 10 + fromIntegral (w - 48) -{-# SPECIALISE decimal :: Parser Int #-} -{-# SPECIALISE decimal :: Parser Int8 #-} -{-# SPECIALISE decimal :: Parser Int16 #-} -{-# SPECIALISE decimal :: Parser Int32 #-} -{-# SPECIALISE decimal :: Parser Int64 #-} -{-# SPECIALISE decimal :: Parser Integer #-} -{-# SPECIALISE decimal :: Parser Word #-} -{-# SPECIALISE decimal :: Parser Word8 #-} -{-# SPECIALISE decimal :: Parser Word16 #-} -{-# SPECIALISE decimal :: Parser Word32 #-} -{-# SPECIALISE decimal :: Parser Word64 #-} - --- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign --- character. -signed :: Num a => Parser a -> Parser a -{-# SPECIALISE signed :: Parser Int -> Parser Int #-} -{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-} -{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-} -{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-} -{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-} -{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-} -signed p = (negate <$> (char8 '-' *> p)) - <|> (char8 '+' *> p) - <|> p - --- | Parse a rational number. --- --- This parser accepts an optional leading sign character, followed by --- at least one decimal digit. The syntax similar to that accepted by --- the 'read' function, with the exception that a trailing @\'.\'@ or --- @\'e\'@ /not/ followed by a number is not consumed. --- --- Examples with behaviour identical to 'read', if you feed an empty --- continuation to the first result: --- --- >rational "3" == Done 3.0 "" --- >rational "3.1" == Done 3.1 "" --- >rational "3e4" == Done 30000.0 "" --- >rational "3.1e4" == Done 31000.0, "" - --- Examples with behaviour identical to 'read': --- --- >rational ".3" == Fail "input does not start with a digit" --- >rational "e3" == Fail "input does not start with a digit" --- --- Examples of differences from 'read': --- --- >rational "3.foo" == Done 3.0 ".foo" --- >rational "3e" == Done 3.0 "e" --- --- This function does not accept string representations of \"NaN\" or --- \"Infinity\". -rational :: Fractional a => Parser a -{-# SPECIALIZE rational :: Parser Double #-} -{-# SPECIALIZE rational :: Parser Float #-} -{-# SPECIALIZE rational :: Parser Rational #-} -rational = floaty $ \real frac fracDenom -> fromRational $ - real % 1 + frac % fracDenom - --- | Parse a rational number. --- --- The syntax accepted by this parser is the same as for 'rational'. --- --- /Note/: This function is almost ten times faster than 'rational', --- but is slightly less accurate. --- --- The 'Double' type supports about 16 decimal places of accuracy. --- For 94.2% of numbers, this function and 'rational' give identical --- results, but for the remaining 5.8%, this function loses precision --- around the 15th decimal place. For 0.001% of numbers, this --- function will lose precision at the 13th or 14th decimal place. --- --- This function does not accept string representations of \"NaN\" or --- \"Infinity\". -double :: Parser Double -double = floaty asDouble - -asDouble :: Integer -> Integer -> Integer -> Double -asDouble real frac fracDenom = - fromIntegral real + fromIntegral frac / fromIntegral fracDenom -{-# INLINE asDouble #-} - --- | Parse a number, attempting to preserve both speed and precision. --- --- The syntax accepted by this parser is the same as for 'rational'. --- --- /Note/: This function is almost ten times faster than 'rational'. --- On integral inputs, it gives perfectly accurate answers, and on --- floating point inputs, it is slightly less accurate than --- 'rational'. --- --- This function does not accept string representations of \"NaN\" or --- \"Infinity\". -number :: Parser Number -number = floaty $ \real frac fracDenom -> - if frac == 0 && fracDenom == 0 - then I real - else D (asDouble real frac fracDenom) -{-# INLINE number #-} - -data T = T !Integer !Int - -floaty :: Fractional a => (Integer -> Integer -> Integer -> a) -> Parser a -{-# INLINE floaty #-} -floaty f = do - let minus = 45 - plus = 43 - !positive <- ((== plus) <$> I.satisfy (\c -> c == minus || c == plus)) <|> - return True - real <- decimal - let tryFraction = do - let dot = 46 - _ <- I.satisfy (==dot) - ds <- I.takeWhile isDigit_w8 - case I.parseOnly decimal ds of - Right n -> return $ T n (B.length ds) - _ -> fail "no digits after decimal" - T fraction fracDigits <- tryFraction <|> return (T 0 0) - let littleE = 101 - bigE = 69 - e w = w == littleE || w == bigE - power <- (I.satisfy e *> signed decimal) <|> return (0::Int) - let n = if fracDigits == 0 - then if power == 0 - then fromIntegral real - else fromIntegral real * (10 ^^ power) - else if power == 0 - then f real fraction (10 ^ fracDigits) - else f real fraction (10 ^ fracDigits) * (10 ^^ power) - return $ if positive - then n - else -n +import Data.Attoparsec.ByteString.Char8 diff --git a/Data/Attoparsec/Combinator.hs b/Data/Attoparsec/Combinator.hs --- a/Data/Attoparsec/Combinator.hs +++ b/Data/Attoparsec/Combinator.hs @@ -1,9 +1,12 @@ {-# LANGUAGE BangPatterns, CPP #-} +#if __GLASGOW_HASKELL__ >= 702 +{-# LANGUAGE Trustworthy #-} -- Imports internal modules +#endif -- | -- Module : Data.Attoparsec.Combinator --- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2009-2010 +-- Copyright : Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2015 -- License : BSD3 --- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : portable @@ -11,42 +14,73 @@ -- Useful parser combinators, similar to those provided by Parsec. module Data.Attoparsec.Combinator ( - choice + -- * Combinators + try + , () + , choice , count , option + , many' , many1 + , many1' , manyTill + , manyTill' , sepBy + , sepBy' , sepBy1 + , sepBy1' , skipMany , skipMany1 , eitherP - - -- * Inlined implementations of existing functions - -- - -- These are exact duplicates of functions already exported by the - -- 'Control.Applicative' module, but whose definitions are - -- inlined. In many cases, this leads to 2x performance - -- improvements. - , many + , feed + , satisfyElem + , endOfInput + , atEnd + , lookAhead ) where -import Control.Applicative (Alternative, Applicative(..), empty, liftA2, - (<|>), (*>), (<$>)) -#if __GLASGOW_HASKELL__ >= 700 -import Data.Attoparsec.Internal.Types (Parser) -import qualified Data.Attoparsec.Zepto as Z +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative (Applicative(..), (<$>)) +import Data.Monoid (Monoid(mappend)) #endif +import Control.Applicative (Alternative(..), liftA2, many, (<|>)) +import Control.Monad (MonadPlus(..)) +import Data.Attoparsec.Internal.Types (Parser(..), IResult(..)) +import Data.Attoparsec.Internal (endOfInput, atEnd, satisfyElem) +import Data.ByteString (ByteString) +import Data.Foldable (asum) +import Data.Text (Text) +import qualified Data.Attoparsec.Zepto as Z +import Prelude hiding (succ) +-- | Attempt a parse, and if it fails, rewind the input so that no +-- input appears to have been consumed. +-- +-- This combinator is provided for compatibility with Parsec. +-- attoparsec parsers always backtrack on failure. +try :: Parser i a -> Parser i a +try = id +{-# INLINE try #-} + +-- | Name the parser, in case failure occurs. +() :: Parser i a + -> String -- ^ the name to use if parsing fails + -> Parser i a +p msg0 = Parser $ \t pos more lose succ -> + let lose' t' pos' more' strs msg = lose t' pos' more' (msg0:strs) msg + in runParser p t pos more lose' succ +{-# INLINE () #-} +infix 0 + -- | @choice ps@ tries to apply the actions in the list @ps@ in order, -- until one of them succeeds. Returns the value of the succeeding -- action. choice :: Alternative f => [f a] -> f a -choice = foldr (<|>) empty -#if __GLASGOW_HASKELL__ >= 700 -{-# SPECIALIZE choice :: [Parser a] -> Parser a #-} +choice = asum +{-# SPECIALIZE choice :: [Parser ByteString a] + -> Parser ByteString a #-} +{-# SPECIALIZE choice :: [Parser Text a] -> Parser Text a #-} {-# SPECIALIZE choice :: [Z.Parser a] -> Z.Parser a #-} -#endif -- | @option x p@ tries to apply action @p@. If @p@ fails without -- consuming input, it returns the value @x@, otherwise the value @@ -55,11 +89,30 @@ -- > priority = option 0 (digitToInt <$> digit) option :: Alternative f => a -> f a -> f a option x p = p <|> pure x -#if __GLASGOW_HASKELL__ >= 700 -{-# SPECIALIZE option :: a -> Parser a -> Parser a #-} +{-# SPECIALIZE option :: a -> Parser ByteString a -> Parser ByteString a #-} +{-# SPECIALIZE option :: a -> Parser Text a -> Parser Text a #-} {-# SPECIALIZE option :: a -> Z.Parser a -> Z.Parser a #-} -#endif +-- | A version of 'liftM2' that is strict in the result of its first +-- action. +liftM2' :: (Monad m) => (a -> b -> c) -> m a -> m b -> m c +liftM2' f a b = do + !x <- a + y <- b + return (f x y) +{-# INLINE liftM2' #-} + +-- | @many' p@ applies the action @p@ /zero/ or more times. Returns a +-- list of the returned values of @p@. The value returned by @p@ is +-- forced to WHNF. +-- +-- > word = many' letter +many' :: (MonadPlus m) => m a -> m [a] +many' p = many_p + where many_p = some_p `mplus` return [] + some_p = liftM2' (:) p many_p +{-# INLINE many' #-} + -- | @many1 p@ applies the action @p@ /one/ or more times. Returns a -- list of the returned values of @p@. -- @@ -68,61 +121,114 @@ many1 p = liftA2 (:) p (many p) {-# INLINE many1 #-} +-- | @many1' p@ applies the action @p@ /one/ or more times. Returns a +-- list of the returned values of @p@. The value returned by @p@ is +-- forced to WHNF. +-- +-- > word = many1' letter +many1' :: (MonadPlus m) => m a -> m [a] +many1' p = liftM2' (:) p (many' p) +{-# INLINE many1' #-} + -- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. -- --- > commaSep p = p `sepBy` (symbol ",") +-- > commaSep p = p `sepBy` (char ',') sepBy :: Alternative f => f a -> f s -> f [a] sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure [] -#if __GLASGOW_HASKELL__ >= 700 -{-# SPECIALIZE sepBy :: Parser a -> Parser s -> Parser [a] #-} +{-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s + -> Parser ByteString [a] #-} +{-# SPECIALIZE sepBy :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} -#endif +-- | @sepBy' p sep@ applies /zero/ or more occurrences of @p@, separated +-- by @sep@. Returns a list of the values returned by @p@. The value +-- returned by @p@ is forced to WHNF. +-- +-- > commaSep p = p `sepBy'` (char ',') +sepBy' :: (MonadPlus m) => m a -> m s -> m [a] +sepBy' p s = scan `mplus` return [] + where scan = liftM2' (:) p ((s >> sepBy1' p s) `mplus` return []) +{-# SPECIALIZE sepBy' :: Parser ByteString a -> Parser ByteString s + -> Parser ByteString [a] #-} +{-# SPECIALIZE sepBy' :: Parser Text a -> Parser Text s -> Parser Text [a] #-} +{-# SPECIALIZE sepBy' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} + -- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated -- by @sep@. Returns a list of the values returned by @p@. -- --- > commaSep p = p `sepBy` (symbol ",") +-- > commaSep p = p `sepBy1` (char ',') sepBy1 :: Alternative f => f a -> f s -> f [a] sepBy1 p s = scan where scan = liftA2 (:) p ((s *> scan) <|> pure []) -#if __GLASGOW_HASKELL__ >= 700 -{-# SPECIALIZE sepBy1 :: Parser a -> Parser s -> Parser [a] #-} +{-# SPECIALIZE sepBy1 :: Parser ByteString a -> Parser ByteString s + -> Parser ByteString [a] #-} +{-# SPECIALIZE sepBy1 :: Parser Text a -> Parser Text s -> Parser Text [a] #-} {-# SPECIALIZE sepBy1 :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} -#endif +-- | @sepBy1' p sep@ applies /one/ or more occurrences of @p@, separated +-- by @sep@. Returns a list of the values returned by @p@. The value +-- returned by @p@ is forced to WHNF. +-- +-- > commaSep p = p `sepBy1'` (char ',') +sepBy1' :: (MonadPlus m) => m a -> m s -> m [a] +sepBy1' p s = scan + where scan = liftM2' (:) p ((s >> scan) `mplus` return []) +{-# SPECIALIZE sepBy1' :: Parser ByteString a -> Parser ByteString s + -> Parser ByteString [a] #-} +{-# SPECIALIZE sepBy1' :: Parser Text a -> Parser Text s -> Parser Text [a] #-} +{-# SPECIALIZE sepBy1' :: Z.Parser a -> Z.Parser s -> Z.Parser [a] #-} + -- | @manyTill p end@ applies action @p@ /zero/ or more times until -- action @end@ succeeds, and returns the list of values returned by -- @p@. This can be used to scan comments: -- --- > simpleComment = string "")) +-- > simpleComment = string "") -- --- Note the overlapping parsers @anyChar@ and @string \"\"@. +-- While this will work, it is not very efficient, as it will cause a +-- lot of backtracking.) manyTill :: Alternative f => f a -> f b -> f [a] manyTill p end = scan where scan = (end *> pure []) <|> liftA2 (:) p scan -#if __GLASGOW_HASKELL__ >= 700 -{-# SPECIALIZE manyTill :: Parser a -> Parser b -> Parser [a] #-} +{-# SPECIALIZE manyTill :: Parser ByteString a -> Parser ByteString b + -> Parser ByteString [a] #-} +{-# SPECIALIZE manyTill :: Parser Text a -> Parser Text b -> Parser Text [a] #-} {-# SPECIALIZE manyTill :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-} -#endif +-- | @manyTill' p end@ applies action @p@ /zero/ or more times until +-- action @end@ succeeds, and returns the list of values returned by +-- @p@. This can be used to scan comments: +-- +-- > simpleComment = string "") +-- +-- (Note the overlapping parsers @anyChar@ and @string \"-->\"@. +-- While this will work, it is not very efficient, as it will cause a +-- lot of backtracking.) +-- +-- The value returned by @p@ is forced to WHNF. +manyTill' :: (MonadPlus m) => m a -> m b -> m [a] +manyTill' p end = scan + where scan = (end >> return []) `mplus` liftM2' (:) p scan +{-# SPECIALIZE manyTill' :: Parser ByteString a -> Parser ByteString b + -> Parser ByteString [a] #-} +{-# SPECIALIZE manyTill' :: Parser Text a -> Parser Text b -> Parser Text [a] #-} +{-# SPECIALIZE manyTill' :: Z.Parser a -> Z.Parser b -> Z.Parser [a] #-} + -- | Skip zero or more instances of an action. skipMany :: Alternative f => f a -> f () skipMany p = scan where scan = (p *> scan) <|> pure () -#if __GLASGOW_HASKELL__ >= 700 -{-# SPECIALIZE skipMany :: Parser a -> Parser () #-} +{-# SPECIALIZE skipMany :: Parser ByteString a -> Parser ByteString () #-} +{-# SPECIALIZE skipMany :: Parser Text a -> Parser Text () #-} {-# SPECIALIZE skipMany :: Z.Parser a -> Z.Parser () #-} -#endif -- | Skip one or more instances of an action. skipMany1 :: Alternative f => f a -> f () skipMany1 p = p *> skipMany p -#if __GLASGOW_HASKELL__ >= 700 -{-# SPECIALIZE skipMany1 :: Parser a -> Parser () #-} +{-# SPECIALIZE skipMany1 :: Parser ByteString a -> Parser ByteString () #-} +{-# SPECIALIZE skipMany1 :: Parser Text a -> Parser Text () #-} {-# SPECIALIZE skipMany1 :: Z.Parser a -> Z.Parser () #-} -#endif -- | Apply the given action repeatedly, returning every result. count :: Monad m => Int -> m a -> m [a] @@ -134,9 +240,17 @@ eitherP a b = (Left <$> a) <|> (Right <$> b) {-# INLINE eitherP #-} --- | Zero or more. -many :: (Alternative f) => f a -> f [a] -many v = many_v - where many_v = some_v <|> pure [] - some_v = (:) <$> v <*> many_v -{-# INLINE many #-} +-- | If a parser has returned a 'T.Partial' result, supply it with more +-- input. +feed :: Monoid i => IResult i r -> i -> IResult i r +feed (Fail t ctxs msg) d = Fail (mappend t d) ctxs msg +feed (Partial k) d = k d +feed (Done t r) d = Done (mappend t d) r +{-# INLINE feed #-} + +-- | Apply a parser without consuming any input. +lookAhead :: Parser i a -> Parser i a +lookAhead p = Parser $ \t pos more lose succ -> + let succ' t' _pos' more' = succ t' pos more' + in runParser p t pos more lose succ' +{-# INLINE lookAhead #-} diff --git a/Data/Attoparsec/FastSet.hs b/Data/Attoparsec/FastSet.hs deleted file mode 100644 --- a/Data/Attoparsec/FastSet.hs +++ /dev/null @@ -1,115 +0,0 @@ -{-# LANGUAGE BangPatterns, MagicHash #-} - ------------------------------------------------------------------------------ --- | --- Module : Data.Attoparsec.FastSet --- Copyright : Bryan O'Sullivan 2008 --- License : BSD3 --- --- Maintainer : bos@serpentine.com --- Stability : experimental --- Portability : unknown --- --- Fast set membership tests for 'Word8' and 8-bit 'Char' values. The --- set representation is unboxed for efficiency. For small sets, we --- test for membership using a binary search. For larger sets, we use --- a lookup table. --- ------------------------------------------------------------------------------ -module Data.Attoparsec.FastSet - ( - -- * Data type - FastSet - -- * Construction - , fromList - , set - -- * Lookup - , memberChar - , memberWord8 - -- * Debugging - , fromSet - -- * Handy interface - , charClass - ) where - -import Data.Bits ((.&.), (.|.)) -import Foreign.Storable (peekByteOff, pokeByteOff) -import GHC.Base (Int(I#), iShiftRA#, narrow8Word#, shiftL#) -import GHC.Word (Word8(W8#)) -import qualified Data.ByteString as B -import qualified Data.ByteString.Char8 as B8 -import qualified Data.ByteString.Internal as I -import qualified Data.ByteString.Unsafe as U - -data FastSet = Sorted { fromSet :: !B.ByteString } - | Table { fromSet :: !B.ByteString } - deriving (Eq, Ord) - -instance Show FastSet where - show (Sorted s) = "FastSet Sorted " ++ show (B8.unpack s) - show (Table _) = "FastSet Table" - --- | The lower bound on the size of a lookup table. We choose this to --- balance table density against performance. -tableCutoff :: Int -tableCutoff = 8 - --- | Create a set. -set :: B.ByteString -> FastSet -set s | B.length s < tableCutoff = Sorted . B.sort $ s - | otherwise = Table . mkTable $ s - -fromList :: [Word8] -> FastSet -fromList = set . B.pack - -data I = I {-# UNPACK #-} !Int {-# UNPACK #-} !Word8 - -shiftR :: Int -> Int -> Int -shiftR (I# x#) (I# i#) = I# (x# `iShiftRA#` i#) - -shiftL :: Word8 -> Int -> Word8 -shiftL (W8# x#) (I# i#) = W8# (narrow8Word# (x# `shiftL#` i#)) - -index :: Int -> I -index i = I (i `shiftR` 3) (1 `shiftL` (i .&. 7)) -{-# INLINE index #-} - --- | Check the set for membership. -memberWord8 :: Word8 -> FastSet -> Bool -memberWord8 w (Table t) = - let I byte bit = index (fromIntegral w) - in U.unsafeIndex t byte .&. bit /= 0 -memberWord8 w (Sorted s) = search 0 (B.length s - 1) - where search lo hi - | hi < lo = False - | otherwise = - let mid = (lo + hi) `div` 2 - in case compare w (U.unsafeIndex s mid) of - GT -> search (mid + 1) hi - LT -> search lo (mid - 1) - _ -> True - --- | Check the set for membership. Only works with 8-bit characters: --- characters above code point 255 will give wrong answers. -memberChar :: Char -> FastSet -> Bool -memberChar c = memberWord8 (I.c2w c) -{-# INLINE memberChar #-} - -mkTable :: B.ByteString -> B.ByteString -mkTable s = I.unsafeCreate 32 $ \t -> do - _ <- I.memset t 0 32 - U.unsafeUseAsCStringLen s $ \(p, l) -> - let loop n | n == l = return () - | otherwise = do - c <- peekByteOff p n :: IO Word8 - let I byte bit = index (fromIntegral c) - prev <- peekByteOff t byte :: IO Word8 - pokeByteOff t byte (prev .|. bit) - loop (n + 1) - in loop 0 - -charClass :: String -> FastSet -charClass = set . B8.pack . go - where go (a:'-':b:xs) = [a..b] ++ go xs - go (x:xs) = x : go xs - go _ = "" diff --git a/Data/Attoparsec/Internal.hs b/Data/Attoparsec/Internal.hs --- a/Data/Attoparsec/Internal.hs +++ b/Data/Attoparsec/Internal.hs @@ -1,453 +1,171 @@ -{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-} +{-# LANGUAGE BangPatterns, CPP, ScopedTypeVariables #-} -- | -- Module : Data.Attoparsec.Internal --- Copyright : Bryan O'Sullivan 2007-2011 +-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- --- Simple, efficient parser combinators for 'B.ByteString' strings, --- loosely based on the Parsec library. +-- Simple, efficient parser combinators, loosely based on the Parsec +-- library. module Data.Attoparsec.Internal - ( - -- * Parser types - Parser - , Result(..) - - -- * Running parsers - , parse - , parseOnly - - -- * Combinators - , () - , try - , module Data.Attoparsec.Combinator - - -- * Parsing individual bytes - , satisfy - , satisfyWith - , anyWord8 - , skip - , word8 - , notWord8 - - -- ** Byte classes - , inClass - , notInClass - - -- * Parsing more complicated structures - , storable - - -- * Efficient string handling - , skipWhile - , string - , stringTransform - , take - , scan - , takeWhile - , takeWhile1 - , takeTill - - -- ** Consume all remaining input - , takeByteString - , takeLazyByteString - - -- * State observation and manipulation functions + ( compareResults + , prompt + , demandInput + , demandInput_ + , wantInput , endOfInput , atEnd - , ensure - - -- * Utilities - , endOfLine + , satisfyElem + , concatReverse ) where -import Control.Applicative ((<|>), (<$>)) -import Control.Monad (when) -import Data.Attoparsec.Combinator -import Data.Attoparsec.FastSet (charClass, memberWord8) +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((<$>)) +import Data.Monoid (Monoid, mconcat) +#endif import Data.Attoparsec.Internal.Types -import Data.Word (Word8) -import Foreign.ForeignPtr (withForeignPtr) -import Foreign.Ptr (castPtr, minusPtr, plusPtr) -import Foreign.Storable (Storable(peek, sizeOf)) -import Prelude hiding (getChar, take, takeWhile) -import System.IO.Unsafe (unsafePerformIO) -import qualified Data.ByteString as B8 -import qualified Data.ByteString.Char8 as B -import qualified Data.ByteString.Internal as B -import qualified Data.ByteString.Lazy as L -import qualified Data.ByteString.Unsafe as B +import Data.ByteString (ByteString) +import Data.Text (Text) +import Prelude hiding (succ) --- | If at least @n@ bytes of input are available, return the current --- input, otherwise fail. -ensure :: Int -> Parser B.ByteString -ensure !n = Parser $ \i0 a0 m0 kf ks -> - if B.length (unI i0) >= n - then ks i0 a0 m0 (unI i0) - else runParser (demandInput >> ensure n) i0 a0 m0 kf ks +-- | Compare two 'IResult' values for equality. +-- +-- If both 'IResult's are 'Partial', the result will be 'Nothing', as +-- they are incomplete and hence their equality cannot be known. +-- (This is why there is no 'Eq' instance for 'IResult'.) +compareResults :: (Eq i, Eq r) => IResult i r -> IResult i r -> Maybe Bool +compareResults (Fail t0 ctxs0 msg0) (Fail t1 ctxs1 msg1) = + Just (t0 == t1 && ctxs0 == ctxs1 && msg0 == msg1) +compareResults (Done t0 r0) (Done t1 r1) = + Just (t0 == t1 && r0 == r1) +compareResults (Partial _) (Partial _) = Nothing +compareResults _ _ = Just False --- | Ask for input. If we receive any, pass it to a success --- continuation, otherwise to a failure continuation. -prompt :: Input -> Added -> More - -> (Input -> Added -> More -> Result r) - -> (Input -> Added -> More -> Result r) - -> Result r -prompt i0 a0 _m0 kf ks = Partial $ \s -> - if B.null s - then kf i0 a0 Complete - else ks (I (unI i0 +++ s)) (A (unA a0 +++ s)) Incomplete +-- | Ask for input. If we receive any, pass the augmented input to a +-- success continuation, otherwise to a failure continuation. +prompt :: Chunk t + => State t -> Pos -> More + -> (State t -> Pos -> More -> IResult t r) + -> (State t -> Pos -> More -> IResult t r) + -> IResult t r +prompt t pos _more lose succ = Partial $ \s -> + if nullChunk s + then lose t pos Complete + else succ (pappendChunk t s) pos Incomplete +{-# SPECIALIZE prompt :: State ByteString -> Pos -> More + -> (State ByteString -> Pos -> More + -> IResult ByteString r) + -> (State ByteString -> Pos -> More + -> IResult ByteString r) + -> IResult ByteString r #-} +{-# SPECIALIZE prompt :: State Text -> Pos -> More + -> (State Text -> Pos -> More -> IResult Text r) + -> (State Text -> Pos -> More -> IResult Text r) + -> IResult Text r #-} -- | Immediately demand more input via a 'Partial' continuation -- result. -demandInput :: Parser () -demandInput = Parser $ \i0 a0 m0 kf ks -> - if m0 == Complete - then kf i0 a0 m0 ["demandInput"] "not enough bytes" - else let kf' i a m = kf i a m ["demandInput"] "not enough bytes" - ks' i a m = ks i a m () - in prompt i0 a0 m0 kf' ks' +demandInput :: Chunk t => Parser t () +demandInput = Parser $ \t pos more lose succ -> + case more of + Complete -> lose t pos more [] "not enough input" + _ -> let lose' _ pos' more' = lose t pos' more' [] "not enough input" + succ' t' pos' more' = succ t' pos' more' () + in prompt t pos more lose' succ' +{-# SPECIALIZE demandInput :: Parser ByteString () #-} +{-# SPECIALIZE demandInput :: Parser Text () #-} +-- | Immediately demand more input via a 'Partial' continuation +-- result. Return the new input. +demandInput_ :: Chunk t => Parser t t +demandInput_ = Parser $ \t pos more lose succ -> + case more of + Complete -> lose t pos more [] "not enough input" + _ -> Partial $ \s -> + if nullChunk s + then lose t pos Complete [] "not enough input" + else succ (pappendChunk t s) pos more s +{-# SPECIALIZE demandInput_ :: Parser ByteString ByteString #-} +{-# SPECIALIZE demandInput_ :: Parser Text Text #-} + -- | This parser always succeeds. It returns 'True' if any input is -- available either immediately or on demand, and 'False' if the end -- of all input has been reached. -wantInput :: Parser Bool -wantInput = Parser $ \i0 a0 m0 _kf ks -> +wantInput :: forall t . Chunk t => Parser t Bool +wantInput = Parser $ \t pos more _lose succ -> case () of - _ | not (B.null (unI i0)) -> ks i0 a0 m0 True - | m0 == Complete -> ks i0 a0 m0 False - | otherwise -> let kf' i a m = ks i a m False - ks' i a m = ks i a m True - in prompt i0 a0 m0 kf' ks' - -get :: Parser B.ByteString -get = Parser $ \i0 a0 m0 _kf ks -> ks i0 a0 m0 (unI i0) - -put :: B.ByteString -> Parser () -put s = Parser $ \_i0 a0 m0 _kf ks -> ks (I s) a0 m0 () - --- | Attempt a parse, and if it fails, rewind the input so that no --- input appears to have been consumed. --- --- This combinator is useful in cases where a parser might consume --- some input before failing, i.e. the parser needs arbitrary --- lookahead. The downside to using this combinator is that it can --- retain input for longer than is desirable. -try :: Parser a -> Parser a -try p = Parser $ \i0 a0 m0 kf ks -> - noAdds i0 a0 m0 $ \i1 a1 m1 -> - let kf' i2 a2 m2 = addS i0 a0 m0 i2 a2 m2 kf - in runParser p i1 a1 m1 kf' ks - --- | The parser @satisfy p@ succeeds for any byte for which the --- predicate @p@ returns 'True'. Returns the byte that is actually --- parsed. --- --- >digit = satisfy isDigit --- > where isDigit w = w >= 48 && w <= 57 -satisfy :: (Word8 -> Bool) -> Parser Word8 -satisfy p = do - s <- ensure 1 - let w = B.unsafeHead s - if p w - then put (B.unsafeTail s) >> return w - else fail "satisfy" - --- | The parser @skip p@ succeeds for any byte for which the predicate --- @p@ returns 'True'. --- --- >skipDigit = skip isDigit --- > where isDigit w = w >= 48 && w <= 57 -skip :: (Word8 -> Bool) -> Parser () -skip p = do - s <- ensure 1 - if p (B.unsafeHead s) - then put (B.unsafeTail s) - else fail "skip" - --- | The parser @satisfyWith f p@ transforms a byte, and succeeds if --- the predicate @p@ returns 'True' on the transformed value. The --- parser returns the transformed byte that was parsed. -satisfyWith :: (Word8 -> a) -> (a -> Bool) -> Parser a -satisfyWith f p = do - s <- ensure 1 - let c = f (B.unsafeHead s) - if p c - then put (B.unsafeTail s) >> return c - else fail "satisfyWith" - -storable :: Storable a => Parser a -storable = hack undefined - where - hack :: Storable b => b -> Parser b - hack dummy = do - (fp,o,_) <- B.toForeignPtr `fmap` take (sizeOf dummy) - return . B.inlinePerformIO . withForeignPtr fp $ \p -> - peek (castPtr $ p `plusPtr` o) - --- | Consume @n@ bytes of input, but succeed only if the predicate --- returns 'True'. -takeWith :: Int -> (B.ByteString -> Bool) -> Parser B.ByteString -takeWith n p = do - s <- ensure n - let h = B.unsafeTake n s - t = B.unsafeDrop n s - if p h - then put t >> return h - else fail "takeWith" - --- | Consume exactly @n@ bytes of input. -take :: Int -> Parser B.ByteString -take n = takeWith n (const True) -{-# INLINE take #-} - --- | @string s@ parses a sequence of bytes that identically match --- @s@. Returns the parsed string (i.e. @s@). This parser consumes no --- input if it fails (even if a partial match). --- --- /Note/: The behaviour of this parser is different to that of the --- similarly-named parser in Parsec, as this one is all-or-nothing. --- To illustrate the difference, the following parser will fail under --- Parsec given an input of @"for"@: --- --- >string "foo" <|> string "for" --- --- The reason for its failure is that that the first branch is a --- partial match, and will consume the letters @\'f\'@ and @\'o\'@ --- before failing. In Attoparsec, the above parser will /succeed/ on --- that input, because the failed first branch will consume nothing. -string :: B.ByteString -> Parser B.ByteString -string s = takeWith (B.length s) (==s) -{-# INLINE string #-} - -stringTransform :: (B.ByteString -> B.ByteString) -> B.ByteString - -> Parser B.ByteString -stringTransform f s = takeWith (B.length s) ((==f s) . f) -{-# INLINE stringTransform #-} - --- | Skip past input for as long as the predicate returns 'True'. -skipWhile :: (Word8 -> Bool) -> Parser () -skipWhile p = go - where - go = do - t <- B8.dropWhile p <$> get - put t - when (B.null t) $ do - input <- wantInput - when input go -{-# INLINE skipWhile #-} - --- | Consume input as long as the predicate returns 'False' --- (i.e. until it returns 'True'), and return the consumed input. --- --- This parser does not fail. It will return an empty string if the --- predicate returns 'True' on the first byte of input. --- --- /Note/: Because this parser does not fail, do not use it with --- combinators such as 'many', because such parsers loop until a --- failure occurs. Careless use will thus result in an infinite loop. -takeTill :: (Word8 -> Bool) -> Parser B.ByteString -takeTill p = takeWhile (not . p) -{-# INLINE takeTill #-} - --- | Consume input as long as the predicate returns 'True', and return --- the consumed input. --- --- This parser does not fail. It will return an empty string if the --- predicate returns 'False' on the first byte of input. --- --- /Note/: Because this parser does not fail, do not use it with --- combinators such as 'many', because such parsers loop until a --- failure occurs. Careless use will thus result in an infinite loop. -takeWhile :: (Word8 -> Bool) -> Parser B.ByteString -takeWhile p = (B.concat . reverse) `fmap` go [] - where - go acc = do - (h,t) <- B8.span p <$> get - put t - if B.null t - then do - input <- wantInput - if input - then go (h:acc) - else return (h:acc) - else return (h:acc) - -takeRest :: Parser [B.ByteString] -takeRest = go [] - where - go acc = do - input <- wantInput - if input - then do - s <- get - put B.empty - go (s:acc) - else return (reverse acc) - --- | Consume all remaining input and return it as a single string. -takeByteString :: Parser B.ByteString -takeByteString = B.concat `fmap` takeRest - --- | Consume all remaining input and return it as a single string. -takeLazyByteString :: Parser L.ByteString -takeLazyByteString = L.fromChunks `fmap` takeRest - -data T s = T {-# UNPACK #-} !Int s - --- | A stateful scanner. The predicate consumes and transforms a --- state argument, and each transformed state is passed to successive --- invocations of the predicate on each byte of the input until one --- returns 'Nothing' or the input ends. --- --- This parser does not fail. It will return an empty string if the --- predicate returns 'Nothing' on the first byte of input. --- --- /Note/: Because this parser does not fail, do not use it with --- combinators such as 'many', because such parsers loop until a --- failure occurs. Careless use will thus result in an infinite loop. -scan :: s -> (s -> Word8 -> Maybe s) -> Parser B.ByteString -scan s0 p = do - chunks <- go [] s0 - case chunks of - [x] -> return x - xs -> return . B.concat . reverse $ xs - where - go acc s1 = do - let scanner (B.PS fp off len) = - withForeignPtr fp $ \ptr0 -> do - let start = ptr0 `plusPtr` off - end = start `plusPtr` len - inner ptr !s - | ptr < end = do - w <- peek ptr - case p s w of - Just s' -> inner (ptr `plusPtr` 1) s' - _ -> done (ptr `minusPtr` start) s - | otherwise = done (ptr `minusPtr` start) s - done !i !s = return (T i s) - inner start s1 - bs <- get - let T i s' = unsafePerformIO $ scanner bs - h = B.unsafeTake i bs - t = B.unsafeDrop i bs - put t - if B.null t - then do - input <- wantInput - if input - then go (h:acc) s' - else return (h:acc) - else return (h:acc) -{-# INLINE scan #-} - --- | Consume input as long as the predicate returns 'True', and return --- the consumed input. --- --- This parser requires the predicate to succeed on at least one byte --- of input: it will fail if the predicate never returns 'True' or if --- there is no input left. -takeWhile1 :: (Word8 -> Bool) -> Parser B.ByteString -takeWhile1 p = do - (`when` demandInput) =<< B.null <$> get - (h,t) <- B8.span p <$> get - when (B.null h) $ fail "takeWhile1" - put t - if B.null t - then (h+++) `fmap` takeWhile p - else return h - --- | Match any byte in a set. --- --- >vowel = inClass "aeiou" --- --- Range notation is supported. --- --- >halfAlphabet = inClass "a-nA-N" --- --- To add a literal @\'-\'@ to a set, place it at the beginning or end --- of the string. -inClass :: String -> Word8 -> Bool -inClass s = (`memberWord8` mySet) - where mySet = charClass s -{-# INLINE inClass #-} - --- | Match any byte not in a set. -notInClass :: String -> Word8 -> Bool -notInClass s = not . inClass s -{-# INLINE notInClass #-} - --- | Match any byte. -anyWord8 :: Parser Word8 -anyWord8 = satisfy $ const True -{-# INLINE anyWord8 #-} - --- | Match a specific byte. -word8 :: Word8 -> Parser Word8 -word8 c = satisfy (== c) show c -{-# INLINE word8 #-} - --- | Match any byte except the given one. -notWord8 :: Word8 -> Parser Word8 -notWord8 c = satisfy (/= c) "not " ++ show c -{-# INLINE notWord8 #-} + _ | pos < atBufferEnd (undefined :: t) t -> succ t pos more True + | more == Complete -> succ t pos more False + | otherwise -> let lose' t' pos' more' = succ t' pos' more' False + succ' t' pos' more' = succ t' pos' more' True + in prompt t pos more lose' succ' +{-# INLINE wantInput #-} -- | Match only if all input has been consumed. -endOfInput :: Parser () -endOfInput = Parser $ \i0 a0 m0 kf ks -> - if B.null (unI i0) - then if m0 == Complete - then ks i0 a0 m0 () - else let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $ - \ i2 a2 m2 -> ks i2 a2 m2 () - ks' i1 a1 m1 _ = addS i0 a0 m0 i1 a1 m1 $ - \ i2 a2 m2 -> kf i2 a2 m2 [] - "endOfInput" - in runParser demandInput i0 a0 m0 kf' ks' - else kf i0 a0 m0 [] "endOfInput" +endOfInput :: forall t . Chunk t => Parser t () +endOfInput = Parser $ \t pos more lose succ -> + case () of + _| pos < atBufferEnd (undefined :: t) t -> lose t pos more [] "endOfInput" + | more == Complete -> succ t pos more () + | otherwise -> + let lose' t' pos' more' _ctx _msg = succ t' pos' more' () + succ' t' pos' more' _a = lose t' pos' more' [] "endOfInput" + in runParser demandInput t pos more lose' succ' +{-# SPECIALIZE endOfInput :: Parser ByteString () #-} +{-# SPECIALIZE endOfInput :: Parser Text () #-} -- | Return an indication of whether the end of input has been -- reached. -atEnd :: Parser Bool +atEnd :: Chunk t => Parser t Bool atEnd = not <$> wantInput {-# INLINE atEnd #-} --- | Match either a single newline character @\'\\n\'@, or a carriage --- return followed by a newline character @\"\\r\\n\"@. -endOfLine :: Parser () -endOfLine = (word8 10 >> return ()) <|> (string "\r\n" >> return ()) - ---- | Name the parser, in case failure occurs. -() :: Parser a - -> String -- ^ the name to use if parsing fails - -> Parser a -p msg0 = Parser $ \i0 a0 m0 kf ks -> - let kf' i a m strs msg = kf i a m (msg0:strs) msg - in runParser p i0 a0 m0 kf' ks -{-# INLINE () #-} -infix 0 - --- | Terminal failure continuation. -failK :: Failure a -failK i0 _a0 _m0 stack msg = Fail (unI i0) stack msg -{-# INLINE failK #-} - --- | Terminal success continuation. -successK :: Success a a -successK i0 _a0 _m0 a = Done (unI i0) a -{-# INLINE successK #-} +satisfySuspended :: forall t r . Chunk t + => (ChunkElem t -> Bool) + -> State t -> Pos -> More + -> Failure t (State t) r + -> Success t (State t) (ChunkElem t) r + -> IResult t r +satisfySuspended p t pos more lose succ = + runParser (demandInput >> go) t pos more lose succ + where go = Parser $ \t' pos' more' lose' succ' -> + case bufferElemAt (undefined :: t) pos' t' of + Just (e, l) | p e -> succ' t' (pos' + Pos l) more' e + | otherwise -> lose' t' pos' more' [] "satisfyElem" + Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ' +{-# SPECIALIZE satisfySuspended :: (ChunkElem ByteString -> Bool) + -> State ByteString -> Pos -> More + -> Failure ByteString (State ByteString) r + -> Success ByteString (State ByteString) + (ChunkElem ByteString) r + -> IResult ByteString r #-} +{-# SPECIALIZE satisfySuspended :: (ChunkElem Text -> Bool) + -> State Text -> Pos -> More + -> Failure Text (State Text) r + -> Success Text (State Text) + (ChunkElem Text) r + -> IResult Text r #-} --- | Run a parser. -parse :: Parser a -> B.ByteString -> Result a -parse m s = runParser m (I s) (A B.empty) Incomplete failK successK -{-# INLINE parse #-} +-- | The parser @satisfyElem p@ succeeds for any chunk element for which the +-- predicate @p@ returns 'True'. Returns the element that is +-- actually parsed. +satisfyElem :: forall t . Chunk t + => (ChunkElem t -> Bool) -> Parser t (ChunkElem t) +satisfyElem p = Parser $ \t pos more lose succ -> + case bufferElemAt (undefined :: t) pos t of + Just (e, l) | p e -> succ t (pos + Pos l) more e + | otherwise -> lose t pos more [] "satisfyElem" + Nothing -> satisfySuspended p t pos more lose succ +{-# INLINE satisfyElem #-} --- | Run a parser that cannot be resupplied via a 'Partial' result. -parseOnly :: Parser a -> B.ByteString -> Either String a -parseOnly m s = case runParser m (I s) (A B.empty) Complete failK successK of - Fail _ _ err -> Left err - Done _ a -> Right a - _ -> error "parseOnly: impossible error!" -{-# INLINE parseOnly #-} +-- | Concatenate a monoid after reversing its elements. Used to +-- glue together a series of textual chunks that have been accumulated +-- \"backwards\". +concatReverse :: Monoid m => [m] -> m +concatReverse [x] = x +concatReverse xs = mconcat (reverse xs) +{-# INLINE concatReverse #-} diff --git a/Data/Attoparsec/Internal/Types.hs b/Data/Attoparsec/Internal/Types.hs --- a/Data/Attoparsec/Internal/Types.hs +++ b/Data/Attoparsec/Internal/Types.hs @@ -1,185 +1,266 @@ -{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, RecordWildCards #-} +{-# LANGUAGE CPP, BangPatterns, GeneralizedNewtypeDeriving, OverloadedStrings, + Rank2Types, RecordWildCards, TypeFamilies #-} -- | -- Module : Data.Attoparsec.Internal.Types --- Copyright : Bryan O'Sullivan 2007-2011 +-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- --- Simple, efficient parser combinators for 'B.ByteString' strings, --- loosely based on the Parsec library. +-- Simple, efficient parser combinators, loosely based on the Parsec +-- library. module Data.Attoparsec.Internal.Types ( Parser(..) + , State , Failure , Success - , Result(..) - , Input(..) - , Added(..) + , Pos(..) + , IResult(..) , More(..) - , addS - , noAdds - , (+++) + , (<>) + , Chunk(..) ) where -import Control.Applicative (Alternative(..), Applicative(..)) +import Control.Applicative as App (Applicative(..), (<$>)) +import Control.Applicative (Alternative(..)) import Control.DeepSeq (NFData(rnf)) import Control.Monad (MonadPlus(..)) -import Data.Monoid (Monoid(..)) -import Prelude hiding (getChar, take, takeWhile) -import qualified Data.ByteString.Char8 as B +import qualified Control.Monad.Fail as Fail (MonadFail(..)) +import Data.Monoid as Mon (Monoid(..)) +import Data.Semigroup (Semigroup(..)) +import Data.Word (Word8) +import Data.ByteString (ByteString) +import qualified Data.ByteString as BS +import Data.ByteString.Internal (w2c) +import Data.Text (Text) +import qualified Data.Text as Text +import Data.Text.Unsafe (Iter(..)) +import Prelude hiding (succ) +import qualified Data.Attoparsec.ByteString.Buffer as B +import qualified Data.Attoparsec.Text.Buffer as T --- | The result of a parse. -data Result r = Fail B.ByteString [String] String - -- ^ The parse failed. The 'B.ByteString' is the input - -- that had not yet been consumed when the failure - -- occurred. The @[@'String'@]@ is a list of contexts - -- in which the error occurred. The 'String' is the - -- message describing the error, if any. - | Partial (B.ByteString -> Result r) - -- ^ Supply this continuation with more input so that - -- the parser can resume. To indicate that no more - -- input is available, use an 'B.empty' string. - | Done B.ByteString r - -- ^ The parse succeeded. The 'B.ByteString' is the - -- input that had not yet been consumed (if any) when - -- the parse succeeded. +newtype Pos = Pos { fromPos :: Int } + deriving (Eq, Ord, Show, Num) -instance Show r => Show (Result r) where - show (Fail bs stk msg) = - "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg - show (Partial _) = "Partial _" - show (Done bs r) = "Done " ++ show bs ++ " " ++ show r +-- | The result of a parse. This is parameterised over the type @i@ +-- of string that was processed. +-- +-- This type is an instance of 'Functor', where 'fmap' transforms the +-- value in a 'Done' result. +data IResult i r = + Fail i [String] String + -- ^ The parse failed. The @i@ parameter is the input that had + -- not yet been consumed when the failure occurred. The + -- @[@'String'@]@ is a list of contexts in which the error + -- occurred. The 'String' is the message describing the error, if + -- any. + | Partial (i -> IResult i r) + -- ^ Supply this continuation with more input so that the parser + -- can resume. To indicate that no more input is available, pass + -- an empty string to the continuation. + -- + -- __Note__: if you get a 'Partial' result, do not call its + -- continuation more than once. + | Done i r + -- ^ The parse succeeded. The @i@ parameter is the input that had + -- not yet been consumed (if any) when the parse succeeded. -instance (NFData r) => NFData (Result r) where - rnf (Fail _ _ _) = () +instance (Show i, Show r) => Show (IResult i r) where + showsPrec d ir = showParen (d > 10) $ + case ir of + (Fail t stk msg) -> showString "Fail" . f t . f stk . f msg + (Partial _) -> showString "Partial _" + (Done t r) -> showString "Done" . f t . f r + where f :: Show a => a -> ShowS + f x = showChar ' ' . showsPrec 11 x + +instance (NFData i, NFData r) => NFData (IResult i r) where + rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg rnf (Partial _) = () - rnf (Done _ r) = rnf r + rnf (Done t r) = rnf t `seq` rnf r {-# INLINE rnf #-} -fmapR :: (a -> b) -> Result a -> Result b -fmapR _ (Fail st stk msg) = Fail st stk msg -fmapR f (Partial k) = Partial (fmapR f . k) -fmapR f (Done bs r) = Done bs (f r) - -instance Functor Result where - fmap = fmapR - {-# INLINE fmap #-} - -newtype Input = I {unI :: B.ByteString} -newtype Added = A {unA :: B.ByteString} +instance Functor (IResult i) where + fmap _ (Fail t stk msg) = Fail t stk msg + fmap f (Partial k) = Partial (fmap f . k) + fmap f (Done t r) = Done t (f r) --- | The 'Parser' type is a monad. -newtype Parser a = Parser { - runParser :: forall r. Input -> Added -> More - -> Failure r - -> Success a r - -> Result r +-- | The core parser type. This is parameterised over the type @i@ +-- of string being processed. +-- +-- This type is an instance of the following classes: +-- +-- * 'Monad', where 'fail' throws an exception (i.e. fails) with an +-- error message. +-- +-- * 'Functor' and 'Applicative', which follow the usual definitions. +-- +-- * 'MonadPlus', where 'mzero' fails (with no error message) and +-- 'mplus' executes the right-hand parser if the left-hand one +-- fails. When the parser on the right executes, the input is reset +-- to the same state as the parser on the left started with. (In +-- other words, attoparsec is a backtracking parser that supports +-- arbitrary lookahead.) +-- +-- * 'Alternative', which follows 'MonadPlus'. +newtype Parser i a = Parser { + runParser :: forall r. + State i -> Pos -> More + -> Failure i (State i) r + -> Success i (State i) a r + -> IResult i r } -type Failure r = Input -> Added -> More -> [String] -> String -> Result r -type Success a r = Input -> Added -> More -> a -> Result r +type family State i +type instance State ByteString = B.Buffer +type instance State Text = T.Buffer +type Failure i t r = t -> Pos -> More -> [String] -> String + -> IResult i r +type Success i t a r = t -> Pos -> More -> a -> IResult i r + -- | Have we read all available input? data More = Complete | Incomplete deriving (Eq, Show) -addS :: Input -> Added -> More - -> Input -> Added -> More - -> (Input -> Added -> More -> r) -> r -addS i0 a0 m0 _i1 a1 m1 f = - let !i = I (unI i0 +++ unA a1) - a = A (unA a0 +++ unA a1) - !m = m0 <> m1 - in f i a m - where - Complete <> _ = Complete - _ <> Complete = Complete - _ <> _ = Incomplete -{-# INLINE addS #-} +instance Semigroup More where + c@Complete <> _ = c + _ <> m = m -bindP :: Parser a -> (a -> Parser b) -> Parser b -bindP m g = - Parser $ \i0 a0 m0 kf ks -> runParser m i0 a0 m0 kf $ - \i1 a1 m1 a -> runParser (g a) i1 a1 m1 kf ks -{-# INLINE bindP #-} +instance Mon.Monoid More where + mappend = (<>) + mempty = Incomplete -returnP :: a -> Parser a -returnP a = Parser (\i0 a0 m0 _kf ks -> ks i0 a0 m0 a) -{-# INLINE returnP #-} +instance Monad (Parser i) where +#if !(MIN_VERSION_base(4,13,0)) + fail = Fail.fail + {-# INLINE fail #-} +#endif -instance Monad Parser where - return = returnP - (>>=) = bindP - fail = failDesc + return = App.pure + {-# INLINE return #-} -noAdds :: Input -> Added -> More - -> (Input -> Added -> More -> r) -> r -noAdds i0 _a0 m0 f = f i0 (A B.empty) m0 -{-# INLINE noAdds #-} + m >>= k = Parser $ \t !pos more lose succ -> + let succ' t' !pos' more' a = runParser (k a) t' pos' more' lose succ + in runParser m t pos more lose succ' + {-# INLINE (>>=) #-} -plus :: Parser a -> Parser a -> Parser a -plus a b = Parser $ \i0 a0 m0 kf ks -> - let kf' i1 a1 m1 _ _ = addS i0 a0 m0 i1 a1 m1 $ - \ i2 a2 m2 -> runParser b i2 a2 m2 kf ks - in noAdds i0 a0 m0 $ \i2 a2 m2 -> runParser a i2 a2 m2 kf' ks -{-# INLINE plus #-} + (>>) = (*>) + {-# INLINE (>>) #-} -instance MonadPlus Parser where - mzero = failDesc "mzero" + +instance Fail.MonadFail (Parser i) where + fail err = Parser $ \t pos more lose _succ -> lose t pos more [] msg + where msg = "Failed reading: " ++ err + {-# INLINE fail #-} + +plus :: Parser i a -> Parser i a -> Parser i a +plus f g = Parser $ \t pos more lose succ -> + let lose' t' _pos' more' _ctx _msg = runParser g t' pos more' lose succ + in runParser f t pos more lose' succ + +instance MonadPlus (Parser i) where + mzero = fail "mzero" {-# INLINE mzero #-} mplus = plus -fmapP :: (a -> b) -> Parser a -> Parser b -fmapP p m = Parser $ \i0 a0 m0 f k -> - runParser m i0 a0 m0 f $ \i1 a1 s1 a -> k i1 a1 s1 (p a) -{-# INLINE fmapP #-} - -instance Functor Parser where - fmap = fmapP +instance Functor (Parser i) where + fmap f p = Parser $ \t pos more lose succ -> + let succ' t' pos' more' a = succ t' pos' more' (f a) + in runParser p t pos more lose succ' {-# INLINE fmap #-} -apP :: Parser (a -> b) -> Parser a -> Parser b +apP :: Parser i (a -> b) -> Parser i a -> Parser i b apP d e = do b <- d a <- e return (b a) {-# INLINE apP #-} -instance Applicative Parser where - pure = returnP +instance Applicative (Parser i) where + pure v = Parser $ \t !pos more _lose succ -> succ t pos more v {-# INLINE pure #-} (<*>) = apP {-# INLINE (<*>) #-} - - -- These definitions are equal to the defaults, but this - -- way the optimizer doesn't have to work so hard to figure - -- that out. - (*>) = (>>) + m *> k = m >>= \_ -> k {-# INLINE (*>) #-} - x <* y = x >>= \a -> y >> return a + x <* y = x >>= \a -> y >> pure a {-# INLINE (<*) #-} -instance Monoid (Parser a) where - mempty = failDesc "mempty" +instance Semigroup (Parser i a) where + (<>) = plus + {-# INLINE (<>) #-} + +instance Monoid (Parser i a) where + mempty = fail "mempty" {-# INLINE mempty #-} - mappend = plus + mappend = (<>) {-# INLINE mappend #-} -instance Alternative Parser where - empty = failDesc "empty" +instance Alternative (Parser i) where + empty = fail "empty" {-# INLINE empty #-} + (<|>) = plus {-# INLINE (<|>) #-} -failDesc :: String -> Parser a -failDesc err = Parser (\i0 a0 m0 kf _ks -> kf i0 a0 m0 [] msg) - where msg = "Failed reading: " ++ err -{-# INLINE failDesc #-} + many v = many_v + where + many_v = some_v <|> pure [] + some_v = (:) <$> v <*> many_v + {-# INLINE many #-} -(+++) :: B.ByteString -> B.ByteString -> B.ByteString -(+++) = B.append -{-# INLINE (+++) #-} + some v = some_v + where + many_v = some_v <|> pure [] + some_v = (:) <$> v <*> many_v + {-# INLINE some #-} + +-- | A common interface for input chunks. +class Monoid c => Chunk c where + type ChunkElem c + -- | Test if the chunk is empty. + nullChunk :: c -> Bool + -- | Append chunk to a buffer. + pappendChunk :: State c -> c -> State c + -- | Position at the end of a buffer. The first argument is ignored. + atBufferEnd :: c -> State c -> Pos + -- | Return the buffer element at the given position along with its length. + bufferElemAt :: c -> Pos -> State c -> Maybe (ChunkElem c, Int) + -- | Map an element to the corresponding character. + -- The first argument is ignored. + chunkElemToChar :: c -> ChunkElem c -> Char + +instance Chunk ByteString where + type ChunkElem ByteString = Word8 + nullChunk = BS.null + {-# INLINE nullChunk #-} + pappendChunk = B.pappend + {-# INLINE pappendChunk #-} + atBufferEnd _ = Pos . B.length + {-# INLINE atBufferEnd #-} + bufferElemAt _ (Pos i) buf + | i < B.length buf = Just (B.unsafeIndex buf i, 1) + | otherwise = Nothing + {-# INLINE bufferElemAt #-} + chunkElemToChar _ = w2c + {-# INLINE chunkElemToChar #-} + +instance Chunk Text where + type ChunkElem Text = Char + nullChunk = Text.null + {-# INLINE nullChunk #-} + pappendChunk = T.pappend + {-# INLINE pappendChunk #-} + atBufferEnd _ = Pos . T.length + {-# INLINE atBufferEnd #-} + bufferElemAt _ (Pos i) buf + | i < T.length buf = let Iter c l = T.iter buf i in Just (c, l) + | otherwise = Nothing + {-# INLINE bufferElemAt #-} + chunkElemToChar _ = id + {-# INLINE chunkElemToChar #-} diff --git a/Data/Attoparsec/Lazy.hs b/Data/Attoparsec/Lazy.hs --- a/Data/Attoparsec/Lazy.hs +++ b/Data/Attoparsec/Lazy.hs @@ -1,8 +1,8 @@ -- | -- Module : Data.Attoparsec.Lazy --- Copyright : Bryan O'Sullivan 2010 +-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 --- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown @@ -23,67 +23,7 @@ module Data.Attoparsec.Lazy ( - Result(..) - , module Data.Attoparsec - -- * Running parsers - , parse - , parseTest - -- ** Result conversion - , maybeResult - , eitherResult + module Data.Attoparsec.ByteString.Lazy ) where -import Data.ByteString.Lazy.Internal (ByteString(..), chunk) -import qualified Data.ByteString as B -import qualified Data.Attoparsec as A -import Data.Attoparsec hiding (Result(..), eitherResult, maybeResult, - parse, parseWith, parseTest) - --- | The result of a parse. -data Result r = Fail ByteString [String] String - -- ^ The parse failed. The 'ByteString' is the input - -- that had not yet been consumed when the failure - -- occurred. The @[@'String'@]@ is a list of contexts - -- in which the error occurred. The 'String' is the - -- message describing the error, if any. - | Done ByteString r - -- ^ The parse succeeded. The 'ByteString' is the - -- input that had not yet been consumed (if any) when - -- the parse succeeded. - -instance Show r => Show (Result r) where - show (Fail bs stk msg) = - "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg - show (Done bs r) = "Done " ++ show bs ++ " " ++ show r - -fmapR :: (a -> b) -> Result a -> Result b -fmapR _ (Fail st stk msg) = Fail st stk msg -fmapR f (Done bs r) = Done bs (f r) - -instance Functor Result where - fmap = fmapR - --- | Run a parser and return its result. -parse :: A.Parser a -> ByteString -> Result a -parse p s = case s of - Chunk x xs -> go (A.parse p x) xs - empty -> go (A.parse p B.empty) empty - where - go (A.Fail x stk msg) ys = Fail (chunk x ys) stk msg - go (A.Done x r) ys = Done (chunk x ys) r - go (A.Partial k) (Chunk y ys) = go (k y) ys - go (A.Partial k) empty = go (k B.empty) empty - --- | Run a parser and print its result to standard output. -parseTest :: (Show a) => A.Parser a -> ByteString -> IO () -parseTest p s = print (parse p s) - --- | Convert a 'Result' value to a 'Maybe' value. -maybeResult :: Result r -> Maybe r -maybeResult (Done _ r) = Just r -maybeResult _ = Nothing - --- | Convert a 'Result' value to an 'Either' value. -eitherResult :: Result r -> Either String r -eitherResult (Done _ r) = Right r -eitherResult (Fail _ _ msg) = Left msg +import Data.Attoparsec.ByteString.Lazy diff --git a/Data/Attoparsec/Number.hs b/Data/Attoparsec/Number.hs --- a/Data/Attoparsec/Number.hs +++ b/Data/Attoparsec/Number.hs @@ -1,16 +1,22 @@ {-# LANGUAGE DeriveDataTypeable #-} -- | -- Module : Data.Attoparsec.Number --- Copyright : Bryan O'Sullivan 2011 +-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 -- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown -- +-- This module is deprecated, and both the module and 'Number' type +-- will be removed in the next major release. Use the +-- package +-- and the 'Data.Scientific.Scientific' type instead. +-- -- A simple number type, useful for parsing both exact and inexact -- quantities without losing much precision. module Data.Attoparsec.Number + {-# DEPRECATED "This module will be removed in the next major release." #-} ( Number(..) ) where @@ -22,9 +28,13 @@ -- | A numeric type that can represent integers accurately, and -- floating point numbers to the precision of a 'Double'. +-- +-- /Note/: this type is deprecated, and will be removed in the next +-- major release. Use the 'Data.Scientific.Scientific' type instead. data Number = I !Integer | D {-# UNPACK #-} !Double deriving (Typeable, Data) +{-# DEPRECATED Number "Use Scientific instead." #-} instance Show Number where show (I a) = show a @@ -54,8 +64,17 @@ (<) = binop (<) (<) {-# INLINE (<) #-} + (<=) = binop (<=) (<=) + {-# INLINE (<=) #-} + (>) = binop (>) (>) {-# INLINE (>) #-} + + (>=) = binop (>=) (>=) + {-# INLINE (>=) #-} + + compare = binop compare compare + {-# INLINE compare #-} instance Num Number where (+) = binop (((I$!).) . (+)) (((D$!).) . (+)) diff --git a/Data/Attoparsec/Text.hs b/Data/Attoparsec/Text.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/Text.hs @@ -0,0 +1,502 @@ +{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeSynonymInstances #-} +#if __GLASGOW_HASKELL__ >= 702 +{-# LANGUAGE Trustworthy #-} -- Imports internal modules +#endif +{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-} + +-- | +-- Module : Data.Attoparsec.Text +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient combinator parsing for 'Text' strings, +-- loosely based on the Parsec library. + +module Data.Attoparsec.Text + ( + -- * Differences from Parsec + -- $parsec + + -- * Incremental input + -- $incremental + + -- * Performance considerations + -- $performance + + -- * Parser types + Parser + , Result + , T.IResult(..) + , I.compareResults + + -- * Running parsers + , parse + , feed + , I.parseOnly + , parseWith + , parseTest + + -- ** Result conversion + , maybeResult + , eitherResult + + -- * Parsing individual characters + , I.char + , I.anyChar + , I.notChar + , I.satisfy + , I.satisfyWith + , I.skip + + -- ** Lookahead + , I.peekChar + , I.peekChar' + + -- ** Special character parsers + , digit + , letter + , space + + -- ** Character classes + , I.inClass + , I.notInClass + + -- * Efficient string handling + , I.string + , I.stringCI + , I.asciiCI + , skipSpace + , I.skipWhile + , I.scan + , I.runScanner + , I.take + , I.takeWhile + , I.takeWhile1 + , I.takeTill + + -- ** String combinators + -- $specalt + , (.*>) + , (<*.) + + -- ** Consume all remaining input + , I.takeText + , I.takeLazyText + + -- * Text parsing + , I.endOfLine + , isEndOfLine + , isHorizontalSpace + + -- * Numeric parsers + , decimal + , hexadecimal + , signed + , double + , Number(..) + , number + , rational + , scientific + + -- * Combinators + , try + , () + , choice + , count + , option + , many' + , many1 + , many1' + , manyTill + , manyTill' + , sepBy + , sepBy' + , sepBy1 + , sepBy1' + , skipMany + , skipMany1 + , eitherP + , I.match + -- * State observation and manipulation functions + , I.endOfInput + , I.atEnd + ) where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative (pure, (*>), (<*), (<$>)) +import Data.Word (Word) +#endif +import Control.Applicative ((<|>)) +import Data.Attoparsec.Combinator +import Data.Attoparsec.Number (Number(..)) +import Data.Scientific (Scientific) +import qualified Data.Scientific as Sci +import Data.Attoparsec.Text.Internal (Parser, Result, parse, takeWhile1) +import Data.Bits (Bits, (.|.), shiftL) +import Data.Char (isAlpha, isDigit, isSpace, ord) +import Data.Int (Int8, Int16, Int32, Int64) +import Data.List (intercalate) +import Data.Text (Text) +import Data.Word (Word8, Word16, Word32, Word64) +import qualified Data.Attoparsec.Internal as I +import qualified Data.Attoparsec.Internal.Types as T +import qualified Data.Attoparsec.Text.Internal as I +import qualified Data.Text as T + +-- $parsec +-- +-- Compared to Parsec 3, attoparsec makes several tradeoffs. It is +-- not intended for, or ideal for, all possible uses. +-- +-- * While attoparsec can consume input incrementally, Parsec cannot. +-- Incremental input is a huge deal for efficient and secure network +-- and system programming, since it gives much more control to users +-- of the library over matters such as resource usage and the I/O +-- model to use. +-- +-- * Much of the performance advantage of attoparsec is gained via +-- high-performance parsers such as 'I.takeWhile' and 'I.string'. +-- If you use complicated combinators that return lists of +-- characters, there is less performance difference between the two +-- libraries. +-- +-- * Unlike Parsec 3, attoparsec does not support being used as a +-- monad transformer. +-- +-- * attoparsec is specialised to deal only with strict 'Text' +-- input. Efficiency concerns rule out both lists and lazy text. +-- The usual use for lazy text would be to allow consumption of very +-- large input without a large footprint. For this need, +-- attoparsec's incremental input provides an excellent substitute, +-- with much more control over when input takes place. If you must +-- use lazy text, see the 'Lazy' module, which feeds lazy chunks to +-- a regular parser. +-- +-- * Parsec parsers can produce more helpful error messages than +-- attoparsec parsers. This is a matter of focus: attoparsec avoids +-- the extra book-keeping in favour of higher performance. + +-- $incremental +-- +-- attoparsec supports incremental input, meaning that you can feed it +-- a 'Text' that represents only part of the expected total amount +-- of data to parse. If your parser reaches the end of a fragment of +-- input and could consume more input, it will suspend parsing and +-- return a 'T.Partial' continuation. +-- +-- Supplying the 'T.Partial' continuation with another string will +-- resume parsing at the point where it was suspended, with the string +-- you supplied used as new input at the end of the existing +-- input. You must be prepared for the result of the resumed parse to +-- be another 'Partial' continuation. +-- +-- To indicate that you have no more input, supply the 'Partial' +-- continuation with an 'T.empty' 'Text'. +-- +-- Remember that some parsing combinators will not return a result +-- until they reach the end of input. They may thus cause 'T.Partial' +-- results to be returned. +-- +-- If you do not need support for incremental input, consider using +-- the 'I.parseOnly' function to run your parser. It will never +-- prompt for more input. +-- +-- /Note/: incremental input does /not/ imply that attoparsec will +-- release portions of its internal state for garbage collection as it +-- proceeds. Its internal representation is equivalent to a single +-- 'Text': if you feed incremental input to an a parser, it will +-- require memory proportional to the amount of input you supply. +-- (This is necessary to support arbitrary backtracking.) + +-- $performance +-- +-- If you write an attoparsec-based parser carefully, it can be +-- realistic to expect it to perform similarly to a hand-rolled C +-- parser (measuring megabytes parsed per second). +-- +-- To actually achieve high performance, there are a few guidelines +-- that it is useful to follow. +-- +-- Use the 'Text'-oriented parsers whenever possible, +-- e.g. 'I.takeWhile1' instead of 'many1' 'I.anyChar'. There is +-- about a factor of 100 difference in performance between the two +-- kinds of parser. +-- +-- For very simple character-testing predicates, write them by hand +-- instead of using 'I.inClass' or 'I.notInClass'. For instance, both +-- of these predicates test for an end-of-line character, but the +-- first is much faster than the second: +-- +-- >endOfLine_fast c = c == '\r' || c == '\n' +-- >endOfLine_slow = inClass "\r\n" +-- +-- Make active use of benchmarking and profiling tools to measure, +-- find the problems with, and improve the performance of your parser. + +-- | Run a parser and print its result to standard output. +parseTest :: (Show a) => I.Parser a -> Text -> IO () +parseTest p s = print (parse p s) + +-- | Run a parser with an initial input string, and a monadic action +-- that can supply more input if needed. +parseWith :: Monad m => + (m Text) + -- ^ An action that will be executed to provide the parser + -- with more input, if necessary. The action must return an + -- 'T.empty' string when there is no more input available. + -> I.Parser a + -> Text + -- ^ Initial input for the parser. + -> m (Result a) +parseWith refill p s = step $ parse p s + where step (T.Partial k) = (step . k) =<< refill + step r = return r +{-# INLINE parseWith #-} + +-- | Convert a 'Result' value to a 'Maybe' value. A 'Partial' result +-- is treated as failure. +maybeResult :: Result r -> Maybe r +maybeResult (T.Done _ r) = Just r +maybeResult _ = Nothing + +-- | Convert a 'Result' value to an 'Either' value. A 'Partial' result +-- is treated as failure. +eitherResult :: Result r -> Either String r +eitherResult (T.Done _ r) = Right r +eitherResult (T.Fail _ [] msg) = Left msg +eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) +eitherResult _ = Left "Result: incomplete input" + +-- | A predicate that matches either a carriage return @\'\\r\'@ or +-- newline @\'\\n\'@ character. +isEndOfLine :: Char -> Bool +isEndOfLine c = c == '\n' || c == '\r' +{-# INLINE isEndOfLine #-} + +-- | A predicate that matches either a space @\' \'@ or horizontal tab +-- @\'\\t\'@ character. +isHorizontalSpace :: Char -> Bool +isHorizontalSpace c = c == ' ' || c == '\t' +{-# INLINE isHorizontalSpace #-} + +-- | Parse and decode an unsigned hexadecimal number. The hex digits +-- @\'a\'@ through @\'f\'@ may be upper or lower case. +-- +-- This parser does not accept a leading @\"0x\"@ string. +hexadecimal :: (Integral a, Bits a) => Parser a +hexadecimal = T.foldl' step 0 `fmap` takeWhile1 isHexDigit + where + isHexDigit c = (c >= '0' && c <= '9') || + (c >= 'a' && c <= 'f') || + (c >= 'A' && c <= 'F') + step a c | w >= 48 && w <= 57 = (a `shiftL` 4) .|. fromIntegral (w - 48) + | w >= 97 = (a `shiftL` 4) .|. fromIntegral (w - 87) + | otherwise = (a `shiftL` 4) .|. fromIntegral (w - 55) + where w = ord c +{-# SPECIALISE hexadecimal :: Parser Int #-} +{-# SPECIALISE hexadecimal :: Parser Int8 #-} +{-# SPECIALISE hexadecimal :: Parser Int16 #-} +{-# SPECIALISE hexadecimal :: Parser Int32 #-} +{-# SPECIALISE hexadecimal :: Parser Int64 #-} +{-# SPECIALISE hexadecimal :: Parser Integer #-} +{-# SPECIALISE hexadecimal :: Parser Word #-} +{-# SPECIALISE hexadecimal :: Parser Word8 #-} +{-# SPECIALISE hexadecimal :: Parser Word16 #-} +{-# SPECIALISE hexadecimal :: Parser Word32 #-} +{-# SPECIALISE hexadecimal :: Parser Word64 #-} + +-- | Parse and decode an unsigned decimal number. +decimal :: Integral a => Parser a +decimal = T.foldl' step 0 `fmap` takeWhile1 isDecimal + where step a c = a * 10 + fromIntegral (ord c - 48) +{-# SPECIALISE decimal :: Parser Int #-} +{-# SPECIALISE decimal :: Parser Int8 #-} +{-# SPECIALISE decimal :: Parser Int16 #-} +{-# SPECIALISE decimal :: Parser Int32 #-} +{-# SPECIALISE decimal :: Parser Int64 #-} +{-# SPECIALISE decimal :: Parser Integer #-} +{-# SPECIALISE decimal :: Parser Word #-} +{-# SPECIALISE decimal :: Parser Word8 #-} +{-# SPECIALISE decimal :: Parser Word16 #-} +{-# SPECIALISE decimal :: Parser Word32 #-} +{-# SPECIALISE decimal :: Parser Word64 #-} + +isDecimal :: Char -> Bool +isDecimal c = c >= '0' && c <= '9' +{-# INLINE isDecimal #-} + +-- | Parse a number with an optional leading @\'+\'@ or @\'-\'@ sign +-- character. +signed :: Num a => Parser a -> Parser a +{-# SPECIALISE signed :: Parser Int -> Parser Int #-} +{-# SPECIALISE signed :: Parser Int8 -> Parser Int8 #-} +{-# SPECIALISE signed :: Parser Int16 -> Parser Int16 #-} +{-# SPECIALISE signed :: Parser Int32 -> Parser Int32 #-} +{-# SPECIALISE signed :: Parser Int64 -> Parser Int64 #-} +{-# SPECIALISE signed :: Parser Integer -> Parser Integer #-} +signed p = (negate <$> (I.char '-' *> p)) + <|> (I.char '+' *> p) + <|> p + +-- | Parse a rational number. +-- +-- The syntax accepted by this parser is the same as for 'double'. +-- +-- /Note/: this parser is not safe for use with inputs from untrusted +-- sources. An input with a suitably large exponent such as +-- @"1e1000000000"@ will cause a huge 'Integer' to be allocated, +-- resulting in what is effectively a denial-of-service attack. +-- +-- In most cases, it is better to use 'double' or 'scientific' +-- instead. +rational :: Fractional a => Parser a +{-# SPECIALIZE rational :: Parser Double #-} +{-# SPECIALIZE rational :: Parser Float #-} +{-# SPECIALIZE rational :: Parser Rational #-} +{-# SPECIALIZE rational :: Parser Scientific #-} +rational = scientifically realToFrac + +-- | Parse a 'Double'. +-- +-- This parser accepts an optional leading sign character, followed by +-- at most one decimal digit. The syntax is similar to that accepted by +-- the 'read' function, with the exception that a trailing @\'.\'@ is +-- consumed. +-- +-- === Examples +-- +-- These examples use this helper: +-- +-- @ +-- r :: 'Parser' a -> 'Data.Text.Text' -> 'Data.Attoparsec.Text.Result' a +-- r p s = 'feed' ('Data.Attoparsec.parse' p s) 'mempty' +-- @ +-- +-- Examples with behaviour identical to 'read', if you feed an empty +-- continuation to the first result: +-- +-- > r double "3" == Done "" 3.0 +-- > r double "3.1" == Done "" 3.1 +-- > r double "3e4" == Done "" 30000.0 +-- > r double "3.1e4" == Done "" 31000.0 +-- > r double "3e" == Done "e" 3.0 +-- +-- Examples with behaviour identical to 'read': +-- +-- > r double ".3" == Fail ".3" _ _ +-- > r double "e3" == Fail "e3" _ _ +-- +-- Example of difference from 'read': +-- +-- > r double "3.foo" == Done "foo" 3.0 +-- +-- This function does not accept string representations of \"NaN\" or +-- \"Infinity\". +double :: Parser Double +double = scientifically Sci.toRealFloat + +-- | Parse a number, attempting to preserve both speed and precision. +-- +-- The syntax accepted by this parser is the same as for 'double'. +-- +-- This function does not accept string representations of \"NaN\" or +-- \"Infinity\". +number :: Parser Number +number = scientifically $ \s -> + let e = Sci.base10Exponent s + c = Sci.coefficient s + in if e >= 0 + then I (c * 10 ^ e) + else D (Sci.toRealFloat s) +{-# DEPRECATED number "Use 'scientific' instead." #-} + +-- | Parse a scientific number. +-- +-- The syntax accepted by this parser is the same as for 'double'. +scientific :: Parser Scientific +scientific = scientifically id + +-- A strict pair +data SP = SP !Integer {-# UNPACK #-}!Int + +{-# INLINE scientifically #-} +scientifically :: (Scientific -> a) -> Parser a +scientifically h = do + !positive <- ((== '+') <$> I.satisfy (\c -> c == '-' || c == '+')) <|> + pure True + + n <- decimal + + let f fracDigits = SP (T.foldl' step n fracDigits) + (negate $ T.length fracDigits) + step a c = a * 10 + fromIntegral (ord c - 48) + + SP c e <- (I.satisfy (=='.') *> (f <$> I.takeWhile isDigit)) <|> + pure (SP n 0) + + let !signedCoeff | positive = c + | otherwise = -c + + (I.satisfy (\w -> w == 'e' || w == 'E') *> + fmap (h . Sci.scientific signedCoeff . (e +)) (signed decimal)) <|> + return (h $ Sci.scientific signedCoeff e) + +-- | Parse a single digit, as recognised by 'isDigit'. +digit :: Parser Char +digit = I.satisfy isDigit "digit" +{-# INLINE digit #-} + +-- | Parse a letter, as recognised by 'isAlpha'. +letter :: Parser Char +letter = I.satisfy isAlpha "letter" +{-# INLINE letter #-} + +-- | Parse a space character, as recognised by 'isSpace'. +space :: Parser Char +space = I.satisfy isSpace "space" +{-# INLINE space #-} + +-- | Skip over white space. +skipSpace :: Parser () +skipSpace = I.skipWhile isSpace +{-# INLINE skipSpace #-} + +-- $specalt +-- +-- If you enable the @OverloadedStrings@ language extension, you can +-- use the '*>' and '<*' combinators to simplify the common task of +-- matching a statically known string, then immediately parsing +-- something else. +-- +-- Instead of writing something like this: +-- +-- @ +--'I.string' \"foo\" '*>' wibble +-- @ +-- +-- Using @OverloadedStrings@, you can omit the explicit use of +-- 'I.string', and write a more compact version: +-- +-- @ +-- \"foo\" '*>' wibble +-- @ +-- +-- (Note: the '.*>' and '<*.' combinators that were originally +-- provided for this purpose are obsolete and unnecessary, and will be +-- removed in the next major version.) + +-- | /Obsolete/. A type-specialized version of '*>' for 'Text'. Use +-- '*>' instead. +(.*>) :: Text -> Parser a -> Parser a +s .*> f = I.string s *> f +{-# DEPRECATED (.*>) "This is no longer necessary, and will be removed. Use '*>' instead." #-} + +-- | /Obsolete/. A type-specialized version of '<*' for 'Text'. Use +-- '*>' instead. +(<*.) :: Parser a -> Text -> Parser a +f <*. s = f <* I.string s +{-# DEPRECATED (<*.) "This is no longer necessary, and will be removed. Use '<*' instead." #-} diff --git a/Data/Attoparsec/Text/Internal.hs b/Data/Attoparsec/Text/Internal.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/Text/Internal.hs @@ -0,0 +1,549 @@ +{-# LANGUAGE BangPatterns, FlexibleInstances, GADTs, OverloadedStrings, + Rank2Types, RecordWildCards, TypeFamilies, TypeSynonymInstances #-} +{-# OPTIONS_GHC -fno-warn-orphans #-} +-- | +-- Module : Data.Attoparsec.Text.Internal +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient parser combinators for 'Text' strings, loosely +-- based on the Parsec library. + +module Data.Attoparsec.Text.Internal + ( + -- * Parser types + Parser + , Result + + -- * Running parsers + , parse + , parseOnly + + -- * Combinators + , module Data.Attoparsec.Combinator + + -- * Parsing individual characters + , satisfy + , satisfyWith + , anyChar + , skip + , char + , notChar + + -- ** Lookahead + , peekChar + , peekChar' + + -- ** Character classes + , inClass + , notInClass + + -- * Efficient string handling + , skipWhile + , string + , stringCI + , asciiCI + , take + , scan + , runScanner + , takeWhile + , takeWhile1 + , takeTill + + -- ** Consume all remaining input + , takeText + , takeLazyText + + -- * Utilities + , endOfLine + , endOfInput + , match + , atEnd + ) where + +import Control.Applicative ((<|>), (<$>), pure, (*>)) +import Control.Monad (when) +import Data.Attoparsec.Combinator (()) +import Data.Attoparsec.Internal +import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success) +import qualified Data.Attoparsec.Text.Buffer as Buf +import Data.Attoparsec.Text.Buffer (Buffer, buffer) +import Data.Char (isAsciiUpper, isAsciiLower, toUpper, toLower) +import Data.List (intercalate) +import Data.String (IsString(..)) +import Data.Text.Internal (Text(..)) +import Prelude hiding (getChar, succ, take, takeWhile) +import qualified Data.Attoparsec.Internal.Types as T +import qualified Data.Attoparsec.Text.FastSet as Set +import qualified Data.Text as T +import qualified Data.Text.Lazy as L +import qualified Data.Text.Unsafe as T + +type Parser = T.Parser Text +type Result = IResult Text +type Failure r = T.Failure Text Buffer r +type Success a r = T.Success Text Buffer a r + +instance (a ~ Text) => IsString (Parser a) where + fromString = string . T.pack + +-- | The parser @satisfy p@ succeeds for any character for which the +-- predicate @p@ returns 'True'. Returns the character that is +-- actually parsed. +-- +-- >digit = satisfy isDigit +-- > where isDigit c = c >= '0' && c <= '9' +satisfy :: (Char -> Bool) -> Parser Char +satisfy p = do + (k,c) <- ensure 1 + let !h = T.unsafeHead c + if p h + then advance k >> return h + else fail "satisfy" +{-# INLINE satisfy #-} + +-- | The parser @skip p@ succeeds for any character for which the +-- predicate @p@ returns 'True'. +-- +-- >skipDigit = skip isDigit +-- > where isDigit c = c >= '0' && c <= '9' +skip :: (Char -> Bool) -> Parser () +skip p = do + (k,s) <- ensure 1 + if p (T.unsafeHead s) + then advance k + else fail "skip" + +-- | The parser @satisfyWith f p@ transforms a character, and succeeds +-- if the predicate @p@ returns 'True' on the transformed value. The +-- parser returns the transformed character that was parsed. +satisfyWith :: (Char -> a) -> (a -> Bool) -> Parser a +satisfyWith f p = do + (k,s) <- ensure 1 + let c = f $! T.unsafeHead s + if p c + then advance k >> return c + else fail "satisfyWith" +{-# INLINE satisfyWith #-} + +-- | Consume @n@ characters of input, but succeed only if the +-- predicate returns 'True'. +takeWith :: Int -> (Text -> Bool) -> Parser Text +takeWith n p = do + (k,s) <- ensure n + if p s + then advance k >> return s + else fail "takeWith" + +-- | Consume exactly @n@ characters of input. +take :: Int -> Parser Text +take n = takeWith (max n 0) (const True) +{-# INLINE take #-} + +-- | @string s@ parses a sequence of characters that identically match +-- @s@. Returns the parsed string (i.e. @s@). This parser consumes no +-- input if it fails (even if a partial match). +-- +-- /Note/: The behaviour of this parser is different to that of the +-- similarly-named parser in Parsec, as this one is all-or-nothing. +-- To illustrate the difference, the following parser will fail under +-- Parsec given an input of @\"for\"@: +-- +-- >string "foo" <|> string "for" +-- +-- The reason for its failure is that the first branch is a +-- partial match, and will consume the letters @\'f\'@ and @\'o\'@ +-- before failing. In attoparsec, the above parser will /succeed/ on +-- that input, because the failed first branch will consume nothing. +string :: Text -> Parser Text +string s = string_ (stringSuspended id) id s +{-# INLINE string #-} + +string_ :: (forall r. Text -> Text -> Buffer -> Pos -> More + -> Failure r -> Success Text r -> Result r) + -> (Text -> Text) + -> Text -> Parser Text +string_ suspended f s0 = T.Parser $ \t pos more lose succ -> + let s = f s0 + ft = f (Buf.unbufferAt (fromPos pos) t) + in case T.commonPrefixes s ft of + Nothing + | T.null s -> succ t pos more T.empty + | T.null ft -> suspended s s t pos more lose succ + | otherwise -> lose t pos more [] "string" + Just (pfx,ssfx,tsfx) + | T.null ssfx -> let l = Pos (Buf.lengthCodeUnits pfx) + in succ t (pos + l) more (substring pos l t) + | not (T.null tsfx) -> lose t pos more [] "string" + | otherwise -> suspended s ssfx t pos more lose succ +{-# INLINE string_ #-} + +stringSuspended :: (Text -> Text) + -> Text -> Text -> Buffer -> Pos -> More + -> Failure r + -> Success Text r + -> Result r +stringSuspended f s000 s0 t0 pos0 more0 lose0 succ0 = + runParser (demandInput_ >>= go) t0 pos0 more0 lose0 succ0 + where + go s' = T.Parser $ \t pos more lose succ -> + let s = f s' + in case T.commonPrefixes s0 s of + Nothing -> lose t pos more [] "string" + Just (_pfx,ssfx,tsfx) + | T.null ssfx -> let l = Pos (Buf.lengthCodeUnits s000) + in succ t (pos + l) more (substring pos l t) + | T.null tsfx -> stringSuspended f s000 ssfx t pos more lose succ + | otherwise -> lose t pos more [] "string" + +-- | Satisfy a literal string, ignoring case. +-- +-- Note: this function is currently quite inefficient. Unicode case +-- folding can change the length of a string (\"ß\" becomes +-- "ss"), which makes a simple, efficient implementation tricky. We +-- have (for now) chosen simplicity over efficiency. +stringCI :: Text -> Parser Text +stringCI s = go 0 + where + go !n + | n > T.length fs = fail "stringCI" + | otherwise = do + (k,t) <- ensure n + if T.toCaseFold t == fs + then advance k >> return t + else go (n+1) + fs = T.toCaseFold s +{-# INLINE stringCI #-} +{-# DEPRECATED stringCI "this is very inefficient, use asciiCI instead" #-} + +-- | Satisfy a literal string, ignoring case for characters in the ASCII range. +asciiCI :: Text -> Parser Text +asciiCI s = fmap fst $ match $ T.foldr ((*>) . asciiCharCI) (pure ()) s +{-# INLINE asciiCI #-} + +asciiCharCI :: Char -> Parser Char +asciiCharCI c + | isAsciiUpper c = char c <|> char (toLower c) + | isAsciiLower c = char c <|> char (toUpper c) + | otherwise = char c +{-# INLINE asciiCharCI #-} + +-- | Skip past input for as long as the predicate returns 'True'. +skipWhile :: (Char -> Bool) -> Parser () +skipWhile p = go + where + go = do + t <- T.takeWhile p <$> get + continue <- inputSpansChunks (size t) + when continue go +{-# INLINE skipWhile #-} + +-- | Consume input as long as the predicate returns 'False' +-- (i.e. until it returns 'True'), and return the consumed input. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'True' on the first character of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +takeTill :: (Char -> Bool) -> Parser Text +takeTill p = takeWhile (not . p) +{-# INLINE takeTill #-} + +-- | Consume input as long as the predicate returns 'True', and return +-- the consumed input. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'False' on the first character of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +takeWhile :: (Char -> Bool) -> Parser Text +takeWhile p = do + h <- T.takeWhile p <$> get + continue <- inputSpansChunks (size h) + -- only use slow concat path if necessary + if continue + then takeWhileAcc p [h] + else return h +{-# INLINE takeWhile #-} + +takeWhileAcc :: (Char -> Bool) -> [Text] -> Parser Text +takeWhileAcc p = go + where + go acc = do + h <- T.takeWhile p <$> get + continue <- inputSpansChunks (size h) + if continue + then go (h:acc) + else return $ concatReverse (h:acc) +{-# INLINE takeWhileAcc #-} + +takeRest :: Parser [Text] +takeRest = go [] + where + go acc = do + input <- wantInput + if input + then do + s <- get + advance (size s) + go (s:acc) + else return (reverse acc) + +-- | Consume all remaining input and return it as a single string. +takeText :: Parser Text +takeText = T.concat `fmap` takeRest + +-- | Consume all remaining input and return it as a single string. +takeLazyText :: Parser L.Text +takeLazyText = L.fromChunks `fmap` takeRest + +data Scan s = Continue s + | Finished s {-# UNPACK #-} !Int Text + +scan_ :: (s -> [Text] -> Parser r) -> s -> (s -> Char -> Maybe s) -> Parser r +scan_ f s0 p = go [] s0 + where + scanner s !n t = + case T.uncons t of + Just (c,t') -> case p s c of + Just s' -> scanner s' (n+1) t' + Nothing -> Finished s n t + Nothing -> Continue s + go acc s = do + input <- get + case scanner s 0 input of + Continue s' -> do continue <- inputSpansChunks (size input) + if continue + then go (input : acc) s' + else f s' (input : acc) + Finished s' n t -> do advance (size input - size t) + f s' (T.take n input : acc) +{-# INLINE scan_ #-} + +-- | A stateful scanner. The predicate consumes and transforms a +-- state argument, and each transformed state is passed to successive +-- invocations of the predicate on each character of the input until one +-- returns 'Nothing' or the input ends. +-- +-- This parser does not fail. It will return an empty string if the +-- predicate returns 'Nothing' on the first character of input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +scan :: s -> (s -> Char -> Maybe s) -> Parser Text +scan = scan_ $ \_ chunks -> return $! concatReverse chunks +{-# INLINE scan #-} + +-- | Like 'scan', but generalized to return the final state of the +-- scanner. +runScanner :: s -> (s -> Char -> Maybe s) -> Parser (Text, s) +runScanner = scan_ $ \s xs -> let !sx = concatReverse xs in return (sx, s) +{-# INLINE runScanner #-} + +-- | Consume input as long as the predicate returns 'True', and return +-- the consumed input. +-- +-- This parser requires the predicate to succeed on at least one +-- character of input: it will fail if the predicate never returns +-- 'True' or if there is no input left. +takeWhile1 :: (Char -> Bool) -> Parser Text +takeWhile1 p = do + (`when` demandInput) =<< endOfChunk + h <- T.takeWhile p <$> get + let size' = size h + when (size' == 0) $ fail "takeWhile1" + advance size' + eoc <- endOfChunk + if eoc + then takeWhileAcc p [h] + else return h +{-# INLINE takeWhile1 #-} + +-- | Match any character in a set. +-- +-- >vowel = inClass "aeiou" +-- +-- Range notation is supported. +-- +-- >halfAlphabet = inClass "a-nA-N" +-- +-- To add a literal @\'-\'@ to a set, place it at the beginning or end +-- of the string. +inClass :: String -> Char -> Bool +inClass s = (`Set.member` mySet) + where mySet = Set.charClass s + {-# NOINLINE mySet #-} +{-# INLINE inClass #-} + +-- | Match any character not in a set. +notInClass :: String -> Char -> Bool +notInClass s = not . inClass s +{-# INLINE notInClass #-} + +-- | Match any character. +anyChar :: Parser Char +anyChar = satisfy $ const True +{-# INLINE anyChar #-} + +-- | Match a specific character. +char :: Char -> Parser Char +char c = satisfy (== c) show c +{-# INLINE char #-} + +-- | Match any character except the given one. +notChar :: Char -> Parser Char +notChar c = satisfy (/= c) "not " ++ show c +{-# INLINE notChar #-} + +-- | Match any character, to perform lookahead. Returns 'Nothing' if +-- end of input has been reached. Does not consume any input. +-- +-- /Note/: Because this parser does not fail, do not use it with +-- combinators such as 'Control.Applicative.many', because such +-- parsers loop until a failure occurs. Careless use will thus result +-- in an infinite loop. +peekChar :: Parser (Maybe Char) +peekChar = T.Parser $ \t pos more _lose succ -> + case () of + _| pos < lengthOf t -> + let T.Iter !c _ = Buf.iter t (fromPos pos) + in succ t pos more (Just c) + | more == Complete -> + succ t pos more Nothing + | otherwise -> + let succ' t' pos' more' = + let T.Iter !c _ = Buf.iter t' (fromPos pos') + in succ t' pos' more' (Just c) + lose' t' pos' more' = succ t' pos' more' Nothing + in prompt t pos more lose' succ' +{-# INLINE peekChar #-} + +-- | Match any character, to perform lookahead. Does not consume any +-- input, but will fail if end of input has been reached. +peekChar' :: Parser Char +peekChar' = do + (_,s) <- ensure 1 + return $! T.unsafeHead s +{-# INLINE peekChar' #-} + +-- | Match either a single newline character @\'\\n\'@, or a carriage +-- return followed by a newline character @\"\\r\\n\"@. +endOfLine :: Parser () +endOfLine = (char '\n' >> return ()) <|> (string "\r\n" >> return ()) + +-- | Terminal failure continuation. +failK :: Failure a +failK t (Pos pos) _more stack msg = Fail (Buf.dropCodeUnits pos t) stack msg +{-# INLINE failK #-} + +-- | Terminal success continuation. +successK :: Success a a +successK t (Pos pos) _more a = Done (Buf.dropCodeUnits pos t) a +{-# INLINE successK #-} + +-- | Run a parser. +parse :: Parser a -> Text -> Result a +parse m s = runParser m (buffer s) 0 Incomplete failK successK +{-# INLINE parse #-} + +-- | Run a parser that cannot be resupplied via a 'Partial' result. +-- +-- This function does not force a parser to consume all of its input. +-- Instead, any residual input will be discarded. To force a parser +-- to consume all of its input, use something like this: +-- +-- @ +--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput') +-- @ +parseOnly :: Parser a -> Text -> Either String a +parseOnly m s = case runParser m (buffer s) 0 Complete failK successK of + Fail _ [] err -> Left err + Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err) + Done _ a -> Right a + _ -> error "parseOnly: impossible error!" +{-# INLINE parseOnly #-} + +get :: Parser Text +get = T.Parser $ \t pos more _lose succ -> + succ t pos more (Buf.dropCodeUnits (fromPos pos) t) +{-# INLINE get #-} + +endOfChunk :: Parser Bool +endOfChunk = T.Parser $ \t pos more _lose succ -> + succ t pos more (pos == lengthOf t) +{-# INLINE endOfChunk #-} + +inputSpansChunks :: Pos -> Parser Bool +inputSpansChunks i = T.Parser $ \t pos_ more _lose succ -> + let pos = pos_ + i + in if pos < lengthOf t || more == Complete + then succ t pos more False + else let lose' t' pos' more' = succ t' pos' more' False + succ' t' pos' more' = succ t' pos' more' True + in prompt t pos more lose' succ' +{-# INLINE inputSpansChunks #-} + +advance :: Pos -> Parser () +advance n = T.Parser $ \t pos more _lose succ -> succ t (pos+n) more () +{-# INLINE advance #-} + +ensureSuspended :: Int -> Buffer -> Pos -> More + -> Failure r -> Success (Pos, Text) r + -> Result r +ensureSuspended n t pos more lose succ = + runParser (demandInput >> go) t pos more lose succ + where go = T.Parser $ \t' pos' more' lose' succ' -> + case lengthAtLeast pos' n t' of + Just n' -> succ' t' pos' more' (n', substring pos n' t') + Nothing -> runParser (demandInput >> go) t' pos' more' lose' succ' + +-- | If at least @n@ elements of input are available, return the +-- current input, otherwise fail. +ensure :: Int -> Parser (Pos, Text) +ensure n = T.Parser $ \t pos more lose succ -> + case lengthAtLeast pos n t of + Just n' -> succ t pos more (n', substring pos n' t) + -- The uncommon case is kept out-of-line to reduce code size: + Nothing -> ensureSuspended n t pos more lose succ +{-# INLINE ensure #-} + +-- | Return both the result of a parse and the portion of the input +-- that was consumed while it was being parsed. +match :: Parser a -> Parser (Text, a) +match p = T.Parser $ \t pos more lose succ -> + let succ' t' pos' more' a = succ t' pos' more' + (substring pos (pos'-pos) t', a) + in runParser p t pos more lose succ' + +-- | Ensure that at least @n@ code points of input are available. +-- Returns the number of words consumed while traversing. +lengthAtLeast :: Pos -> Int -> Buffer -> Maybe Pos +lengthAtLeast pos n t = go 0 (fromPos pos) + where go i !p + | i == n = Just (Pos p - pos) + | p == len = Nothing + | otherwise = go (i+1) (p + Buf.iter_ t p) + Pos len = lengthOf t +{-# INLINE lengthAtLeast #-} + +substring :: Pos -> Pos -> Buffer -> Text +substring (Pos pos) (Pos n) = Buf.substring pos n +{-# INLINE substring #-} + +lengthOf :: Buffer -> Pos +lengthOf = Pos . Buf.length + +size :: Text -> Pos +size (Text _ _ l) = Pos l diff --git a/Data/Attoparsec/Text/Lazy.hs b/Data/Attoparsec/Text/Lazy.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/Text/Lazy.hs @@ -0,0 +1,115 @@ +{-# LANGUAGE CPP #-} +#if __GLASGOW_HASKELL__ >= 702 +{-# LANGUAGE Trustworthy #-} -- Imports internal modules +#endif + +{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-} +-- | +-- Module : Data.Attoparsec.Text.Lazy +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient combinator parsing that can consume lazy 'Text' +-- strings, loosely based on the Parsec library. +-- +-- This is essentially the same code as in the 'Data.Attoparsec.Text' +-- module, only with a 'parse' function that can consume a lazy +-- 'Text' incrementally, and a 'Result' type that does not allow +-- more input to be fed in. Think of this as suitable for use with a +-- lazily read file, e.g. via 'L.readFile' or 'L.hGetContents'. +-- +-- /Note:/ The various parser functions and combinators such as +-- 'string' still expect /strict/ 'T.Text' parameters, and return +-- strict 'T.Text' results. Behind the scenes, strict 'T.Text' values +-- are still used internally to store parser input and manipulate it +-- efficiently. + +module Data.Attoparsec.Text.Lazy + ( + Result(..) + , module Data.Attoparsec.Text + -- * Running parsers + , parse + , parseOnly + , parseTest + -- ** Result conversion + , maybeResult + , eitherResult + ) where + +import Control.DeepSeq (NFData(rnf)) +import Data.List (intercalate) +import Data.Text.Lazy.Internal (Text(..), chunk) +import qualified Data.Attoparsec.Internal.Types as T +import qualified Data.Attoparsec.Text as A +import qualified Data.Text as T +import Data.Attoparsec.Text hiding (IResult(..), Result, eitherResult, + maybeResult, parse, parseOnly, parseWith, parseTest) + +-- | The result of a parse. +data Result r = Fail Text [String] String + -- ^ The parse failed. The 'Text' is the input + -- that had not yet been consumed when the failure + -- occurred. The @[@'String'@]@ is a list of contexts + -- in which the error occurred. The 'String' is the + -- message describing the error, if any. + | Done Text r + -- ^ The parse succeeded. The 'Text' is the + -- input that had not yet been consumed (if any) when + -- the parse succeeded. + deriving (Show) + +instance NFData r => NFData (Result r) where + rnf (Fail bs ctxs msg) = rnf bs `seq` rnf ctxs `seq` rnf msg + rnf (Done bs r) = rnf bs `seq` rnf r + {-# INLINE rnf #-} + +fmapR :: (a -> b) -> Result a -> Result b +fmapR _ (Fail st stk msg) = Fail st stk msg +fmapR f (Done bs r) = Done bs (f r) + +instance Functor Result where + fmap = fmapR + +-- | Run a parser and return its result. +parse :: A.Parser a -> Text -> Result a +parse p s = case s of + Chunk x xs -> go (A.parse p x) xs + empty -> go (A.parse p T.empty) empty + where + go (T.Fail x stk msg) ys = Fail (chunk x ys) stk msg + go (T.Done x r) ys = Done (chunk x ys) r + go (T.Partial k) (Chunk y ys) = go (k y) ys + go (T.Partial k) empty = go (k T.empty) empty + +-- | Run a parser and print its result to standard output. +parseTest :: (Show a) => A.Parser a -> Text -> IO () +parseTest p s = print (parse p s) + +-- | Convert a 'Result' value to a 'Maybe' value. +maybeResult :: Result r -> Maybe r +maybeResult (Done _ r) = Just r +maybeResult _ = Nothing + +-- | Convert a 'Result' value to an 'Either' value. +eitherResult :: Result r -> Either String r +eitherResult (Done _ r) = Right r +eitherResult (Fail _ [] msg) = Left msg +eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg) + +-- | Run a parser that cannot be resupplied via a 'T.Partial' result. +-- +-- This function does not force a parser to consume all of its input. +-- Instead, any residual input will be discarded. To force a parser +-- to consume all of its input, use something like this: +-- +-- @ +--'parseOnly' (myParser 'Control.Applicative.<*' 'endOfInput') +-- @ +parseOnly :: A.Parser a -> Text -> Either String a +parseOnly p = eitherResult . parse p +{-# INLINE parseOnly #-} diff --git a/Data/Attoparsec/Types.hs b/Data/Attoparsec/Types.hs new file mode 100644 --- /dev/null +++ b/Data/Attoparsec/Types.hs @@ -0,0 +1,20 @@ +-- | +-- Module : Data.Attoparsec.Types +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Simple, efficient parser combinators for strings, loosely based on +-- the Parsec library. + +module Data.Attoparsec.Types + ( + Parser + , IResult(..) + , Chunk(chunkElemToChar) + ) where + +import Data.Attoparsec.Internal.Types (Parser(..), IResult(..), Chunk(..)) diff --git a/Data/Attoparsec/Zepto.hs b/Data/Attoparsec/Zepto.hs --- a/Data/Attoparsec/Zepto.hs +++ b/Data/Attoparsec/Zepto.hs @@ -1,10 +1,14 @@ -{-# LANGUAGE BangPatterns, MagicHash, UnboxedTuples #-} +{-# LANGUAGE CPP #-} +#if __GLASGOW_HASKELL__ >= 702 +{-# LANGUAGE Trustworthy #-} -- Data.ByteString.Unsafe +#endif +{-# LANGUAGE BangPatterns #-} -- | -- Module : Data.Attoparsec.Zepto --- Copyright : Bryan O'Sullivan 2011 +-- Copyright : Bryan O'Sullivan 2007-2015 -- License : BSD3 --- +-- -- Maintainer : bos@serpentine.com -- Stability : experimental -- Portability : unknown @@ -12,112 +16,150 @@ -- A tiny, highly specialized combinator parser for 'B.ByteString' -- strings. -- --- While the main Attoparsec module generally performs well, this +-- While the main attoparsec module generally performs well, this -- module is particularly fast for simple non-recursive loops that -- should not normally result in failed parses. -- -- /Warning/: on more complex inputs involving recursion or failure, -- parsers based on this module may be as much as /ten times slower/ --- than regular Attoparsec! You should /only/ use this module when you +-- than regular attoparsec! You should /only/ use this module when you -- have benchmarks that prove that its use speeds your code up. module Data.Attoparsec.Zepto ( Parser + , ZeptoT , parse + , parseT , atEnd , string , take , takeWhile ) where -import Data.Word (Word8) import Control.Applicative -import Control.Monad -import Data.Monoid -import qualified Data.ByteString as B -import qualified Data.ByteString.Unsafe as B +import Control.Monad (MonadPlus(..), ap) +import qualified Control.Monad.Fail as Fail +import Control.Monad.IO.Class (MonadIO(..)) import Data.ByteString (ByteString) +import Data.Functor.Identity (Identity(runIdentity)) +import Data.Monoid as Mon (Monoid(..)) +import Data.Semigroup (Semigroup(..)) +import Data.Word (Word8) import Prelude hiding (take, takeWhile) +import qualified Data.ByteString as B +import qualified Data.ByteString.Unsafe as B newtype S = S { input :: ByteString } data Result a = Fail String - | OK !a + | OK !a S -- | A simple parser. -- -- This monad is strict in its state, and the monadic bind operator -- ('>>=') evaluates each result to weak head normal form before -- passing it along. -newtype Parser a = Parser { - runParser :: S -> (# Result a, S #) +newtype ZeptoT m a = Parser { + runParser :: S -> m (Result a) } -instance Functor Parser where - fmap f m = Parser $ \s -> case runParser m s of - (# OK a, s' #) -> (# OK (f a), s' #) - (# Fail err, s' #) -> (# Fail err, s' #) +type Parser a = ZeptoT Identity a + +instance Monad m => Functor (ZeptoT m) where + fmap f m = Parser $ \s -> do + result <- runParser m s + case result of + OK a s' -> return (OK (f a) s') + Fail err -> return (Fail err) {-# INLINE fmap #-} -instance Monad Parser where - return a = Parser $ \s -> (# OK a, s #) +instance MonadIO m => MonadIO (ZeptoT m) where + liftIO act = Parser $ \s -> do + result <- liftIO act + return (OK result s) + {-# INLINE liftIO #-} + +instance Monad m => Monad (ZeptoT m) where + return = pure {-# INLINE return #-} - m >>= k = Parser $ \s -> case runParser m s of - (# OK a, s' #) -> runParser (k a) s' - (# Fail err, s' #) -> (# Fail err, s' #) + m >>= k = Parser $ \s -> do + result <- runParser m s + case result of + OK a s' -> runParser (k a) s' + Fail err -> return (Fail err) {-# INLINE (>>=) #-} - fail msg = Parser $ \s -> (# Fail msg, s #) +#if !(MIN_VERSION_base(4,13,0)) + fail = Fail.fail + {-# INLINE fail #-} +#endif -instance MonadPlus Parser where +instance Monad m => Fail.MonadFail (ZeptoT m) where + fail msg = Parser $ \_ -> return (Fail msg) + {-# INLINE fail #-} + +instance Monad m => MonadPlus (ZeptoT m) where mzero = fail "mzero" {-# INLINE mzero #-} - mplus a b = Parser $ \s -> - case runParser a s of - (# ok@(OK _), s' #) -> (# ok, s' #) - (# _, _ #) -> case runParser b s of - (# ok@(OK _), s'' #) -> (# ok, s'' #) - (# err, s'' #) -> (# err, s'' #) + mplus a b = Parser $ \s -> do + result <- runParser a s + case result of + ok@(OK _ _) -> return ok + _ -> runParser b s {-# INLINE mplus #-} -instance Applicative Parser where - pure = return +instance (Monad m) => Applicative (ZeptoT m) where + pure a = Parser $ \s -> return (OK a s) {-# INLINE pure #-} (<*>) = ap {-# INLINE (<*>) #-} -gets :: (S -> a) -> Parser a -gets f = Parser $ \s -> (# OK (f s), s #) +gets :: Monad m => (S -> a) -> ZeptoT m a +gets f = Parser $ \s -> return (OK (f s) s) {-# INLINE gets #-} -put :: S -> Parser () -put s = Parser $ \_ -> (# OK (), s #) +put :: Monad m => S -> ZeptoT m () +put s = Parser $ \_ -> return (OK () s) {-# INLINE put #-} -- | Run a parser. parse :: Parser a -> ByteString -> Either String a -parse p bs = case runParser p (S bs) of - (# OK a, _ #) -> Right a - (# Fail err, _ #) -> Left err +parse p bs = case runIdentity (runParser p (S bs)) of + (OK a _) -> Right a + (Fail err) -> Left err +{-# INLINE parse #-} -instance Monoid (Parser a) where +-- | Run a parser on top of the given base monad. +parseT :: Monad m => ZeptoT m a -> ByteString -> m (Either String a) +parseT p bs = do + result <- runParser p (S bs) + case result of + OK a _ -> return (Right a) + Fail err -> return (Left err) +{-# INLINE parseT #-} + +instance Monad m => Semigroup (ZeptoT m a) where + (<>) = mplus + {-# INLINE (<>) #-} + +instance Monad m => Mon.Monoid (ZeptoT m a) where mempty = fail "mempty" {-# INLINE mempty #-} - mappend = mplus + mappend = (<>) {-# INLINE mappend #-} -instance Alternative Parser where +instance Monad m => Alternative (ZeptoT m) where empty = fail "empty" {-# INLINE empty #-} (<|>) = mplus {-# INLINE (<|>) #-} -- | Consume input while the predicate returns 'True'. -takeWhile :: (Word8 -> Bool) -> Parser ByteString +takeWhile :: Monad m => (Word8 -> Bool) -> ZeptoT m ByteString takeWhile p = do (h,t) <- gets (B.span p . input) put (S t) @@ -125,7 +167,7 @@ {-# INLINE takeWhile #-} -- | Consume @n@ bytes of input. -take :: Int -> Parser ByteString +take :: Monad m => Int -> ZeptoT m ByteString take !n = do s <- gets input if B.length s >= n @@ -134,7 +176,7 @@ {-# INLINE take #-} -- | Match a string exactly. -string :: ByteString -> Parser () +string :: Monad m => ByteString -> ZeptoT m () string s = do i <- gets input if s `B.isPrefixOf` i @@ -143,7 +185,7 @@ {-# INLINE string #-} -- | Indicate whether the end of the input has been reached. -atEnd :: Parser Bool +atEnd :: Monad m => ZeptoT m Bool atEnd = do i <- gets input return $! B.null i diff --git a/README.markdown b/README.markdown --- a/README.markdown +++ b/README.markdown @@ -10,17 +10,11 @@ and other improvements. Please report bugs via the -[bitbucket issue tracker](http://bitbucket.org/bos/attoparsec/issues). - -Master [Mercurial repository](http://bitbucket.org/bos/attoparsec): - -* `hg clone http://bitbucket.org/bos/attoparsec` +[github issue tracker](https://github.com/bos/attoparsec/issues). -There's also a [git mirror](http://github.com/bos/attoparsec): +Master [git repository](https://github.com/bos/attoparsec): * `git clone git://github.com/bos/attoparsec.git` - -(You can create and contribute changes using either Mercurial or git.) Authors ------- diff --git a/attoparsec.cabal b/attoparsec.cabal --- a/attoparsec.cabal +++ b/attoparsec.cabal @@ -1,16 +1,16 @@ name: attoparsec -version: 0.8.6.1 +version: 0.14.4 license: BSD3 license-file: LICENSE category: Text, Parsing author: Bryan O'Sullivan -maintainer: Bryan O'Sullivan +maintainer: Bryan O'Sullivan , Ben Gamari stability: experimental -tested-with: GHC == 6.10.4, GHC == 6.12.3, GHC == 7.0.3 -synopsis: Fast combinator parsing for bytestrings -cabal-version: >= 1.6 -homepage: https://bitbucket.org/bos/attoparsec -bug-reports: https://bitbucket.org/bos/attoparsec/issues +tested-with: GHC == 7.4.2, GHC ==7.6.3, GHC ==7.8.4, GHC ==7.10.3, GHC ==8.0.2, GHC ==8.2.2, GHC==8.4.4, GHC==8.6.5, GHC==8.8.4, GHC==8.10.7, GHC ==9.0.2, GHC ==9.2.1 +synopsis: Fast combinator parsing for bytestrings and text +cabal-version: 2.0 +homepage: https://github.com/bgamari/attoparsec +bug-reports: https://github.com/bgamari/attoparsec/issues build-type: Simple description: A fast parser combinator library, aimed particularly at dealing @@ -18,61 +18,180 @@ file formats. extra-source-files: README.markdown + benchmarks/*.txt + benchmarks/json-data/*.json benchmarks/Makefile - benchmarks/Tiny.hs benchmarks/med.txt.bz2 - tests/Makefile - tests/QC.hs - tests/QCSupport.hs - tests/TestFastSet.hs + changelog.md + examples/*.c + examples/*.hs examples/Makefile - examples/Parsec_RFC2616.hs - examples/RFC2616.hs - examples/TestRFC2616.hs - examples/rfc2616.c Flag developer Description: Whether to build the library in development mode Default: False + Manual: True -flag split-base -flag applicative-in-base +-- We need to test and benchmark these modules, +-- but do not want to expose them to end users +library attoparsec-internal + hs-source-dirs: internal + build-depends: array, + base >= 4.3 && < 5, + bytestring <0.12, + text >= 1.1.1.3 + if !impl(ghc >= 8.0) + build-depends: semigroups >=0.16.1 && <0.21 + exposed-modules: Data.Attoparsec.ByteString.Buffer + Data.Attoparsec.ByteString.FastSet + Data.Attoparsec.Internal.Compat + Data.Attoparsec.Internal.Fhthagn + Data.Attoparsec.Text.Buffer + Data.Attoparsec.Text.FastSet + ghc-options: -O2 -Wall + default-language: Haskell2010 library - if flag(split-base) - -- bytestring was in base-2.0 and 2.1.1 - build-depends: base >= 2.0 && < 2.2 - else - -- in base 1.0 and >= 3.0 bytestring is a separate package - build-depends: base < 2.0 || >= 3, bytestring >= 0.9, containers >= 0.1.0.1 - - if flag(applicative-in-base) - build-depends: base >= 2.0 && < 5.0 - cpp-options: -DAPPLICATIVE_IN_BASE - else - build-depends: base < 2.0 + build-depends: array, + base >= 4.3 && < 5, + bytestring <0.12, + containers, + deepseq, + scientific >= 0.3.1 && < 0.4, + transformers >= 0.2 && (< 0.4 || >= 0.4.1.0) && < 0.7, + text >= 1.1.1.3, + ghc-prim <0.9, + attoparsec-internal + if impl(ghc < 7.4) + build-depends: + bytestring < 0.10.4.0 - build-depends: deepseq + if !impl(ghc >= 8.0) + -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+ + build-depends: fail == 4.9.*, + semigroups >=0.16.1 && <0.21 - extensions: CPP exposed-modules: Data.Attoparsec + Data.Attoparsec.ByteString + Data.Attoparsec.ByteString.Char8 + Data.Attoparsec.ByteString.Lazy Data.Attoparsec.Char8 Data.Attoparsec.Combinator - Data.Attoparsec.FastSet + Data.Attoparsec.Internal + Data.Attoparsec.Internal.Types Data.Attoparsec.Lazy Data.Attoparsec.Number + Data.Attoparsec.Text + Data.Attoparsec.Text.Lazy + Data.Attoparsec.Types Data.Attoparsec.Zepto - other-modules: Data.Attoparsec.Internal - Data.Attoparsec.Internal.Types - ghc-options: -Wall + other-modules: Data.Attoparsec.ByteString.Internal + Data.Attoparsec.Text.Internal + ghc-options: -O2 -Wall + default-language: Haskell2010 + if flag(developer) ghc-prof-options: -auto-all + ghc-options: -Werror -source-repository head - type: mercurial - location: https://bitbucket.org/bos/attoparsec +test-suite attoparsec-tests + type: exitcode-stdio-1.0 + hs-source-dirs: tests + main-is: QC.hs + other-modules: QC.Buffer + QC.ByteString + QC.Combinator + QC.Common + QC.IPv6.Internal + QC.IPv6.Types + QC.Rechunked + QC.Simple + QC.Text + QC.Text.FastSet + QC.Text.Regressions + ghc-options: + -Wall -threaded -rtsopts + + if flag(developer) + ghc-options: -Werror + + build-depends: + array, + attoparsec, + attoparsec-internal, + base, + bytestring, + deepseq >= 1.1, + QuickCheck >= 2.13.2 && < 2.15, + quickcheck-unicode, + scientific, + tasty >= 0.11, + tasty-quickcheck >= 0.8, + text, + transformers, + vector + + default-language: Haskell2010 + + if !impl(ghc >= 8.0) + -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+ + build-depends: fail == 4.9.*, + semigroups >=0.16.1 && <0.19 + +benchmark attoparsec-benchmarks + type: exitcode-stdio-1.0 + hs-source-dirs: benchmarks benchmarks/warp-3.0.1.1 + ghc-options: -O2 -Wall -rtsopts + main-is: Benchmarks.hs + other-modules: + Aeson + Common + Genome + HeadersByteString + HeadersByteString.Atto + HeadersText + Links + Network.Wai.Handler.Warp.ReadInt + Network.Wai.Handler.Warp.RequestHeader + Numbers + Sets + TextFastSet + Warp + ghc-options: -O2 -Wall + + if flag(developer) + ghc-options: -Werror + + build-depends: + array, + attoparsec, + attoparsec-internal, + base == 4.*, + bytestring >= 0.10.4.0, + case-insensitive, + containers, + deepseq >= 1.1, + directory, + filepath, + ghc-prim, + http-types, + parsec >= 3.1.2, + scientific, + tasty-bench >= 0.3, + text >= 1.1.1.0, + transformers, + unordered-containers, + vector + + default-language: Haskell2010 + + if !impl(ghc >= 8.0) + -- Data.Semigroup && Control.Monad.Fail are available in base-4.9+ + build-depends: fail == 4.9.*, + semigroups >=0.16.1 && <0.19 + source-repository head type: git - location: https://github.com/bos/attoparsec + location: https://github.com/bgamari/attoparsec diff --git a/benchmarks/Aeson.hs b/benchmarks/Aeson.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Aeson.hs @@ -0,0 +1,353 @@ +{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} +{-# OPTIONS_GHC -fno-warn-unused-binds #-} + +module Aeson + ( + aeson + , value' + ) where + +import Data.ByteString.Builder + (Builder, byteString, toLazyByteString, charUtf8, word8) + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((*>), (<$>), (<*), pure) +import Data.Monoid (mappend, mempty) +#endif + +import Common (pathTo) +import Control.Applicative (liftA2) +import Control.DeepSeq (NFData(..)) +import Control.Monad (forM) +import Data.Attoparsec.ByteString.Char8 (Parser, char, endOfInput, scientific, + skipSpace, string) +import Data.Bits ((.|.), shiftL) +import Data.ByteString (ByteString) +import Data.Char (chr) +import Data.List (sort) +import Data.Scientific (Scientific) +import Data.Text (Text) +import Data.Text.Encoding (decodeUtf8') +import Data.Vector as Vector (Vector, foldl', fromList) +import Data.Word (Word8) +import System.Directory (getDirectoryContents) +import System.FilePath ((), dropExtension) +import qualified Data.Attoparsec.ByteString as A +import qualified Data.Attoparsec.Lazy as L +import qualified Data.Attoparsec.Zepto as Z +import qualified Data.ByteString as B +import qualified Data.ByteString.Lazy as L +import qualified Data.ByteString.Unsafe as B +import qualified Data.HashMap.Strict as H +import Test.Tasty.Bench + +#define BACKSLASH 92 +#define CLOSE_CURLY 125 +#define CLOSE_SQUARE 93 +#define COMMA 44 +#define DOUBLE_QUOTE 34 +#define OPEN_CURLY 123 +#define OPEN_SQUARE 91 +#define C_0 48 +#define C_9 57 +#define C_A 65 +#define C_F 70 +#define C_a 97 +#define C_f 102 +#define C_n 110 +#define C_t 116 + +data Result a = Error String + | Success a + deriving (Eq, Show) + + +-- | A JSON \"object\" (key\/value map). +type Object = H.HashMap Text Value + +-- | A JSON \"array\" (sequence). +type Array = Vector Value + +-- | A JSON value represented as a Haskell value. +data Value = Object !Object + | Array !Array + | String !Text + | Number !Scientific + | Bool !Bool + | Null + deriving (Eq, Show) + +instance NFData Value where + rnf (Object o) = rnf o + rnf (Array a) = Vector.foldl' (\x y -> rnf y `seq` x) () a + rnf (String s) = rnf s + rnf (Number n) = rnf n + rnf (Bool b) = rnf b + rnf Null = () + +-- | Parse a top-level JSON value. This must be either an object or +-- an array, per RFC 4627. +-- +-- The conversion of a parsed value to a Haskell value is deferred +-- until the Haskell value is needed. This may improve performance if +-- only a subset of the results of conversions are needed, but at a +-- cost in thunk allocation. +json :: Parser Value +json = json_ object_ array_ + +-- | Parse a top-level JSON value. This must be either an object or +-- an array, per RFC 4627. +-- +-- This is a strict version of 'json' which avoids building up thunks +-- during parsing; it performs all conversions immediately. Prefer +-- this version if most of the JSON data needs to be accessed. +json' :: Parser Value +json' = json_ object_' array_' + +json_ :: Parser Value -> Parser Value -> Parser Value +json_ obj ary = do + w <- skipSpace *> A.satisfy (\w -> w == OPEN_CURLY || w == OPEN_SQUARE) + if w == OPEN_CURLY + then obj + else ary +{-# INLINE json_ #-} + +object_ :: Parser Value +object_ = {-# SCC "object_" #-} Object <$> objectValues jstring value + +object_' :: Parser Value +object_' = {-# SCC "object_'" #-} do + !vals <- objectValues jstring' value' + return (Object vals) + where + jstring' = do + !s <- jstring + return s + +objectValues :: Parser Text -> Parser Value -> Parser (H.HashMap Text Value) +objectValues str val = do + skipSpace + let pair = liftA2 (,) (str <* skipSpace) (char ':' *> skipSpace *> val) + H.fromList <$> commaSeparated pair CLOSE_CURLY +{-# INLINE objectValues #-} + +array_ :: Parser Value +array_ = {-# SCC "array_" #-} Array <$> arrayValues value + +array_' :: Parser Value +array_' = {-# SCC "array_'" #-} do + !vals <- arrayValues value' + return (Array vals) + +commaSeparated :: Parser a -> Word8 -> Parser [a] +commaSeparated item endByte = do + w <- A.peekWord8' + if w == endByte + then A.anyWord8 >> return [] + else loop + where + loop = do + v <- item <* skipSpace + ch <- A.satisfy $ \w -> w == COMMA || w == endByte + if ch == COMMA + then skipSpace >> (v:) <$> loop + else return [v] +{-# INLINE commaSeparated #-} + +arrayValues :: Parser Value -> Parser (Vector Value) +arrayValues val = do + skipSpace + Vector.fromList <$> commaSeparated val CLOSE_SQUARE +{-# INLINE arrayValues #-} + +-- | Parse any JSON value. You should usually 'json' in preference to +-- this function, as this function relaxes the object-or-array +-- requirement of RFC 4627. +-- +-- In particular, be careful in using this function if you think your +-- code might interoperate with Javascript. A naïve Javascript +-- library that parses JSON data using @eval@ is vulnerable to attack +-- unless the encoded data represents an object or an array. JSON +-- implementations in other languages conform to that same restriction +-- to preserve interoperability and security. +value :: Parser Value +value = do + w <- A.peekWord8' + case w of + DOUBLE_QUOTE -> A.anyWord8 *> (String <$> jstring_) + OPEN_CURLY -> A.anyWord8 *> object_ + OPEN_SQUARE -> A.anyWord8 *> array_ + C_f -> string "false" *> pure (Bool False) + C_t -> string "true" *> pure (Bool True) + C_n -> string "null" *> pure Null + _ | w >= 48 && w <= 57 || w == 45 + -> Number <$> scientific + | otherwise -> fail "not a valid json value" + +-- | Strict version of 'value'. See also 'json''. +value' :: Parser Value +value' = do + w <- A.peekWord8' + case w of + DOUBLE_QUOTE -> do + !s <- A.anyWord8 *> jstring_ + return (String s) + OPEN_CURLY -> A.anyWord8 *> object_' + OPEN_SQUARE -> A.anyWord8 *> array_' + C_f -> string "false" *> pure (Bool False) + C_t -> string "true" *> pure (Bool True) + C_n -> string "null" *> pure Null + _ | w >= 48 && w <= 57 || w == 45 + -> do + !n <- scientific + return (Number n) + | otherwise -> fail "not a valid json value" + +-- | Parse a quoted JSON string. +jstring :: Parser Text +jstring = A.word8 DOUBLE_QUOTE *> jstring_ + +-- | Parse a string without a leading quote. +jstring_ :: Parser Text +jstring_ = {-# SCC "jstring_" #-} do + s <- A.scan False $ \s c -> if s then Just False + else if c == DOUBLE_QUOTE + then Nothing + else Just (c == BACKSLASH) + _ <- A.word8 DOUBLE_QUOTE + s1 <- if BACKSLASH `B.elem` s + then case Z.parse unescape s of + Right r -> return r + Left err -> fail err + else return s + + case decodeUtf8' s1 of + Right r -> return r + Left err -> fail $ show err + +{-# INLINE jstring_ #-} + +unescape :: Z.Parser ByteString +unescape = toByteString <$> go mempty where + go acc = do + h <- Z.takeWhile (/=BACKSLASH) + let rest = do + start <- Z.take 2 + let !slash = B.unsafeHead start + !t = B.unsafeIndex start 1 + escape = case B.findIndex (==t) "\"\\/ntbrfu" of + Just i -> i + _ -> 255 + if slash /= BACKSLASH || escape == 255 + then fail "invalid JSON escape sequence" + else do + let cont m = go (acc `mappend` byteString h `mappend` m) + {-# INLINE cont #-} + if t /= 117 -- 'u' + then cont (word8 (B.unsafeIndex mapping escape)) + else do + a <- hexQuad + if a < 0xd800 || a > 0xdfff + then cont (charUtf8 (chr a)) + else do + b <- Z.string "\\u" *> hexQuad + if a <= 0xdbff && b >= 0xdc00 && b <= 0xdfff + then let !c = ((a - 0xd800) `shiftL` 10) + + (b - 0xdc00) + 0x10000 + in cont (charUtf8 (chr c)) + else fail "invalid UTF-16 surrogates" + done <- Z.atEnd + if done + then return (acc `mappend` byteString h) + else rest + mapping = "\"\\/\n\t\b\r\f" + +hexQuad :: Z.Parser Int +hexQuad = do + s <- Z.take 4 + let hex n | w >= C_0 && w <= C_9 = w - C_0 + | w >= C_a && w <= C_f = w - 87 + | w >= C_A && w <= C_F = w - 55 + | otherwise = 255 + where w = fromIntegral $ B.unsafeIndex s n + a = hex 0; b = hex 1; c = hex 2; d = hex 3 + if (a .|. b .|. c .|. d) /= 255 + then return $! d .|. (c `shiftL` 4) .|. (b `shiftL` 8) .|. (a `shiftL` 12) + else fail "invalid hex escape" + +decodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString -> Maybe a +decodeWith p to s = + case L.parse p s of + L.Done _ v -> case to v of + Success a -> Just a + _ -> Nothing + _ -> Nothing +{-# INLINE decodeWith #-} + +decodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString + -> Maybe a +decodeStrictWith p to s = + case either Error to (A.parseOnly p s) of + Success a -> Just a + Error _ -> Nothing +{-# INLINE decodeStrictWith #-} + +eitherDecodeWith :: Parser Value -> (Value -> Result a) -> L.ByteString + -> Either String a +eitherDecodeWith p to s = + case L.parse p s of + L.Done _ v -> case to v of + Success a -> Right a + Error msg -> Left msg + L.Fail _ _ msg -> Left msg +{-# INLINE eitherDecodeWith #-} + +eitherDecodeStrictWith :: Parser Value -> (Value -> Result a) -> B.ByteString + -> Either String a +eitherDecodeStrictWith p to s = + case either Error to (A.parseOnly p s) of + Success a -> Right a + Error msg -> Left msg +{-# INLINE eitherDecodeStrictWith #-} + +-- $lazy +-- +-- The 'json' and 'value' parsers decouple identification from +-- conversion. Identification occurs immediately (so that an invalid +-- JSON document can be rejected as early as possible), but conversion +-- to a Haskell value is deferred until that value is needed. +-- +-- This decoupling can be time-efficient if only a smallish subset of +-- elements in a JSON value need to be inspected, since the cost of +-- conversion is zero for uninspected elements. The trade off is an +-- increase in memory usage, due to allocation of thunks for values +-- that have not yet been converted. + +-- $strict +-- +-- The 'json'' and 'value'' parsers combine identification with +-- conversion. They consume more CPU cycles up front, but have a +-- smaller memory footprint. + +-- | Parse a top-level JSON value followed by optional whitespace and +-- end-of-input. See also: 'json'. +jsonEOF :: Parser Value +jsonEOF = json <* skipSpace <* endOfInput + +-- | Parse a top-level JSON value followed by optional whitespace and +-- end-of-input. See also: 'json''. +jsonEOF' :: Parser Value +jsonEOF' = json' <* skipSpace <* endOfInput + +toByteString :: Builder -> ByteString +toByteString = L.toStrict . toLazyByteString +{-# INLINE toByteString #-} + +aeson :: IO Benchmark +aeson = do + path <- pathTo "json-data" + names <- sort . filter (`notElem` [".", ".."]) <$> getDirectoryContents path + benches <- forM names $ \name -> do + bs <- B.readFile (path name) + return . bench (dropExtension name) $ nf (A.parseOnly jsonEOF') bs + return $ bgroup "aeson" benches diff --git a/benchmarks/Benchmarks.hs b/benchmarks/Benchmarks.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Benchmarks.hs @@ -0,0 +1,126 @@ +{-# LANGUAGE BangPatterns, CPP #-} + +import Common () +import Control.Applicative (many) +import Test.Tasty.Bench (bench, bgroup, defaultMain, nf) +import Data.Bits +import Data.Char (isAlpha) +import Data.Word (Word32) +import Data.Word (Word8) +import Numbers (numbers) +import Common (chunksOf) +import Text.Parsec.Text () +import Text.Parsec.Text.Lazy () +import qualified Warp +import qualified Aeson +import qualified Genome +import qualified Data.Attoparsec.ByteString as AB +import qualified Data.Attoparsec.ByteString.Char8 as AC +import qualified Data.Attoparsec.ByteString.Lazy as ABL +import qualified Data.Attoparsec.Text as AT +import qualified Data.Attoparsec.Text.Lazy as ATL +import qualified Data.ByteString as B +import qualified Data.ByteString.Char8 as BC +import qualified Data.ByteString.Lazy as BL +import qualified Data.Text as T +import qualified Data.Text.Lazy as TL +import qualified HeadersByteString +import qualified HeadersText +import qualified Links +import qualified Text.Parsec as P +import qualified Sets + +main :: IO () +main = do + let s = take 1024 . cycle $ ['a'..'z'] ++ ['A'..'Z'] + !b = BC.pack s + !bl = BL.fromChunks . map BC.pack . chunksOf 4 $ s + !t = T.pack s + !tl = TL.fromChunks . map T.pack . chunksOf 4 $ s + aeson <- Aeson.aeson + headersBS <- HeadersByteString.headers + headersT <- HeadersText.headers + defaultMain [ + bgroup "many" [ + bgroup "attoparsec" [ + bench "B" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b + , bench "BL" $ nf (ABL.parse (many (AC.satisfy AC.isAlpha_ascii))) bl + , bench "T" $ nf (AT.parse (many (AT.satisfy AC.isAlpha_ascii))) t + , bench "TL" $ nf (ATL.parse (many (AT.satisfy AC.isAlpha_ascii))) tl + ] + , bgroup "parsec" [ + bench "S" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") s + , bench "B" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") b + , bench "BL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") bl + , bench "T" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") t + , bench "TL" $ nf (P.parse (many (P.satisfy AC.isAlpha_ascii)) "") tl + ] + ] + , bgroup "comparison" [ + bgroup "many-vs-takeWhile" [ + bench "many" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b + , bench "takeWhile" $ nf (AB.parse (AC.takeWhile AC.isAlpha_ascii)) b + ] + , bgroup "letter-vs-isAlpha" [ + bench "letter" $ nf (AB.parse (many AC.letter_ascii)) b + , bench "isAlpha" $ nf (AB.parse (many (AC.satisfy AC.isAlpha_ascii))) b + ] + ] + , bgroup "takeWhile" [ + bench "isAlpha" $ nf (ABL.parse (AC.takeWhile isAlpha)) bl + , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile AC.isAlpha_ascii)) bl + , bench "isAlpha_iso8859_15" $ + nf (ABL.parse (AC.takeWhile AC.isAlpha_iso8859_15)) bl + , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile isAlpha)) t + , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile isAlpha)) tl + ] + , bgroup "takeWhile1" [ + bench "isAlpha" $ nf (ABL.parse (AC.takeWhile1 isAlpha)) bl + , bench "isAlpha_ascii" $ nf (ABL.parse (AC.takeWhile1 AC.isAlpha_ascii)) bl + , bench "T isAlpha" $ nf (AT.parse (AT.takeWhile1 isAlpha)) t + , bench "TL isAlpha" $ nf (ATL.parse (AT.takeWhile1 isAlpha)) tl + ] + , bench "word32LE" $ nf (AB.parse word32LE) b + , bgroup "scan" [ + bench "short" $ nf (AB.parse quotedString) (BC.pack "abcdefghijk\"") + , bench "long" $ nf (AB.parse quotedString) b + ] + , aeson + , Genome.genome + , headersBS + , headersT + , Links.links + , numbers + , Sets.benchmarks + , Warp.benchmarks + ] + +-- Benchmarks bind and (potential) bounds-check merging. +word32LE :: AB.Parser Word32 +word32LE = do + w1 <- AB.anyWord8 + w2 <- AB.anyWord8 + w3 <- AB.anyWord8 + w4 <- AB.anyWord8 + return $! (fromIntegral w1 :: Word32) + + fromIntegral w2 `unsafeShiftL` 8 + + fromIntegral w3 `unsafeShiftL` 16 + + fromIntegral w4 `unsafeShiftL` 32 + +doubleQuote, backslash :: Word8 +doubleQuote = 34 +backslash = 92 +{-# INLINE backslash #-} +{-# INLINE doubleQuote #-} + +-- | Parse a string without a leading quote. +quotedString :: AB.Parser B.ByteString +quotedString = AB.scan False $ \s c -> if s then Just False + else if c == doubleQuote + then Nothing + else Just (c == backslash) + +#if !MIN_VERSION_base(4,5,0) +unsafeShiftL :: Bits a => a -> Int -> a +unsafeShiftL = shiftL +#endif diff --git a/benchmarks/Common.hs b/benchmarks/Common.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Common.hs @@ -0,0 +1,47 @@ +{-# LANGUAGE CPP #-} +{-# OPTIONS_GHC -fno-warn-orphans #-} + +module Common ( + chunksOf + , pathTo + , rechunkBS + , rechunkT + ) where + +import Control.DeepSeq (NFData(rnf)) +import System.Directory (doesDirectoryExist) +import System.FilePath (()) +import Text.Parsec (ParseError) +import qualified Data.ByteString as B +import qualified Data.ByteString.Lazy as BL +import qualified Data.Text as T +import qualified Data.Text.Lazy as TL + +#if !MIN_VERSION_bytestring(0,10,0) +import Data.ByteString.Internal (ByteString(..)) + +instance NFData ByteString where + rnf (PS _ _ _) = () +#endif + +instance NFData ParseError where + rnf = rnf . show + +chunksOf :: Int -> [a] -> [[a]] +chunksOf k = go + where go xs = case splitAt k xs of + ([],_) -> [] + (y, ys) -> y : go ys + +rechunkBS :: Int -> B.ByteString -> BL.ByteString +rechunkBS n = BL.fromChunks . map B.pack . chunksOf n . B.unpack + +rechunkT :: Int -> T.Text -> TL.Text +rechunkT n = TL.fromChunks . map T.pack . chunksOf n . T.unpack + +pathTo :: String -> IO FilePath +pathTo wat = do + exists <- doesDirectoryExist "benchmarks" + return $ if exists + then "benchmarks" wat + else wat diff --git a/benchmarks/Genome.hs b/benchmarks/Genome.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Genome.hs @@ -0,0 +1,75 @@ +{-# LANGUAGE OverloadedStrings #-} + +module Genome + ( + genome + ) where + +import Control.Applicative +import Test.Tasty.Bench +import Data.ByteString (ByteString) +import qualified Data.ByteString.Char8 as B8 +import qualified Data.ByteString.Lazy.Char8 as L8 +import Data.Attoparsec.ByteString.Char8 as B +import qualified Data.Attoparsec.ByteString.Lazy as BL +import Data.Text (Text) +import qualified Data.Text as T +import qualified Data.Text.Lazy as TL +import Data.Attoparsec.Text as T +import qualified Data.Attoparsec.Text.Lazy as TL +import Common (rechunkBS, rechunkT) + +genome :: Benchmark +genome = bgroup "genome" [ + bgroup "bytestring" [ + bench "s" $ nf (map (B.parse searchBS)) (B8.tails geneB) + , bench "l" $ nf (map (BL.parse searchBS)) (L8.tails geneBL) + , bgroup "CI" [ + bench "s" $ nf (map (B.parse searchBSCI)) (B8.tails geneB) + , bench "l" $ nf (map (BL.parse searchBSCI)) (L8.tails geneBL) + ] + ] + , bgroup "text" [ + bench "s" $ nf (map (T.parse searchT)) (T.tails geneT) + , bench "l" $ nf (map (TL.parse searchT)) (TL.tails geneTL) + , bgroup "CI" [ + bench "s" $ nf (map (T.parse searchTCI)) (T.tails geneT) + , bench "l" $ nf (map (TL.parse searchTCI)) (TL.tails geneTL) + ] + ] + ] + where geneB = B8.pack gene + geneBL = rechunkBS 4 geneB + geneT = T.pack gene + geneTL = rechunkT 4 geneT + +searchBS :: B.Parser ByteString +searchBS = "caac" *> ("aaca" <|> "aact") + +searchBSCI :: B.Parser ByteString +searchBSCI = B.stringCI "CAAC" *> (B.stringCI "AACA" <|> B.stringCI "AACT") + +searchT :: T.Parser Text +searchT = "caac" *> ("aaca" <|> "aact") + +searchTCI :: T.Parser Text +searchTCI = T.asciiCI "CAAC" *> (T.asciiCI "AACA" <|> T.asciiCI "AACT") + +-- Dictyostelium discoideum developmental protein DG1094 (gacT) gene, +-- partial cds. http://www.ncbi.nlm.nih.gov/nuccore/AF081586.1 + +gene :: String +gene = "atcgatttagaaagatacaaagatagaaccatcaataataaacaagagaagagagcaagt\ + \agagatattaataaagagattgaaagagagattgaaaagaagagattatcaccaagagaa\ + \agattaaatttatttggtctttcttcctcatcttcatcagtgaattcaacattaacaaga\ + \tctacagcaaatattatctctacaatagacggtagtggaggtagtaatcgtaatagtaaa\ + \aattatggtaatggctcatcctcctcctcaaatagaagatatagtaatactattaatcaa\ + \caattacaaatgcaattacaacaacttcaaatccaacaacaacaatatcaacaaactcaa\ + \caatctcaaataccattacaatatcaacaacaacaacagcaacaacaacaacaaaccact\ + \acaactacaactacatcaagtggtagtaatagattctcttcaaatagatataaaccagtt\ + \gatcttacacaatcatcttcaaactttcgttattcacgtgaaatttatgatgatgattat\ + \tattcaaataataatttaatgatgtttggtaatgagcaaccaaatcaaacaccaatttct\ + \gtatcatcttcatctgcattcacacgtcaaagatctcaaagttgctttgaaccagagaat\ + \cttgtattgctacaacaacaatatcaacaatatcaacaacaacaacaacaacaacaacaa\ + \attccattccaagcaaatccacaatatagtaatgctgttattgaacaaaaattggatcaa\ + \attagagataccattaataatttacatagagataaccgagtctctaga" diff --git a/benchmarks/HeadersByteString.hs b/benchmarks/HeadersByteString.hs new file mode 100644 --- /dev/null +++ b/benchmarks/HeadersByteString.hs @@ -0,0 +1,36 @@ +module HeadersByteString (headers) where + +import Common (pathTo, rechunkBS) +import Test.Tasty.Bench (Benchmark, bench, bgroup, nf, nfIO) +import HeadersByteString.Atto (request, response) +import Network.Wai.Handler.Warp.RequestHeader (parseHeaderLines) +import qualified Data.Attoparsec.ByteString.Char8 as B +import qualified Data.Attoparsec.ByteString.Lazy as BL +import qualified Data.ByteString.Char8 as B + +-- Note: In the benchmarks for parsing an http request +-- from a strict bytestring, we consider warp's implementation, +-- which has highly optimized code for handling the first +-- line in particular. It's treatment of the headers +-- is more relaxed from the treatment they are given by the +-- attoparsec parser benchmarked here. Consequently, it +-- is should not be possible to match its performance since +-- it accepts header names with disallowed characters. + +headers :: IO Benchmark +headers = do + req <- B.readFile =<< pathTo "http-request.txt" + resp <- B.readFile =<< pathTo "http-response.txt" + let reql = rechunkBS 4 req + respl = rechunkBS 4 resp + return $ bgroup "headers" [ + bgroup "B" [ + bench "request" $ nf (B.parseOnly request) req + , bench "warp" $ nfIO (parseHeaderLines (B.split '\n' req)) + , bench "response" $ nf (B.parseOnly response) resp + ] + , bgroup "BL" [ + bench "request" $ nf (BL.parse request) reql + , bench "response" $ nf (BL.parse response) respl + ] + ] diff --git a/benchmarks/HeadersByteString/Atto.hs b/benchmarks/HeadersByteString/Atto.hs new file mode 100644 --- /dev/null +++ b/benchmarks/HeadersByteString/Atto.hs @@ -0,0 +1,57 @@ +{-# LANGUAGE BangPatterns, OverloadedStrings #-} +{-# OPTIONS_GHC -fno-warn-missing-signatures -fno-warn-orphans #-} +module HeadersByteString.Atto + ( + request + , response + ) where + +import Control.Applicative +import Control.DeepSeq (NFData(..)) +import Network.HTTP.Types.Version (HttpVersion, http11) +import qualified Data.Attoparsec.ByteString.Char8 as B +import qualified Data.ByteString.Char8 as B + +instance NFData HttpVersion where + rnf !_ = () + +isHeaderChar :: Char -> Bool +isHeaderChar c = + (c >= 'a' && c <= 'z') || + (c >= 'A' && c <= 'Z') || + (c >= '0' && c <= '9') || + (c == '_') || + (c == '-') + +header = do + name <- B.takeWhile1 isHeaderChar <* B.char ':' <* B.skipSpace + body <- bodyLine + return (name, body) + +bodyLine = B.takeTill (\c -> c == '\r' || c == '\n') <* B.endOfLine + +requestLine = do + m <- (B.takeTill B.isSpace <* B.char ' ') + (p,q) <- B.break (=='?') <$> (B.takeTill B.isSpace <* B.char ' ') + v <- httpVersion + return (m,p,q,v) + +httpVersion = http11 <$ "HTTP/1.1" + +responseLine = (,,) <$> + (httpVersion <* B.skipSpace) <*> + (int <* B.skipSpace) <*> + bodyLine + +int :: B.Parser Int +int = B.decimal + +request = (,) <$> (requestLine <* B.endOfLine) <*> manyheader + +response = (,) <$> responseLine <*> many header + +manyheader = do + c <- B.peekChar' + if c == '\r' || c == '\n' + then return [] + else (:) <$> header <*> manyheader diff --git a/benchmarks/HeadersText.hs b/benchmarks/HeadersText.hs new file mode 100644 --- /dev/null +++ b/benchmarks/HeadersText.hs @@ -0,0 +1,56 @@ +{-# LANGUAGE OverloadedStrings #-} +{-# OPTIONS_GHC -fno-warn-missing-signatures #-} +module HeadersText (headers) where + +import Common (pathTo, rechunkT) +import Control.Applicative +import Test.Tasty.Bench (Benchmark, bench, bgroup, nf) +import Data.Char (isSpace) +import qualified Data.Attoparsec.Text as T +import qualified Data.Attoparsec.Text.Lazy as TL +import qualified Data.Text.IO as T + +header = do + name <- T.takeWhile1 (T.inClass "a-zA-Z0-9_-") <* T.char ':' <* T.skipSpace + body <- (:) <$> bodyLine <*> many (T.takeWhile1 isSpace *> bodyLine) + return (name, body) + +bodyLine = T.takeTill (\c -> c == '\r' || c == '\n') <* T.endOfLine + +requestLine = + (,,) <$> + (method <* T.skipSpace) <*> + (T.takeTill isSpace <* T.skipSpace) <*> + httpVersion + where method = "GET" <|> "POST" + +httpVersion = "HTTP/" *> ((,) <$> (int <* T.char '.') <*> int) + +responseLine = (,,) <$> + (httpVersion <* T.skipSpace) <*> + (int <* T.skipSpace) <*> + bodyLine + +int :: T.Parser Int +int = T.decimal + +request = (,) <$> (requestLine <* T.endOfLine) <*> many header + +response = (,) <$> responseLine <*> many header + +headers :: IO Benchmark +headers = do + req <- T.readFile =<< pathTo "http-request.txt" + resp <- T.readFile =<< pathTo "http-response.txt" + let reql = rechunkT 4 req + respl = rechunkT 4 resp + return $ bgroup "headers" [ + bgroup "T" [ + bench "request" $ nf (T.parseOnly request) req + , bench "response" $ nf (T.parseOnly response) resp + ] + , bgroup "TL" [ + bench "request" $ nf (TL.parse request) reql + , bench "response" $ nf (TL.parse response) respl + ] + ] diff --git a/benchmarks/Links.hs b/benchmarks/Links.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Links.hs @@ -0,0 +1,63 @@ +{-# LANGUAGE OverloadedStrings #-} + +module Links (links) where + +import Control.Applicative +import Control.DeepSeq (NFData(..)) +import Test.Tasty.Bench (Benchmark, bench, nf) +import Data.Attoparsec.ByteString as A +import Data.Attoparsec.ByteString.Char8 as A8 +import Data.ByteString.Char8 as B8 + +data Link = Link { + linkURL :: ByteString + , linkParams :: [(ByteString, ByteString)] + } deriving (Eq, Show) + +instance NFData Link where + rnf l = rnf (linkURL l) `seq` rnf (linkParams l) + +link :: Parser Link +link = Link <$> url <*> many (char8 ';' *> skipSpace *> param) + where url = char8 '<' *> A8.takeTill (=='>') <* char8 '>' <* skipSpace + +param :: Parser (ByteString, ByteString) +param = do + name <- paramName + skipSpace *> "=" *> skipSpace + c <- peekChar' + let isTokenChar = A.inClass "!#$%&'()*+./0-9:<=>?@a-zA-Z[]^_`{|}~-" + val <- case c of + '"' -> quotedString + _ -> A.takeWhile isTokenChar + skipSpace + return (name, val) + +data Quot = Literal | Backslash + +quotedString :: Parser ByteString +quotedString = char '"' *> (fixup <$> body) <* char '"' + where body = A8.scan Literal $ \s c -> + case (s,c) of + (Literal, '\\') -> backslash + (Literal, '"') -> Nothing + _ -> literal + literal = Just Literal + backslash = Just Backslash + fixup = B8.pack . go . B8.unpack + where go ('\\' : x@'\\' : xs) = x : go xs + go ('\\' : x@'"' : xs) = x : go xs + go (x : xs) = x : go xs + go xs = xs + +paramName :: Parser ByteString +paramName = do + name <- A.takeWhile1 $ A.inClass "a-zA-Z0-9!#$&+-.^_`|~" + c <- peekChar + return $ case c of + Just '*' -> B8.snoc name '*' + _ -> name + +links :: Benchmark +links = bench "links" $ nf (A.parseOnly link) lnk + where lnk = "; rel=\"next\", ; rel=\"last\"" diff --git a/benchmarks/Numbers.hs b/benchmarks/Numbers.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Numbers.hs @@ -0,0 +1,81 @@ +{-# LANGUAGE BangPatterns #-} +{-# OPTIONS_GHC -fno-warn-deprecations #-} + +module Numbers (numbers) where + +import Test.Tasty.Bench (Benchmark, bench, bgroup, nf) +import Data.Scientific (Scientific(..)) +import Text.Parsec.Text () +import Text.Parsec.Text.Lazy () +import qualified Data.Attoparsec.ByteString.Char8 as AC +import qualified Data.Attoparsec.Text as AT +import qualified Data.ByteString.Char8 as BC +import qualified Data.Text as T + +strN, strNePos, strNeNeg :: String +strN = "1234.56789" +strNePos = "1234.56789e3" +strNeNeg = "1234.56789e-3" + +numbers :: Benchmark +numbers = bgroup "numbers" [ + let !tN = T.pack strN + !tNePos = T.pack strNePos + !tNeNeg = T.pack strNeNeg + in bgroup "Text" + [ + bgroup "no power" + [ bench "double" $ nf (AT.parseOnly AT.double) tN + , bench "number" $ nf (AT.parseOnly AT.number) tN + , bench "rational" $ + nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tN + , bench "scientific" $ + nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tN + ] + , bgroup "positive power" + [ bench "double" $ nf (AT.parseOnly AT.double) tNePos + , bench "number" $ nf (AT.parseOnly AT.number) tNePos + , bench "rational" $ + nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNePos + , bench "scientific" $ + nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNePos + ] + , bgroup "negative power" + [ bench "double" $ nf (AT.parseOnly AT.double) tNeNeg + , bench "number" $ nf (AT.parseOnly AT.number) tNeNeg + , bench "rational" $ + nf (AT.parseOnly (AT.rational :: AT.Parser Rational)) tNeNeg + , bench "scientific" $ + nf (AT.parseOnly (AT.rational :: AT.Parser Scientific)) tNeNeg + ] + ] + , let !bN = BC.pack strN + !bNePos = BC.pack strNePos + !bNeNeg = BC.pack strNeNeg + in bgroup "ByteString" + [ bgroup "no power" + [ bench "double" $ nf (AC.parseOnly AC.double) bN + , bench "number" $ nf (AC.parseOnly AC.number) bN + , bench "rational" $ + nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bN + , bench "scientific" $ + nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bN + ] + , bgroup "positive power" + [ bench "double" $ nf (AC.parseOnly AC.double) bNePos + , bench "number" $ nf (AC.parseOnly AC.number) bNePos + , bench "rational" $ + nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNePos + , bench "scientific" $ + nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNePos + ] + , bgroup "negative power" + [ bench "double" $ nf (AC.parseOnly AC.double) bNeNeg + , bench "number" $ nf (AC.parseOnly AC.number) bNeNeg + , bench "rational" $ + nf (AC.parseOnly (AC.rational :: AC.Parser Rational)) bNeNeg + , bench "scientific" $ + nf (AC.parseOnly (AC.rational :: AC.Parser Scientific)) bNeNeg + ] + ] + ] diff --git a/benchmarks/Sets.hs b/benchmarks/Sets.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Sets.hs @@ -0,0 +1,21 @@ +module Sets (benchmarks) where + +import Test.Tasty.Bench +import Data.Char (ord) +import qualified Data.Attoparsec.Text.FastSet as FastSet +import qualified TextFastSet +import qualified Data.HashSet as HashSet +import qualified Data.IntSet as IntSet + +smallSet :: String +smallSet = ['a'..'z'] ++ ['A'..'Z'] ++ ['0'..'9'] + +benchmarks :: Benchmark +benchmarks = bgroup "sets" [ + bench "Fast" $ whnf (FastSet.member '*') (FastSet.fromList smallSet) + , bench "Hash" $ whnf (HashSet.member '*') (HashSet.fromList smallSet) + , bench "Int" $ whnf (IntSet.member (ord '*')) + (IntSet.fromList (map ord smallSet)) + , bench "TextFast" $ whnf (TextFastSet.member '*') + (TextFastSet.fromList smallSet) + ] diff --git a/benchmarks/TextFastSet.hs b/benchmarks/TextFastSet.hs new file mode 100644 --- /dev/null +++ b/benchmarks/TextFastSet.hs @@ -0,0 +1,121 @@ +{-# LANGUAGE BangPatterns #-} + +------------------------------------------------------------------------------ +-- | +-- Module : Data.Attoparsec.FastSet +-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : felipe.lessa@gmail.com +-- Stability : experimental +-- Portability : unknown +-- +-- Fast set membership tests for 'Char' values. We test for +-- membership using a hashtable implemented with Robin Hood +-- collision resolution. The set representation is unboxed, +-- and the characters and hashes interleaved, for efficiency. +-- +-- +----------------------------------------------------------------------------- +module TextFastSet + ( + -- * Data type + FastSet + -- * Construction + , fromList + , set + -- * Lookup + , member + -- * Handy interface + , charClass + ) where + +import Data.Bits ((.|.), (.&.), shiftR) +import Data.Function (on) +import Data.List (sort, sortBy) +import qualified Data.Array.Base as AB +import qualified Data.Array.Unboxed as A +import qualified Data.Text as T + +data FastSet = FastSet { + table :: {-# UNPACK #-} !(A.UArray Int Int) + , mask :: {-# UNPACK #-} !Int + } + +data Entry = Entry { + key :: {-# UNPACK #-} !Char + , initialIndex :: {-# UNPACK #-} !Int + , index :: {-# UNPACK #-} !Int + } + +offset :: Entry -> Int +offset e = index e - initialIndex e + +resolveCollisions :: [Entry] -> [Entry] +resolveCollisions [] = [] +resolveCollisions [e] = [e] +resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries) + where (a', b') + | index a < index b = (a, b) + | offset a < offset b = (b { index=index a }, a { index=index a + 1 }) + | otherwise = (a, b { index=index a + 1 }) + +pad :: Int -> [Entry] -> [Entry] +pad = go 0 + where -- ensure that we pad enough so that lookups beyond the + -- last hash in the table fall within the array + go !_ !m [] = replicate (max 1 m + 1) empty + go k m (e:entries) = map (const empty) [k..i - 1] ++ e : + go (i + 1) (m + i - k - 1) entries + where i = index e + empty = Entry '\0' maxBound 0 + +nextPowerOf2 :: Int -> Int +nextPowerOf2 0 = 1 +nextPowerOf2 x = go (x - 1) 1 + where go y 32 = y + 1 + go y k = go (y .|. (y `shiftR` k)) $ k * 2 + +fastHash :: Char -> Int +fastHash = fromEnum + +fromList :: String -> FastSet +fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved) + mask' + where s' = ordNub (sort s) + l = length s' + mask' = nextPowerOf2 ((5 * l) `div` 4) - 1 + entries = pad mask' . + resolveCollisions . + sortBy (compare `on` initialIndex) . + zipWith (\c i -> Entry c i i) s' . + map ((.&. mask') . fastHash) $ s' + interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e]) + entries + +ordNub :: Eq a => [a] -> [a] +ordNub [] = [] +ordNub (y:ys) = go y ys + where go x (z:zs) + | x == z = go x zs + | otherwise = x : go z zs + go x [] = [x] + +set :: T.Text -> FastSet +set = fromList . T.unpack + +-- | Check the set for membership. +member :: Char -> FastSet -> Bool +member c a = go (2 * i) + where i = fastHash c .&. mask a + lookupAt j b = (i' <= i) && (c == c' || b) + where c' = toEnum $ AB.unsafeAt (table a) j + i' = AB.unsafeAt (table a) $ j + 1 + go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) . + lookupAt (j + 6) . go $ j + 8 + +charClass :: String -> FastSet +charClass = fromList . go + where go (a:'-':b:xs) = [a..b] ++ go xs + go (x:xs) = x : go xs + go _ = "" diff --git a/benchmarks/Tiny.hs b/benchmarks/Tiny.hs deleted file mode 100644 --- a/benchmarks/Tiny.hs +++ /dev/null @@ -1,31 +0,0 @@ -import Control.Applicative ((<|>)) -import Control.Monad (forM_) -import System.Environment (getArgs) -import qualified Data.Attoparsec.Char8 as A -import qualified Data.ByteString.Char8 as B -import qualified Text.Parsec as P -import qualified Text.Parsec.ByteString as P - -attoparsec = do - args <- getArgs - forM_ args $ \arg -> do - input <- B.readFile arg - case A.parse p input `A.feed` B.empty of - A.Done _ xs -> print (length xs) - what -> print what - where - slow = A.many (A.many1 A.letter_ascii <|> A.many1 A.digit) - fast = A.many (A.takeWhile1 isLetter <|> A.takeWhile1 isDigit) - isDigit c = c >= '0' && c <= '9' - isLetter c = (c >= 'a' && c <= 'z') || (c >= 'A' && c <= 'Z') - p = fast - -parsec = do - args <- getArgs - forM_ args $ \arg -> do - input <- readFile arg - case P.parse (P.many (P.many1 P.letter P.<|> P.many1 P.digit)) "" input of - Left err -> print err - Right xs -> print (length xs) - -main = attoparsec diff --git a/benchmarks/Warp.hs b/benchmarks/Warp.hs new file mode 100644 --- /dev/null +++ b/benchmarks/Warp.hs @@ -0,0 +1,16 @@ +{-# LANGUAGE OverloadedStrings #-} + +module Warp (benchmarks) where + +import Test.Tasty.Bench (Benchmark, bench, bgroup, nf) +import Data.ByteString (ByteString) +import Network.Wai.Handler.Warp.ReadInt (readInt) +import qualified Data.Attoparsec.ByteString.Char8 as B + +benchmarks :: Benchmark +benchmarks = bgroup "warp" [ + bgroup "decimal" [ + bench "warp" $ nf (readInt :: ByteString -> Int) "31337" + , bench "atto" $ nf (B.parse (B.decimal :: B.Parser Int)) "31337" + ] + ] diff --git a/benchmarks/http-request.txt b/benchmarks/http-request.txt new file mode 100644 --- /dev/null +++ b/benchmarks/http-request.txt @@ -0,0 +1,9 @@ +GET / HTTP/1.1 +Host: twitter.com +Accept: text/html, application/xhtml+xml, application/xml; q=0.9, image/webp, */*; q=0.8 +Accept-Encoding: gzip,deflate,sdch +Accept-Language: en-GB,en-US;q=0.8,en;q=0.6 +Cache-Control: max-age=0 +Cookie: guest_id=v1%3A139; _twitter_sess=BAh7CSIKZmxhc2hJQz-e1e1; __utma=43838368.452555194.1399611824.1; __utmb=43838368; __utmc=43838368; __utmz=1399611824.1.1.utmcsr=(direct)|utmcmd=(none) +User-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10_8_5) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/35.0.1916.86 Safari/537.36 + diff --git a/benchmarks/http-response.txt b/benchmarks/http-response.txt new file mode 100644 --- /dev/null +++ b/benchmarks/http-response.txt @@ -0,0 +1,14 @@ +HTTP/1.1 200 OK +Date: Fri, 09 May 2014 04:24:57 GMT +Expires: -1 +Cache-Control: private, max-age=0 +Content-Type: text/html; charset=ISO-8859-1 +Set-Cookie: PREF=ID=1a871afc4240db5e:FF:LM=1399609497:S=e5MZ0itEekjVwNcU; expires=Sun, 08-May-2016 04:24:57 GMT; path=/; domain=.google.com +Set-Cookie: NID=67=-WlfaDG6VSEPk7abAjrK98HBSoCD2ID6JKkUR95tEumzDmg7Fc8pSQ8; expires=Sat, 08-Nov-2014 04:24:57 GMT; path=/; domain=.google.com; HttpOnly +P3P: CP="This is not a P3P policy! See http://www.google.com/support/accounts/bin/answer.py?hl=en&answer=151657 for more info." +Server: gws +X-XSS-Protection: 1; mode=block +X-Frame-Options: SAMEORIGIN +Alternate-Protocol: 80:quic +Transfer-Encoding: chunked + diff --git a/benchmarks/json-data/example.json b/benchmarks/json-data/example.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/example.json @@ -0,0 +1,88 @@ +{"web-app": { + "servlet": [ + { + "servlet-name": "cofaxCDS", + "servlet-class": "org.cofax.cds.CDSServlet", + "init-param": { + "configGlossary:installationAt": "Philadelphia, PA", + "configGlossary:adminEmail": "ksm@pobox.com", + "configGlossary:poweredBy": "Cofax", + "configGlossary:poweredByIcon": "/images/cofax.gif", + "configGlossary:staticPath": "/content/static", + "templateProcessorClass": "org.cofax.WysiwygTemplate", + "templateLoaderClass": "org.cofax.FilesTemplateLoader", + "templatePath": "templates", + "templateOverridePath": "", + "defaultListTemplate": "listTemplate.htm", + "defaultFileTemplate": "articleTemplate.htm", + "useJSP": false, + "jspListTemplate": "listTemplate.jsp", + "jspFileTemplate": "articleTemplate.jsp", + "cachePackageTagsTrack": 200, + "cachePackageTagsStore": 200, + "cachePackageTagsRefresh": 60, + "cacheTemplatesTrack": 100, + "cacheTemplatesStore": 50, + "cacheTemplatesRefresh": 15, + "cachePagesTrack": 200, + "cachePagesStore": 100, + "cachePagesRefresh": 10, + "cachePagesDirtyRead": 10, + "searchEngineListTemplate": "forSearchEnginesList.htm", + "searchEngineFileTemplate": "forSearchEngines.htm", + "searchEngineRobotsDb": "WEB-INF/robots.db", + "useDataStore": true, + "dataStoreClass": "org.cofax.SqlDataStore", + "redirectionClass": "org.cofax.SqlRedirection", + "dataStoreName": "cofax", + "dataStoreDriver": "com.microsoft.jdbc.sqlserver.SQLServerDriver", + "dataStoreUrl": "jdbc:microsoft:sqlserver://LOCALHOST:1433;DatabaseName=goon", + "dataStoreUser": "sa", + "dataStorePassword": "dataStoreTestQuery", + "dataStoreTestQuery": "SET NOCOUNT ON;select test='test';", + "dataStoreLogFile": "/usr/local/tomcat/logs/datastore.log", + "dataStoreInitConns": 10, + "dataStoreMaxConns": 100, + "dataStoreConnUsageLimit": 100, + "dataStoreLogLevel": "debug", + "maxUrlLength": 500}}, + { + "servlet-name": "cofaxEmail", + "servlet-class": "org.cofax.cds.EmailServlet", + "init-param": { + "mailHost": "mail1", + "mailHostOverride": "mail2"}}, + { + "servlet-name": "cofaxAdmin", + "servlet-class": "org.cofax.cds.AdminServlet"}, + + { + "servlet-name": "fileServlet", + "servlet-class": "org.cofax.cds.FileServlet"}, + { + "servlet-name": "cofaxTools", + "servlet-class": "org.cofax.cms.CofaxToolsServlet", + "init-param": { + "templatePath": "toolstemplates/", + "log": 1, + "logLocation": "/usr/local/tomcat/logs/CofaxTools.log", + "logMaxSize": "", + "dataLog": 1, + "dataLogLocation": "/usr/local/tomcat/logs/dataLog.log", + "dataLogMaxSize": "", + "removePageCache": "/content/admin/remove?cache=pages&id=", + "removeTemplateCache": "/content/admin/remove?cache=templates&id=", + "fileTransferFolder": "/usr/local/tomcat/webapps/content/fileTransferFolder", + "lookInContext": 1, + "adminGroupID": 4, + "betaServer": true}}], + "servlet-mapping": { + "cofaxCDS": "/", + "cofaxEmail": "/cofaxutil/aemail/*", + "cofaxAdmin": "/admin/*", + "fileServlet": "/static/*", + "cofaxTools": "/tools/*"}, + + "taglib": { + "taglib-uri": "cofax.tld", + "taglib-location": "/WEB-INF/tlds/cofax.tld"}}} diff --git a/benchmarks/json-data/geometry.json b/benchmarks/json-data/geometry.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/geometry.json @@ -0,0 +1,1 @@ +{"geometry": {"type": "Polygon", "coordinates": [[[-0.939359853061118, 51.57401065198471], [-0.939440892477492, 51.57431080772057], [-0.939543636564569, 51.57460846194951], [-0.939564627628489, 51.574822653966265], [-0.939763179055758, 51.575406210178826], [-0.939787182642249, 51.575552991614], [-0.939819571231525, 51.57564949527348], [-0.939851290904264, 51.57571272360808], [-0.939975682132949, 51.57588648747347], [-0.940036822193859, 51.57598774653439], [-0.940072640734852, 51.57606090267849], [-0.940109693338918, 51.576205104339515], [-0.940125502187331, 51.57645611534466], [-0.940118623499009, 51.57662779459441], [-0.94008851367835, 51.57680555827417], [-0.939998015208524, 51.57709787034017], [-0.939928028667517, 51.577252794653916], [-0.939830628174189, 51.57740747134858], [-0.939796941313687, 51.57749078985784], [-0.939785586773343, 51.57754463746666], [-0.939770656147318, 51.57769016804059], [-0.939658154074368, 51.57824573765943], [-0.939485738834128, 51.57883313597966], [-0.93945717030888, 51.579192545519916], [-0.939524336079755, 51.57928306919007], [-0.939540939284811, 51.57931379092206], [-0.939553921057406, 51.579748206813974], [-0.939549110634237, 51.57983088690364], [-0.939520940649101, 51.58004913048237], [-0.93951863934971, 51.58014801827346], [-0.939525037302583, 51.580245186310094], [-0.939540364690294, 51.58033074581249], [-0.939561798495469, 51.58040197377017], [-0.939594984852117, 51.58046431619436], [-0.939708262827559, 51.580619996404984], [-0.939729069878358, 51.58065615108302], [-0.939759224390201, 51.58072476025555], [-0.939813615319267, 51.58093026195459], [-0.939900523550716, 51.58172321441459], [-0.939894144544868, 51.581997403240464], [-0.939910832471369, 51.58208657162566], [-0.940114353648015, 51.582457967531546], [-0.94022333049887, 51.58267475179605], [-0.940267247821581, 51.58277225843995], [-0.94038427828014, 51.583077233742756], [-0.940493362377966, 51.583289522851196], [-0.940571515796737, 51.58340442254201], [-0.940725857371931, 51.58359464061899], [-0.941198340240742, 51.584069167875626], [-0.941335307610427, 51.584261925920295], [-0.941372786463165, 51.5843261048293], [-0.941416540699353, 51.58443080287741], [-0.941461326187118, 51.584739621364996], [-0.941517445876004, 51.5849954910945], [-0.941575869597484, 51.58533860085252], [-0.941574762730556, 51.58538624677686], [-0.941565185406358, 51.58542572382202], [-0.941550002863301, 51.58545795698674], [-0.941515976834126, 51.58549361692739], [-0.941470510606583, 51.585524677868065], [-0.941423872780384, 51.585544039043356], [-0.94131509921043, 51.585566436558274], [-0.941075026707647, 51.58558675057684], [-0.940953181611661, 51.58561262652464], [-0.940734943851404, 51.58568708689612], [-0.940229533088359, 51.585883040066975], [-0.940067635923264, 51.58595531027499], [-0.939917220191166, 51.58603038143916], [-0.939797255285709, 51.586099433232604], [-0.939675637701456, 51.586177461657186], [-0.939611074554604, 51.58622273608784], [-0.939340396866166, 51.586441486256], [-0.93912244296424, 51.58662744303347], [-0.938817233975319, 51.58671729893312], [-0.938661522913105, 51.586771639765516], [-0.938087678078033, 51.586992141762096], [-0.937332636663603, 51.5873072119485], [-0.93492634290483, 51.58836081134952], [-0.934774110277819, 51.58845114531925], [-0.934663126573178, 51.588505886685766], [-0.934565467487243, 51.588546362183585], [-0.934462140700832, 51.588582290320545], [-0.934337145222589, 51.58861892084846], [-0.934213782000904, 51.588647473549656], [-0.934055887760941, 51.588671216763295], [-0.933259701136762, 51.58864510257983], [-0.933213278816969, 51.588716614209304], [-0.932681740160827, 51.588792708227174], [-0.931992471253759, 51.58900853446031], [-0.930629113767652, 51.58946908647644], [-0.928525036745892, 51.59005953842682], [-0.928533690860491, 51.59024394687689], [-0.928456010745829, 51.59047792078815], [-0.928256501298223, 51.5906748158337], [-0.927916132025856, 51.59066181734799], [-0.927671608556404, 51.590624516635486], [-0.927319567022116, 51.59061680481465], [-0.926850285435352, 51.59062240702726], [-0.926313746570405, 51.59066425819173], [-0.925516790702947, 51.59079184232522], [-0.925387133168341, 51.59078076476673], [-0.925293323156809, 51.59077990606886], [-0.925202187496562, 51.59078806346173], [-0.925112304116411, 51.59080432476366], [-0.925036768134577, 51.59082431403807], [-0.924968299737815, 51.59085066215826], [-0.924899640304234, 51.59088510100373], [-0.924851228495836, 51.590917926896914], [-0.924734051019008, 51.59105082982951], [-0.924694255912291, 51.59108553291224], [-0.924446018071168, 51.59126668934789], [-0.924204972773907, 51.59150995377465], [-0.923492520665307, 51.59215352189589], [-0.922775141969353, 51.59288246146081], [-0.922298613651092, 51.59343737077436], [-0.922101568270595, 51.59365046303728], [-0.92149319027045, 51.59422483935332], [-0.921029930136652, 51.59464499018023], [-0.919455791303858, 51.595519790418045], [-0.919908472816787, 51.59560757835559], [-0.919902358174605, 51.595621908790214], [-0.919721503870405, 51.59588190272939], [-0.919513222918683, 51.59614164398608], [-0.919057326435374, 51.59661490568889], [-0.918991959815932, 51.59669253146064], [-0.918853979663433, 51.59690975873926], [-0.91882720841051, 51.59694278142396], [-0.918711889332325, 51.597056812913756], [-0.918614808732714, 51.59713234806153], [-0.918297245740306, 51.59749448485627], [-0.918073703114389, 51.59778825130676], [-0.917853804369843, 51.59811082427763], [-0.917772408698363, 51.59831598343439], [-0.917709563771812, 51.59853030520902], [-0.917692745480418, 51.59856971355161], [-0.917634249201942, 51.59866178857289], [-0.917443039919903, 51.59887043094418], [-0.917335250471836, 51.598971042984616], [-0.916888284039272, 51.599309503426845], [-0.916921110547038, 51.59938623548714], [-0.916942485633783, 51.5995195094582], [-0.916937652924948, 51.599601289122916], [-0.916945811778801, 51.599683188627004], [-0.916964246289877, 51.599757989575366], [-0.917049297107238, 51.59994580090974], [-0.917089705367533, 51.60000731699611], [-0.917171120773417, 51.60010517795964], [-0.91752823274465, 51.60044925531009], [-0.917834023417531, 51.600765883511485], [-0.917913079603466, 51.600902386385464], [-0.918033251654948, 51.60107073894696], [-0.91851090277833, 51.601507638962644], [-0.918694916056997, 51.601663091331545], [-0.919167224655989, 51.60214309940451], [-0.919302231291783, 51.6024167896932], [-0.919552009673002, 51.60266096432073], [-0.919812571846437, 51.60293760761218], [-0.920091738726093, 51.60358667644501], [-0.920208566517809, 51.603592246724574], [-0.920644522919282, 51.60359715428394], [-0.921093152621479, 51.6036156641763], [-0.921168285587618, 51.603613657034074], [-0.921469264587163, 51.6035867495928], [-0.921584776688781, 51.603586911416876], [-0.921718864440287, 51.603595336217005], [-0.921999521996191, 51.60363387995426], [-0.922136050325758, 51.603661209181794], [-0.922248015684399, 51.60368921195661], [-0.922346882036963, 51.60372159023333], [-0.922478548042792, 51.60377135359644], [-0.922605777045377, 51.603825571929555], [-0.92269948345521, 51.60389297005248], [-0.922855181916126, 51.60396453348124], [-0.922908065211369, 51.60398749776935], [-0.923525984356841, 51.604174796116844], [-0.923689774691443, 51.6042095667925], [-0.923842334751645, 51.60423074681459], [-0.924020987014581, 51.604247669912816], [-0.924152253615336, 51.604253368572344], [-0.924379056519158, 51.60424915231234], [-0.924491916632975, 51.60423939614583], [-0.925129396784027, 51.604149022807746], [-0.925308707040747, 51.60413807581467], [-0.925396812395019, 51.604137083863186], [-0.925816640142735, 51.60415261457396], [-0.926339243350925, 51.604157394450915], [-0.926627592983669, 51.60417621577326], [-0.928219342008724, 51.60433911850777], [-0.928540897883304, 51.60435823822504], [-0.928666454251138, 51.6043611822271], [-0.928925123731038, 51.60435275210506], [-0.929272427371303, 51.60432085222454], [-0.929350681081097, 51.604308977474346], [-0.929525019586135, 51.60426381040009], [-0.929730308556221, 51.60419195021111], [-0.929806393059037, 51.60414948374236], [-0.929854111423592, 51.60408517871234], [-0.929877477717563, 51.604012559228565], [-0.929880189120251, 51.60395863398061], [-0.930157001898001, 51.603362311928585], [-0.930233415197893, 51.60324431822904], [-0.930397156019029, 51.60303540508514], [-0.93058677482955, 51.602831223239896], [-0.930747612253953, 51.60268432562219], [-0.931065151604954, 51.602443542878724], [-0.931358556224333, 51.60224659876122], [-0.931494751600125, 51.602165114969594], [-0.931807666849096, 51.601998019766675], [-0.932115553298882, 51.60186055047904], [-0.932344261944379, 51.601774512081256], [-0.932581062209752, 51.601712824287226], [-0.932837650566022, 51.60166929919289], [-0.93304760157037, 51.60164423223924], [-0.933247236692325, 51.60162806284857], [-0.933524572231589, 51.601623388892406], [-0.93367307135076, 51.60163283011416], [-0.933854562367985, 51.601651562386515], [-0.934222940436163, 51.60170526005669], [-0.934582321335698, 51.60177326158339], [-0.935176916778695, 51.60190903449902], [-0.935323237909383, 51.60194992468383], [-0.935449328012611, 51.60199153042619], [-0.935555166022244, 51.60203475076641], [-0.935754957696255, 51.60213547009268], [-0.935920944220561, 51.60219991608389], [-0.936105992086264, 51.60225194623237], [-0.936251123590137, 51.60228203448254], [-0.9362553703842, 51.602285669620606], [-0.935954861941404, 51.603034649313756], [-0.936025513047831, 51.60328615677915], [-0.937604653681525, 51.60374194595848], [-0.937842729718605, 51.6037494948452], [-0.937998245297976, 51.60376798569096], [-0.938149157504488, 51.60379812385097], [-0.938282536474463, 51.60383709493093], [-0.938398403200176, 51.60388400001471], [-0.938549544157173, 51.60396629131982], [-0.938542113846477, 51.60403725821696], [-0.938540670189083, 51.60403724516617], [-0.938690470772444, 51.60417707075241], [-0.93885671831091, 51.60429276731543], [-0.938949655717409, 51.60433227129961], [-0.939171393952754, 51.60435945147724], [-0.939491406642938, 51.60438302306183], [-0.939580914110842, 51.60438383145672], [-0.939698081584302, 51.604374998744255], [-0.939860253923854, 51.60435578228165], [-0.940131370864495, 51.60430877574863], [-0.940224037565311, 51.60429792302206], [-0.941065905352937, 51.604358569226044], [-0.941456261791824, 51.60439985396626], [-0.94172260946072, 51.604433725629356], [-0.942065117075164, 51.604483568721975], [-0.942405972956444, 51.60454238758566], [-0.942542307804962, 51.60457868292929], [-0.942668453620936, 51.60461848302318], [-0.942754322773386, 51.60465162617505], [-0.942930037674105, 51.6047332338937], [-0.94300827141212, 51.60478429141865], [-0.943050642772121, 51.60482513526179], [-0.943095505071305, 51.604883085645305], [-0.943175837511794, 51.60503037259752], [-0.943199044776033, 51.60508812802956], [-0.943264927978451, 51.605360268787045], [-0.94328295289835, 51.6055168856955], [-0.943285556153251, 51.605653582182974], [-0.94327790338372, 51.60573443814757], [-0.943262026480571, 51.60579633763445], [-0.943228365851772, 51.605877858692274], [-0.943092212068021, 51.60614458434088], [-0.943074097962666, 51.60624063192375], [-0.943061365824471, 51.606415854446915], [-0.943044862244347, 51.60650472320056], [-0.943017897594943, 51.606608783583646], [-0.942979591589439, 51.606703750216774], [-0.942905884027612, 51.60683076806164], [-0.942741267849139, 51.60707925374213], [-0.942655006715899, 51.607249318295594], [-0.942630361430127, 51.60731563455148], [-0.942616263944651, 51.607425205688976], [-0.942621958529523, 51.60749089598715], [-0.942636336634899, 51.60755576531453], [-0.942660904708633, 51.607617129739225], [-0.942696981288364, 51.607680396114986], [-0.942747433102709, 51.60774648940761], [-0.942856244975984, 51.6078490746924], [-0.94299552290573, 51.60794563997599], [-0.943040847342192, 51.60798381288104], [-0.943186973159248, 51.608158666884215], [-0.943285889122319, 51.60825217104693], [-0.943509689787491, 51.60844031193307], [-0.94379690141149, 51.609007570967925], [-0.943824004868445, 51.60908424372538], [-0.943831400135399, 51.609201201602104], [-0.943839541642426, 51.60922375393887], [-0.943852077204152, 51.6092436483043], [-0.943874740412961, 51.60926273459518], [-0.943900416430683, 51.60927645299323], [-0.944008015202393, 51.60930709311221], [-0.944074894993692, 51.60934995527111], [-0.944126815315737, 51.60941516198104], [-0.944143328071964, 51.60945037786937], [-0.944150844233183, 51.609499899486615], [-0.944148608042361, 51.60953404761941], [-0.944074023202655, 51.60969882315075], [-0.94403415265091, 51.60986121332522], [-0.944017357658548, 51.60996266784037], [-0.943992023164905, 51.61030771903426], [-0.943965568458423, 51.61051428886229], [-0.943938629028152, 51.61067949277199], [-0.943919488028492, 51.61075754789674], [-0.943885949921455, 51.61083367520212], [-0.943827406881077, 51.61092935920088], [-0.943739589608875, 51.61104186395993], [-0.943638735204063, 51.61115604969767], [-0.943533757272514, 51.611261206608894], [-0.942952360107171, 51.61179457356613], [-0.942768364001955, 51.61194397664764], [-0.942436714102017, 51.61217027698273], [-0.942010518369458, 51.61248743929258], [-0.941742162181165, 51.61266215641604], [-0.941369087685306, 51.61286829880399], [-0.941218061678922, 51.612965845186196], [-0.941055044244821, 51.613082165678385], [-0.940962318642569, 51.61315685920963], [-0.940802313735133, 51.613329853845215], [-0.940532273923746, 51.613638528438315], [-0.940201080800705, 51.61403027273604], [-0.940058816377521, 51.614185443187054], [-0.939985695447699, 51.614286388653916], [-0.939953592073967, 51.614362527773245], [-0.939906859457064, 51.614508669589505], [-0.939802341993177, 51.61490335803689], [-0.939554942446072, 51.615603370947234], [-0.939452722231603, 51.61596121406953], [-0.939421935085161, 51.61604275989804], [-0.939387192811998, 51.616108085051245], [-0.939207265482904, 51.61639149465681], [-0.939036585027605, 51.61671185322904], [-0.938852844916865, 51.61697274874371], [-0.938765881571911, 51.61710953487875], [-0.938636321443754, 51.617400592062225], [-0.93858227703968, 51.617550263869646], [-0.938563060896774, 51.61763101488344], [-0.938557821588965, 51.617793716095726], [-0.938568952285691, 51.6178738422429], [-0.938586194898738, 51.61793963701825], [-0.93864824402059, 51.61806608070808], [-0.938712639101221, 51.61815388154161], [-0.938801458484915, 51.61824729803767], [-0.938902019778203, 51.61833272809444], [-0.939001577491258, 51.61839926656718], [-0.939080060597956, 51.6184404379885], [-0.939144458958051, 51.618466196342986], [-0.93924483456823, 51.61849767462955], [-0.939389936057716, 51.61853135511866], [-0.939533886937889, 51.618552436752374], [-0.939605967169062, 51.618558482633226], [-0.939704125343146, 51.618561167280205], [-0.940011869234288, 51.61855765138392], [-0.940970156479417, 51.61846828865034], [-0.942814559287174, 51.61834913395653], [-0.9433943585448, 51.61832378069166], [-0.943791844341078, 51.61831207069643], [-0.944095316626396, 51.61830580819228], [-0.944345189840605, 51.61830625638639], [-0.944633949874169, 51.618311549349706], [-0.944866264500346, 51.618321729423634], [-0.945069571918896, 51.61833704343469], [-0.945259736594118, 51.618358533188456], [-0.945405071369022, 51.6183823175338], [-0.945538707551366, 51.61841229079249], [-0.945670733169093, 51.618449442740584], [-0.945789657802543, 51.61849097274293], [-0.945898390514756, 51.618536007789324], [-0.946002624502939, 51.61858819565799], [-0.946144975691139, 51.61867849034559], [-0.946290660655923, 51.61881197458077], [-0.946424293873759, 51.618966930407886], [-0.94648587943588, 51.619052004215185], [-0.946597289998464, 51.61923103785771], [-0.946748500992991, 51.619500344620654], [-0.946865282768134, 51.619759451627154], [-0.94692090631825, 51.619852564183816], [-0.946986743272162, 51.619941272483025], [-0.947121992710119, 51.62008904866086], [-0.947221067183078, 51.620177155655796], [-0.947357337089385, 51.62028088174252], [-0.947636341593443, 51.62045871900467], [-0.947732020809812, 51.62050633282523], [-0.947832261440868, 51.62054409665008], [-0.948024909405708, 51.6205835873772], [-0.948272727755043, 51.62061098363029], [-0.94903310890345, 51.62064836261257], [-0.949342820854191, 51.62068530212313], [-0.949548509996597, 51.62072310869445], [-0.949603327033706, 51.620726296510135], [-0.94966121922192, 51.62072141934501], [-0.949725095662238, 51.62070760405018], [-0.949813979767225, 51.620674230793945], [-0.949850856696741, 51.620766275113425], [-0.949938127431095, 51.62092800552347], [-0.95012170684362, 51.62142328688538], [-0.950137689181391, 51.621481875301626], [-0.950144591409982, 51.621558365780544], [-0.950143525838059, 51.62166715485939], [-0.950086848280287, 51.62218276713024], [-0.950081566444785, 51.62234906486587], [-0.950091380322934, 51.6227375905417], [-0.950012857804674, 51.623198158520914], [-0.949963053357781, 51.62366617649237], [-0.94993621019599, 51.62382778558582], [-0.949887611273865, 51.62405573809743], [-0.94981748429385, 51.62434014525264], [-0.949698012983878, 51.6246969431444], [-0.949601071539472, 51.62520410239216], [-0.949519655994856, 51.62547671925938], [-0.949509640700394, 51.62553507516918], [-0.949509569744091, 51.62560071332227], [-0.949517625184728, 51.6256898023632], [-0.949539397678852, 51.62581048474923], [-0.949602831958219, 51.626066413978656], [-0.949622600072634, 51.6262113557699], [-0.949625807500304, 51.62644786389373], [-0.949588359660548, 51.62688092470566], [-0.949587162842075, 51.62718303218221], [-0.949593421398238, 51.627287390862], [-0.949641886384285, 51.62762860642186], [-0.949677564559904, 51.627772791296934], [-0.949732061930258, 51.62791534613564], [-0.949847071945823, 51.62812767746571], [-0.95005020451512, 51.62890367131774], [-0.949860358893705, 51.62924185674224], [-0.949849459019953, 51.62927592739189], [-0.949848649628705, 51.62931098742953], [-0.949857806222275, 51.62935243070728], [-0.949882540677514, 51.62940750068883], [-0.949782851646605, 51.62940750843079], [-0.949684104107472, 51.6296170289926], [-0.949619670293909, 51.62984214210067], [-0.949589348281571, 51.62990391300069], [-0.949478823262764, 51.63006027755304], [-0.949419643728549, 51.63018293320961], [-0.949378577882241, 51.63033452402259], [-0.949364251310331, 51.63051692549393], [-0.949339228920643, 51.63059942443184], [-0.949248633732607, 51.63076855530058], [-0.949181283974238, 51.630869557872636], [-0.949044504574139, 51.63103647701982], [-0.948893935504611, 51.63136242402941], [-0.948761069414249, 51.631297394415576], [-0.948669492362367, 51.63125880992652], [-0.948537801268757, 51.63120547966423], [-0.948447461288637, 51.63117589768262], [-0.948353982967507, 51.63115707745748], [-0.948302104865814, 51.63115121794117], [-0.948079606840815, 51.63115102360314], [-0.947964190602531, 51.63114369566099], [-0.94782149485015, 51.63112892992514], [-0.947725107052886, 51.63111098229264], [-0.947684910040859, 51.63109983219839], [-0.947483021604023, 51.63102069524269], [-0.947447137482345, 51.63101048287877], [-0.947306094892948, 51.630986739722026], [-0.947000710620611, 51.63094713644845], [-0.946674033898238, 51.6308911565172], [-0.946364247153943, 51.63079216747898], [-0.946230490849763, 51.63076579091048], [-0.946172752135344, 51.63076347450912], [-0.94612066649297, 51.630766603772976], [-0.945914796224295, 51.63079712600587], [-0.94583241748209, 51.63079818492752], [-0.945382953779145, 51.63067905708907], [-0.945085984219956, 51.63058827220451], [-0.944883205963743, 51.630547786680644], [-0.944304065189339, 51.630538086402446], [-0.94394898927073, 51.630523204990325], [-0.943611477254356, 51.63049858971805], [-0.943603681926519, 51.6307098224617], [-0.943277115569317, 51.63102249010073], [-0.943359247728321, 51.63109426279834], [-0.942862682241593, 51.631385618132356], [-0.942777562378065, 51.63144239822567], [-0.942532313252267, 51.63161282917167], [-0.942337892928893, 51.63177202827151], [-0.94226606523137, 51.631816339444626], [-0.942197377359527, 51.63184988892168], [-0.942115813951467, 51.631877927416205], [-0.941937005967162, 51.631924871353945], [-0.941512981586086, 51.63201636159427], [-0.94144898217334, 51.6320346671529], [-0.94125937051438, 51.632111184999914], [-0.940790185204025, 51.6323425346351], [-0.940501042462563, 51.632535943664614], [-0.940243238615803, 51.63268647504363], [-0.940131608045529, 51.632764593869275], [-0.939328651391563, 51.63361514453957], [-0.939011405652477, 51.634145481445906], [-0.93882930544315, 51.63451878632893], [-0.93850479164515, 51.63486472819315], [-0.93841585373771, 51.63483694950617], [-0.938308667759282, 51.63503379600045], [-0.938237520065274, 51.63511048065125], [-0.938174497877949, 51.635148574806536], [-0.938097155068085, 51.63518114448376], [-0.938014243480848, 51.63520467214815], [-0.937885103100742, 51.635227781700706], [-0.937899482630853, 51.63529265131639], [-0.937852791962712, 51.635312010611116], [-0.937756752174709, 51.63534081433219], [-0.93768849662133, 51.635355482713884], [-0.937445207164159, 51.63537845841074], [-0.937282775985471, 51.6354039635962], [-0.936848828519967, 51.635485456519916], [-0.935951432459366, 51.63561220386278], [-0.935719677036262, 51.635636179646525], [-0.935420148631615, 51.63565414571281], [-0.935249454884316, 51.63560044703531], [-0.935077590540852, 51.635535048401415], [-0.934717727795324, 51.63535285185533], [-0.934413155884105, 51.635216113905294], [-0.934240481559584, 51.635123731852076], [-0.934130824273522, 51.63505529964683], [-0.934018404467151, 51.63498144729724], [-0.93379675026591, 51.63482118293064], [-0.933679892303923, 51.6347517857655], [-0.933595523374065, 51.63471415412531], [-0.933350473747258, 51.63462740768713], [-0.933261876876166, 51.63458524160035], [-0.933052343088727, 51.63446285066096], [-0.932887751506176, 51.63439571653097], [-0.932638117941304, 51.63431971687678], [-0.932307197466639, 51.63419801967628], [-0.931343887912331, 51.63380981222079], [-0.931071830619705, 51.63376597498289], [-0.930956833347264, 51.63374065092008], [-0.930823331188951, 51.63370346918478], [-0.930701576222194, 51.633658301797674], [-0.930601553796263, 51.63361063468632], [-0.930506119022842, 51.63355221932683], [-0.930386739592999, 51.633467510133144], [-0.930286034494439, 51.633387466714524], [-0.930225334024314, 51.63332666999925], [-0.930188937852857, 51.633276884582266], [-0.930114567680391, 51.63312155131756], [-0.92999324620862, 51.63293521875163], [-0.929900400330813, 51.63282827174111], [-0.929602366751531, 51.6325378240622], [-0.929499431873266, 51.632429885607195], [-0.929341000864788, 51.63222433167361], [-0.929059923028374, 51.631889079042224], [-0.928963213558906, 51.63176231446386], [-0.928896162303318, 51.6316645934755], [-0.928844852932023, 51.631573310156845], [-0.928688841592085, 51.63126527289447], [-0.928672375509884, 51.6312282570475], [-0.928615004479859, 51.631026321392014], [-0.928599834825331, 51.63099561149414], [-0.928552267379979, 51.63092953870757], [-0.928477466267079, 51.630854225808044], [-0.928389580173335, 51.630782390113474], [-0.928294323595921, 51.6307167812279], [-0.928190294396403, 51.63065558801307], [-0.928078937075949, 51.630598823630024], [-0.927494137115659, 51.630339021667446], [-0.927177150281751, 51.63017967221046], [-0.927053070740772, 51.63011110151437], [-0.926922044883713, 51.63003077810591], [-0.926774152423019, 51.6299305188448], [-0.926569924361936, 51.62976860145066], [-0.926465515994788, 51.62966244509719], [-0.926222881099496, 51.62935271335746], [-0.925807083215573, 51.62885077488713], [-0.925685153671251, 51.62869140695483], [-0.925627779063265, 51.628612654944924], [-0.925107975398826, 51.62780494620014], [-0.925039238852947, 51.627717997425265], [-0.924853081975605, 51.627525670804864], [-0.924566287633664, 51.62725149768458], [-0.924018135317732, 51.62666651663998], [-0.9236755124427, 51.62631000590676], [-0.923506463123086, 51.62618886774415], [-0.92325024557972, 51.62602736696645], [-0.923179326155173, 51.62597186775246], [-0.923151247824846, 51.62593744208942], [-0.923025917353845, 51.62573937605691], [-0.922746731858051, 51.625388839233764], [-0.922647729925315, 51.625421200084226], [-0.922438316532782, 51.62517470633975], [-0.922266691774008, 51.62491866820555], [-0.922176577184834, 51.624819832363215], [-0.921722712186069, 51.62440384906751], [-0.921324388846087, 51.624082786314446], [-0.921078577970903, 51.623909687134365], [-0.920860652296657, 51.62377910436709], [-0.920574889783577, 51.623646099345635], [-0.920239048968319, 51.623492851580735], [-0.920014292502202, 51.62371107994427], [-0.919774493442185, 51.623954346092496], [-0.9196346398006, 51.62406455586703], [-0.919395541436808, 51.62427815528515], [-0.919291601043514, 51.624396787581134], [-0.919216417933559, 51.6245210794288], [-0.919153464283899, 51.62467785367513], [-0.919134125069682, 51.624762197061855], [-0.919115026043568, 51.62495803894169], [-0.919049238753011, 51.62517323267518], [-0.919009465019033, 51.625266379578875], [-0.918926652164549, 51.625407685106715], [-0.91889138185638, 51.62549368011671], [-0.918887531877765, 51.62553410703284], [-0.918896749679156, 51.62569334383204], [-0.918892707420934, 51.62574186144837], [-0.918872585162246, 51.62579832350382], [-0.918836276012485, 51.62586722482348], [-0.918763089019947, 51.62596815648993], [-0.918486277330256, 51.626309088016214], [-0.918317614737411, 51.62653682130949], [-0.917905561785174, 51.626975413689514], [-0.917718470441796, 51.62724883363936], [-0.917588198962995, 51.627380709193844], [-0.917518986462533, 51.627435819379606], [-0.917391270738013, 51.627520961779815], [-0.916852199941663, 51.62783249660931], [-0.916708494011591, 51.62822500463541], [-0.916564194300437, 51.62882431452802], [-0.91642514281193, 51.62950639562586], [-0.916399138398425, 51.62974892972319], [-0.916394191477189, 51.62995659074321], [-0.917260413231125, 51.62992321851857], [-0.917422640699178, 51.63166639247214], [-0.91745600722272, 51.63232848375385], [-0.917204699151121, 51.632324368705305], [-0.916787813832452, 51.632356490901394], [-0.916473041038736, 51.63240843616508], [-0.91615824611563, 51.63246127954521], [-0.916096846672852, 51.632491284427324], [-0.916000979824314, 51.632573122584574], [-0.916035541448316, 51.63300234215989], [-0.916058746179642, 51.633180590521675], [-0.916070697537387, 51.63322475979131], [-0.916098260729099, 51.63328076225654], [-0.916287121367376, 51.6334803208717], [-0.916556537933578, 51.63369500893812], [-0.916833436931067, 51.63389897542989], [-0.916980624704717, 51.63396776999687], [-0.917236275570907, 51.634093312450645], [-0.91746761535009, 51.63414759643489], [-0.917599467742121, 51.63382870989293], [-0.917652284973834, 51.63367364156546], [-0.917677934007693, 51.63362802065708], [-0.917745133700401, 51.63359716923921], [-0.917749446066394, 51.633598108140106], [-0.917778102484095, 51.633608262991594], [-0.918084580428658, 51.633662338963], [-0.918258883815884, 51.633684625273325], [-0.918506861448772, 51.63370758977881], [-0.918953829589691, 51.63374767133924], [-0.919245145699076, 51.633771033193085], [-0.919300707852053, 51.63386505735126], [-0.919518444759651, 51.63449197843591], [-0.919277685382965, 51.63446908250848], [-0.919031520477806, 51.63467362436313], [-0.918786199566619, 51.63490335001199], [-0.918632752044247, 51.63503681158531], [-0.918623327237537, 51.63512933850577], [-0.918590569006466, 51.635413172104], [-0.918679820058316, 51.63554886817429], [-0.918329488250497, 51.63557621368664], [-0.918276435808259, 51.635741170885815], [-0.918247752304029, 51.6360358318421], [-0.918226764712395, 51.6364321689642], [-0.918316733144818, 51.63702374696847], [-0.918287332378286, 51.63783452012518], [-0.918306713699577, 51.63835621240955], [-0.918316674296085, 51.639213205140855], [-0.918347519668651, 51.639799742499974], [-0.918322169732004, 51.63995416480466], [-0.918318885834364, 51.64003146244247], [-0.91832686087795, 51.64012145202931], [-0.91837911416845, 51.640354816042915], [-0.918418495846573, 51.64070405330022], [-0.918530296534871, 51.64128953760163], [-0.918512952473936, 51.64147190762244], [-0.918367217757134, 51.64200916315153], [-0.917905817511154, 51.6420255938785], [-0.917874522823857, 51.64200462484983], [-0.9178264462409, 51.64196012300076], [-0.917792775459127, 51.641917552189355], [-0.917773553228143, 51.64187511449974], [-0.917765526057023, 51.64184806570082], [-0.917757894232724, 51.6417436926823], [-0.917749532884981, 51.64142711089125], [-0.917739557627689, 51.64136048104305], [-0.917720785029217, 51.641299165096676], [-0.917688816437575, 51.64124581999865], [-0.917649452591449, 51.641199600032465], [-0.917568381483579, 51.64114490323613], [-0.917433423830488, 51.64098630616572], [-0.917315173490429, 51.64079369481265], [-0.916601390868836, 51.640243120219885], [-0.916329281834837, 51.640018517003504], [-0.916001068304932, 51.63966211774633], [-0.915790319174844, 51.63947044935813], [-0.915502073944432, 51.63913509831614], [-0.915393357554307, 51.63902799332443], [-0.915169439572157, 51.63884339546647], [-0.914312592230519, 51.638234837864296], [-0.913969150495335, 51.63797270396478], [-0.913808719070197, 51.63773204326735], [-0.913709021859032, 51.63761063348384], [-0.913238840648949, 51.637814889395024], [-0.912211197236081, 51.63818662075986], [-0.912057780107923, 51.6382571327065], [-0.911911629192503, 51.63832591344631], [-0.911683066608314, 51.6384568717294], [-0.911571655864317, 51.638583520328496], [-0.910821072629623, 51.63897039510019], [-0.910799442348496, 51.63890815232427], [-0.910457034748542, 51.63884473254883], [-0.90959863753988, 51.63872527019996], [-0.909397970101408, 51.639078576087414], [-0.909048252097236, 51.63925965643008], [-0.909362542404515, 51.63959166868019], [-0.90780907162756, 51.64013291512084], [-0.906217399025103, 51.640939038154336], [-0.905898125060113, 51.64111499768922], [-0.905490384709512, 51.641363863281036], [-0.905329841704473, 51.64154939281248], [-0.905189541321435, 51.641794455508446], [-0.90489098319803, 51.64194992468491], [-0.904781623731163, 51.641990266433346], [-0.904676706895303, 51.64202615370086], [-0.904609919053975, 51.64203901826923], [-0.904237228330216, 51.64209218907456], [-0.90337364044862, 51.64224597828853], [-0.902975191138407, 51.642348358507896], [-0.90292303291413, 51.6422939216028], [-0.902563354675933, 51.64240655335107], [-0.902346768622897, 51.642458479170756], [-0.900824166346957, 51.64291090498388], [-0.900831401206159, 51.64297031739377], [-0.900456613238591, 51.64299018760407], [-0.900019098619797, 51.64297440185565], [-0.899740380937974, 51.64290615240652], [-0.899740489711103, 51.64290165761423], [-0.899316872364163, 51.642849133775655], [-0.899203336991784, 51.642822893203494], [-0.898949902655656, 51.64272520647125], [-0.898783095909619, 51.642631028913314], [-0.898613530793898, 51.64253143027416], [-0.898274969154989, 51.64230885935864], [-0.898003026265053, 51.642080618381755], [-0.897815191816853, 51.641840577798526], [-0.897681652652772, 51.6416262230417], [-0.897327401428262, 51.64091885338664], [-0.896908641882592, 51.6401308512027], [-0.896689777704333, 51.63985994571793], [-0.896199107519928, 51.639356299928586], [-0.896147069948886, 51.63929736526477], [-0.896071667668875, 51.63912941223961], [-0.896034388155249, 51.63881974973283], [-0.89604243255033, 51.63866696761571], [-0.896079873457203, 51.63849378104931], [-0.896158355572289, 51.63829670279626], [-0.896345617779906, 51.63796397393339], [-0.896436991088377, 51.637771512438086], [-0.896627579786388, 51.63748017587825], [-0.896853716275347, 51.63721255114492], [-0.896930541034958, 51.63714313797598], [-0.897052325259386, 51.63706695367484], [-0.897622203318074, 51.636806151704704], [-0.897875248140837, 51.636679946210485], [-0.898045509693898, 51.63657094674504], [-0.898161794997489, 51.63648302058021], [-0.898300490282884, 51.636364732965696], [-0.898761753797595, 51.63587451909389], [-0.898944791614438, 51.635595696246455], [-0.899167964890093, 51.63497197055003], [-0.899296205851425, 51.63450920414348], [-0.899574174378538, 51.633591065468096], [-0.89965934952667, 51.63323579470252], [-0.899745200652967, 51.632733067337156], [-0.89977291429982, 51.632065248259224], [-0.899749317297925, 51.63190587518938], [-0.899730833669311, 51.631833768913715], [-0.899698165870897, 51.631750739777836], [-0.89965967663145, 51.63166945441679], [-0.899415121605884, 51.63126703489972], [-0.899342021743563, 51.6311233827535], [-0.899274678557411, 51.630980683675816], [-0.899221406706553, 51.63067446858268], [-0.899099405183406, 51.63046202142283], [-0.899036514315775, 51.63037421293725], [-0.898969246754073, 51.63028816171176], [-0.898790586842518, 51.63008867047265], [-0.898592010806669, 51.62987640386868], [-0.898497321924236, 51.62978919602221], [-0.898330098469121, 51.62965455114822], [-0.898092642525963, 51.62949676796704], [-0.897090362270362, 51.62894426419184], [-0.896737033461809, 51.62879887742956], [-0.896347312922056, 51.6286648367393], [-0.895633444660858, 51.62837398981453], [-0.895432402381131, 51.628264199314984], [-0.895328663542796, 51.62819308870188], [-0.895257753282041, 51.62813847178444], [-0.895144755729953, 51.62803220648194], [-0.894948239644532, 51.627795675481295], [-0.894944118635818, 51.62766795529761], [-0.894659948504904, 51.62723368184], [-0.894597856997988, 51.62711350846984], [-0.894557343909314, 51.62699713484451], [-0.894469809950127, 51.62655661915932], [-0.894297931114171, 51.625960652861906], [-0.894027819576293, 51.62530531541029], [-0.893931965007508, 51.62514795788166], [-0.893770350871199, 51.62496210671055], [-0.893637995566781, 51.62476124514902], [-0.893507481839104, 51.62466290563429], [-0.892108104715385, 51.62369479825078], [-0.891788795844237, 51.623459800649094], [-0.891922368328922, 51.62337294285213], [-0.891402229815371, 51.62296161084893], [-0.891224922435199, 51.622768414566416], [-0.890089770742591, 51.621276764770215], [-0.890188416566163, 51.62120036880181], [-0.889947380146256, 51.62101466068101], [-0.889727152716072, 51.62086421627997], [-0.889328903798693, 51.62066892786315], [-0.889153387824523, 51.620758083474584], [-0.888409981594066, 51.6201459098237], [-0.888016456293258, 51.619876030785385], [-0.887588982852847, 51.619754191291285], [-0.887143566599165, 51.61965735685454], [-0.88701981132148, 51.61963820065132], [-0.886790744842007, 51.619613550199404], [-0.886603228328527, 51.619602780759124], [-0.886388075513318, 51.619599841439666], [-0.886090409498186, 51.61960421155123], [-0.8851368584814, 51.61967159165818], [-0.883828125903616, 51.61979133688442], [-0.883515973065361, 51.619797361107345], [-0.883424375160774, 51.6198216668555], [-0.883259776293847, 51.619877648328995], [-0.883163867754863, 51.61990101371408], [-0.883044634749604, 51.619815357981636], [-0.881854770311083, 51.61956485587701], [-0.881704286246311, 51.61951666620604], [-0.881635675440863, 51.619487239450166], [-0.881560131370525, 51.619446057447796], [-0.881477720403852, 51.619390423316226], [-0.881374708667671, 51.619291432867335], [-0.880834298239682, 51.61853547912722], [-0.880617549323506, 51.618127888748454], [-0.880388345702594, 51.61816796449318], [-0.879226788544387, 51.6185884841998], [-0.878534686661489, 51.61883184500677], [-0.878385021629543, 51.61898507235025], [-0.878148819949825, 51.61913297697072], [-0.878102165244257, 51.61915051459153], [-0.87804120240859, 51.61916252048532], [-0.877967464227806, 51.619165412606506], [-0.877896924603018, 51.61915574690363], [-0.877839648002824, 51.61913541789456], [-0.877812586845032, 51.61911987344738], [-0.877382402665225, 51.61869944717381], [-0.877261875140598, 51.61866682400238], [-0.877087293116294, 51.618600414623565], [-0.876592344555959, 51.61846350297477], [-0.876408990128558, 51.61845995037962], [-0.876374465270622, 51.61845422502283], [-0.876347205240439, 51.61844677083749], [-0.87630299358364, 51.61842386858449], [-0.876241963569583, 51.618380124514495], [-0.876216636094276, 51.618352907107045], [-0.876152781748704, 51.618131100785114], [-0.876106882196741, 51.61811807314475], [-0.876305643178539, 51.617614643124426], [-0.875030363348109, 51.6174927341714], [-0.874705473526163, 51.61748872204597], [-0.874564111923802, 51.6174810731233], [-0.874279482039409, 51.61730930128958], [-0.874259717266618, 51.61699889890464], [-0.874416434195306, 51.61673604585861], [-0.874423036602998, 51.61652750219062], [-0.870144618410033, 51.61769939147719], [-0.870074692270606, 51.617607003497994], [-0.869665459226217, 51.61768399010514], [-0.869137937974611, 51.617812887107476], [-0.868711126950696, 51.61789959196275], [-0.868460959800069, 51.617969115035805], [-0.866874516019656, 51.61827841686334], [-0.866642434191741, 51.6183175388698], [-0.866517885416195, 51.61833072340073], [-0.866392071649004, 51.61833670224208], [-0.865776872894858, 51.61833166083683], [-0.865633662902087, 51.618340168339564], [-0.865493072065054, 51.618359490991885], [-0.864874419821269, 51.618492883413026], [-0.864829070270363, 51.61851582340227], [-0.8648101986804, 51.61846169086974], [-0.864778464993556, 51.618402038980314], [-0.864733824417545, 51.61833866562683], [-0.864681918741689, 51.61827702035103], [-0.864649512487616, 51.61824433697217], [-0.864492159027339, 51.61812502442397], [-0.864510219622979, 51.618037979732996], [-0.864490008258273, 51.61792179156664], [-0.863791866117017, 51.616668790850674], [-0.863578496430752, 51.61619016667409], [-0.863939572338851, 51.6160749702936], [-0.864141702322916, 51.61602027805823], [-0.864343742093738, 51.615969181278444], [-0.864684853799959, 51.61590144547291], [-0.864287415633653, 51.61573755014447], [-0.864114344880943, 51.615611790807684], [-0.86394143216696, 51.615479738556914], [-0.863424226660599, 51.6150224515856], [-0.863108525016747, 51.61470918210108], [-0.862999136822108, 51.61463618943345], [-0.862947760773663, 51.614611414387845], [-0.862827479233939, 51.614569786988696], [-0.862764327092327, 51.6145538895073], [-0.862690954996651, 51.614542388851355], [-0.862422671693898, 51.614528100870835], [-0.862278208948609, 51.61452939875511], [-0.862025067586916, 51.614544929155834], [-0.861633333855888, 51.61461576315295], [-0.861195617216796, 51.61467715820802], [-0.860991546767721, 51.61469406144679], [-0.860819513274215, 51.61470048511226], [-0.860591345418716, 51.61469917048917], [-0.860366335624517, 51.61468709604235], [-0.860199196800327, 51.61467108707321], [-0.860140174693704, 51.6146633207896], [-0.859842784619867, 51.61460018922178], [-0.85969929013584, 51.61456282905675], [-0.859501466379857, 51.61450336097874], [-0.859306643699259, 51.614439425872085], [-0.859175017225196, 51.614389591981386], [-0.858977780895874, 51.61430675031806], [-0.858172868778381, 51.61392127488393], [-0.856305510909038, 51.61299763777437], [-0.855879431428414, 51.61282624136621], [-0.855413827571698, 51.612676038205095], [-0.855073660630441, 51.61259179657028], [-0.854915624510577, 51.612558784566126], [-0.854688372582268, 51.61252150056368], [-0.854459541396129, 51.6124895957323], [-0.854208848612115, 51.61246556965946], [-0.853413812340721, 51.612436228916096], [-0.851724243907319, 51.61242871018406], [-0.851450292115, 51.612410744947404], [-0.850998615679464, 51.61233888823236], [-0.850653274334699, 51.61223120468302], [-0.850372939737194, 51.61235164666859], [-0.850315593337778, 51.61233490012849], [-0.850193999216673, 51.612288751000705], [-0.850146601119627, 51.612278395984944], [-0.849926028861458, 51.61226274823948], [-0.849854084982468, 51.61225215268858], [-0.849714847013531, 51.612218418620564], [-0.849473435162227, 51.61217019573735], [-0.849372523204365, 51.61216291272777], [-0.849235958321253, 51.61219484371945], [-0.849170915863905, 51.6121969037703], [-0.849112126238191, 51.61218014249445], [-0.8487984760956, 51.61201881385575], [-0.848813983178796, 51.61186251023449], [-0.848805967905994, 51.611779707971536], [-0.848777693193183, 51.61169850541887], [-0.848751669639592, 51.61164250170296], [-0.848740414389996, 51.61163070213332], [-0.848685616135578, 51.61162746733029], [-0.848598109857592, 51.61148993537107], [-0.848561752293423, 51.61144282198033], [-0.848420551583887, 51.61131555337684], [-0.848346143135118, 51.61123120073643], [-0.848017978126262, 51.61073074025961], [-0.84803240586268, 51.61067423405594], [-0.848009203184881, 51.61062095534751], [-0.848010806265629, 51.61061467688053], [-0.848360723390725, 51.61054078070849], [-0.848731046077576, 51.61040234328455], [-0.848814480324059, 51.61035820278237], [-0.848820437461021, 51.610351067821576], [-0.848690278305866, 51.610072847084595], [-0.847947554822518, 51.60900543974003], [-0.847435103308081, 51.6083125448088], [-0.847167998407497, 51.60796823756615], [-0.846186886755928, 51.60662333116728], [-0.845549998419521, 51.605828497430636], [-0.845383680959569, 51.60566770865375], [-0.844840468159951, 51.60522267062485], [-0.84443530295085, 51.60497141150611], [-0.844232696249957, 51.60481835643492], [-0.843486943931864, 51.60416181103064], [-0.84332558359401, 51.60420428093958], [-0.842908147301968, 51.603868373383044], [-0.842663709069561, 51.603714004109015], [-0.842310199280505, 51.603533382087996], [-0.841471682375652, 51.60311958453644], [-0.841215384127901, 51.602977683579475], [-0.840873068217364, 51.60281155440105], [-0.840467421086961, 51.602637605395635], [-0.840268344470896, 51.602516948405764], [-0.840203154295604, 51.60246864832527], [-0.838474883614574, 51.601841924417336], [-0.838334815858368, 51.60178568911777], [-0.838125139250388, 51.60168470536249], [-0.837520083534699, 51.60134782062488], [-0.837365310402971, 51.60124558073874], [-0.837143016970701, 51.6010734356079], [-0.83702163004049, 51.600964332538595], [-0.836879440722268, 51.60082175386177], [-0.836733036616179, 51.60067463738169], [-0.836105420124444, 51.59992210370809], [-0.836001567218505, 51.59980508080317], [-0.835894758960057, 51.59969072601903], [-0.835646409012494, 51.5994652683849], [-0.835572705263831, 51.59941148620318], [-0.835355212679077, 51.599278049641256], [-0.835001490423373, 51.59910819321327], [-0.834666328550124, 51.59894661249016], [-0.834023851532118, 51.59860753956394], [-0.833813699592692, 51.59846967713012], [-0.832219972267628, 51.59727861587006], [-0.831975375091702, 51.59713321406168], [-0.83180286996819, 51.597047874561696], [-0.83156138306724, 51.59695015903964], [-0.831279067386554, 51.596868221715724], [-0.831119729288761, 51.59683246683902], [-0.830996129682144, 51.596810555210986], [-0.830798964246538, 51.59678611250204], [-0.829935838169309, 51.596720865686486], [-0.82967342169104, 51.596707460026586], [-0.829378950815281, 51.59670542343618], [-0.828672101908656, 51.596738836236966], [-0.828529092462618, 51.59674190522934], [-0.828241907711544, 51.596737240965595], [-0.828066024571149, 51.59672739285258], [-0.827854311754233, 51.596707295846045], [-0.827399248313258, 51.59666228882735], [-0.827164974703315, 51.59662128423301], [-0.827063074447412, 51.59659778687348], [-0.826830893268571, 51.59653162563389], [-0.826403126611598, 51.596379885757386], [-0.826320361645679, 51.596342192238744], [-0.826196596762853, 51.596270819297594], [-0.825930135887572, 51.596078429107884], [-0.825702044863314, 51.59590980062742], [-0.825239717878873, 51.595531118786504], [-0.824901250965003, 51.59522021379687], [-0.824412039116432, 51.59470908081712], [-0.8242790371805, 51.59460434384618], [-0.824162427084317, 51.59453573788591], [-0.823734544991122, 51.59433363318264], [-0.822923577534385, 51.59387232098135], [-0.82274220720895, 51.593740122024236], [-0.822758790294358, 51.59343366962803], [-0.822450529949737, 51.592123177421634], [-0.822408018987733, 51.591980681321466], [-0.82236394886053, 51.59184266543808], [-0.822242174035691, 51.59158338051977], [-0.821801765862476, 51.5908065697487], [-0.821372709449585, 51.59009371260957], [-0.821171850754746, 51.58982284235581], [-0.820679968304875, 51.58936291919855], [-0.820417155492676, 51.58914357740762], [-0.82015811620844, 51.5888901042506], [-0.820045903377484, 51.58876399099103], [-0.81975498206002, 51.5884040936899], [-0.819793038416411, 51.58838379523831], [-0.819648800144719, 51.588268149727725], [-0.819147039514258, 51.58763368041164], [-0.818936357700162, 51.58740856531028], [-0.818746726401906, 51.58698404449756], [-0.818744261992127, 51.58691208559554], [-0.818786542624285, 51.586561832259704], [-0.818798419467402, 51.58638211648965], [-0.818772601288344, 51.58593047014409], [-0.818622316220491, 51.585380460186784], [-0.818493730937228, 51.58471737211902], [-0.818460174123387, 51.58461992329734], [-0.818316632401033, 51.58436670899539], [-0.818092592164715, 51.58404524580265], [-0.817774082795079, 51.58341531231479], [-0.817553796530972, 51.58311636524129], [-0.817445537064436, 51.58300557512581], [-0.81689125274485, 51.582562990062094], [-0.816348587477007, 51.58217357091916], [-0.816214612729635, 51.58210837837547], [-0.816144330954904, 51.58209148442308], [-0.816059129697027, 51.58209332267878], [-0.815742672724781, 51.5820523651453], [-0.815217212787465, 51.58194545592985], [-0.815002344756643, 51.58188304223224], [-0.814826435408141, 51.5818210214772], [-0.814485295861823, 51.581730356582035], [-0.81444044205173, 51.581790148477246], [-0.813566956536122, 51.581635656767844], [-0.813282023122958, 51.58154825394594], [-0.813052037332166, 51.581456910143594], [-0.812870182657061, 51.581346270732034], [-0.812790810356639, 51.58129061819263], [-0.812604263086127, 51.581138568732094], [-0.812386509085548, 51.58085492331321], [-0.812249092317067, 51.58070067277682], [-0.812167619564544, 51.58055957666617], [-0.812051961231651, 51.58029045130041], [-0.812042798783181, 51.580254391465495], [-0.812034433182585, 51.580187767648724], [-0.812033188044369, 51.58012481260171], [-0.812058064730261, 51.580000977815104], [-0.81229781440549, 51.579440518478464], [-0.812247901650195, 51.57941753400863], [-0.812446355706805, 51.57916777205078], [-0.81277233113049, 51.578787120404634], [-0.813191367818544, 51.57821318632392], [-0.813476583358647, 51.57767926033569], [-0.81372993476285, 51.57714950751218], [-0.813894821439398, 51.57669169369027], [-0.813998634879093, 51.57614064720803], [-0.814138744624452, 51.57508193151095], [-0.814120940539715, 51.57493428638376], [-0.81419874804071, 51.57321943977239], [-0.814492542549023, 51.572575897898666], [-0.814547744449169, 51.57211787423915], [-0.814549364628156, 51.57200009817749], [-0.81449843948966, 51.57157247390041], [-0.81447275908744, 51.57022974030085], [-0.814470739157426, 51.56964165674743], [-0.814429823166273, 51.56938407823071], [-0.814416473674158, 51.5693425811485], [-0.814362577800679, 51.569251219648685], [-0.81406844007837, 51.5689659058573], [-0.813908308238922, 51.56874308971205], [-0.813853532979604, 51.56863013877188], [-0.81375715260415, 51.56839717647337], [-0.81371284208748, 51.56815934527622], [-0.813667666933597, 51.567788426746645], [-0.813915408556528, 51.567527470860746], [-0.814280993234198, 51.56684059466537], [-0.814704823511867, 51.56613272518902], [-0.814994772052415, 51.56569055892733], [-0.815202529336662, 51.56519091397622], [-0.815219131565213, 51.56505170869626], [-0.815351636137841, 51.564671793906264], [-0.815511116853932, 51.56436408558186], [-0.815565592175225, 51.5642108755608], [-0.815662011458114, 51.564053592855515], [-0.815731002538058, 51.56389693250399], [-0.815762954470268, 51.56377766396064], [-0.815882314039101, 51.56307031436626], [-0.815899206541573, 51.563030920866616], [-0.815918960262566, 51.5629924554096], [-0.816100387305838, 51.56272812828101], [-0.816239061970809, 51.562387838558415], [-0.816351227865814, 51.56217946080997], [-0.816402225233145, 51.562104443964415], [-0.816445731089239, 51.56204014171416], [-0.816755073070336, 51.56173843863565], [-0.81682883069147, 51.5615089920632], [-0.81709149295673, 51.56100450196165], [-0.817126546068515, 51.5610435199925], [-0.817036868291134, 51.56144185218239], [-0.817602599672938, 51.56148891511105], [-0.817650902097453, 51.56129517879352], [-0.81772376875861, 51.56109989153342], [-0.818544773098936, 51.56114952106405], [-0.818940645385275, 51.56112652991029], [-0.819286252234888, 51.56087194248433], [-0.820505192935939, 51.560762809232635], [-0.821152924392013, 51.56109751750433], [-0.821401734784996, 51.56112699167495], [-0.821468077854438, 51.561127657861135], [-0.821837057068471, 51.56108460493917], [-0.822551882107614, 51.56083281445182], [-0.822991148836609, 51.56069335159132], [-0.823298868990794, 51.56056425765945], [-0.823427756279142, 51.560489119484224], [-0.823816316952276, 51.56018999039105], [-0.823841530161624, 51.56016326766115], [-0.823879440321637, 51.5600917131651], [-0.823939663402364, 51.55926686943448], [-0.824000930577316, 51.55924050793579], [-0.823876052668265, 51.55798579953388], [-0.823797968341331, 51.557154174451156], [-0.823813910366727, 51.55698348995032], [-0.824268965579194, 51.556733581409404], [-0.824612742777356, 51.55649154853787], [-0.826344281900068, 51.55484359477631], [-0.826657025878971, 51.55457337099326], [-0.827233265990788, 51.554040521447654], [-0.827929376968602, 51.55344502444081], [-0.828029419518581, 51.553368693973354], [-0.828246668974642, 51.55322159923911], [-0.828485269800709, 51.5530855074047], [-0.828605105979095, 51.55302466009866], [-0.829372820563392, 51.55267264797847], [-0.830416538296143, 51.552300003050114], [-0.830341853307235, 51.55217517181714], [-0.830015969895102, 51.55217192349864], [-0.82991663595149, 51.55216463892005], [-0.829524156953837, 51.55211486704629], [-0.829282415323888, 51.552092673855796], [-0.828838545910614, 51.55207835426137], [-0.828599504055965, 51.55206338004898], [-0.828680519991051, 51.55199764928292], [-0.828534433277995, 51.55195752639793], [-0.828384829125967, 51.55188589688778], [-0.827987906418731, 51.55167242458396], [-0.827957477145366, 51.551621766572], [-0.827834232346298, 51.55159086272802], [-0.827633977763617, 51.551525919798664], [-0.827259642164726, 51.55144395104261], [-0.826879262755715, 51.5513727108443], [-0.826619197529414, 51.551334143723224], [-0.825020961294276, 51.55117248609027], [-0.825087548806697, 51.55099511486544], [-0.825080332863119, 51.55093929339289], [-0.825041927300218, 51.55086247849746], [-0.82502361605882, 51.55078946149474], [-0.825044884876699, 51.55069166368164], [-0.825058487270179, 51.550667521970404], [-0.82509857658956, 51.550622964257876], [-0.825145597538488, 51.55058926609727], [-0.825325151596322, 51.5505056412203], [-0.824909915146001, 51.550164291306395], [-0.82525013660448, 51.550002248032946], [-0.825332063085088, 51.549957209837], [-0.825638185418255, 51.54977504214384], [-0.82578350044032, 51.54967668704559], [-0.825923116734683, 51.54957557721289], [-0.826170603160388, 51.54937393870707], [-0.826371785812396, 51.54917813090106], [-0.826492161334072, 51.549039961540565], [-0.826611394860751, 51.548890091280356], [-0.82670116630089, 51.54876420424681], [-0.826782355507479, 51.54863553380353], [-0.826823019292071, 51.54856850170786], [-0.827062757600335, 51.548106920435835], [-0.827101368877001, 51.54800749719491], [-0.827194201898492, 51.54770629998806], [-0.827307057244965, 51.54741159704493], [-0.827582602426052, 51.54684696658141], [-0.827901482950928, 51.54639156924703], [-0.828226190833503, 51.54604592938406], [-0.828636291311094, 51.545744301711125], [-0.82879259021163, 51.54566673370386], [-0.828904643767125, 51.545627388779295], [-0.829074413403866, 51.54558682127211], [-0.829642313890905, 51.54554213206049], [-0.831137752395514, 51.5457125947128], [-0.831296230672639, 51.545718668970665], [-0.831381409559054, 51.545715021306385], [-0.831520416985355, 51.54569302674314], [-0.831658465956176, 51.54565213966273], [-0.832162223002951, 51.54540897973132], [-0.832259763552867, 51.545373083913695], [-0.832342495362879, 51.54535232675641], [-0.832449690786029, 51.545333611293344], [-0.832560958333776, 51.54532482723805], [-0.832748224427793, 51.54533298427906], [-0.833594396864807, 51.5455158387706], [-0.833803468208608, 51.5455736658201], [-0.834066591719905, 51.54566080332341], [-0.834319302360527, 51.54576042533909], [-0.834632701147966, 51.545911902800114], [-0.834743597643834, 51.54597414830218], [-0.834972095381443, 51.546118487532766], [-0.835101437527799, 51.546192605160904], [-0.835308853525451, 51.54642845092972], [-0.835597379030446, 51.546650714213946], [-0.835675530378703, 51.54669644865621], [-0.835765285050956, 51.54673960061442], [-0.835946924814448, 51.54679895002405], [-0.836738145066418, 51.54693268079673], [-0.837616543696299, 51.54698454508781], [-0.837668585980954, 51.546979665457], [-0.837867989708348, 51.546964555807335], [-0.83797367625272, 51.54694851789646], [-0.838105566972017, 51.54692284834119], [-0.838233315283634, 51.54688994418392], [-0.838329229403341, 51.54686122067977], [-0.838482151664417, 51.546802489195365], [-0.839036827411148, 51.54642762424692], [-0.83955396219585, 51.54605418383688], [-0.840116011657223, 51.54567219327131], [-0.840736658187885, 51.54525391246058], [-0.840941426195899, 51.54514083988849], [-0.841049279937165, 51.54509604683764], [-0.841194847094701, 51.5450426342828], [-0.841299520083949, 51.545009498946165], [-0.841898633062652, 51.544870644649805], [-0.842282244574123, 51.54481328536381], [-0.842762474116396, 51.54475597844143], [-0.843565178344648, 51.54477737891959], [-0.844086979548171, 51.54484366398717], [-0.845732620874625, 51.545006428046236], [-0.847066038668597, 51.54519847249473], [-0.847735465249349, 51.545415455459946], [-0.84773690700669, 51.54541546961599], [-0.848634731053663, 51.54572550693968], [-0.849946581441456, 51.54620234699594], [-0.850255922443757, 51.54628810259981], [-0.850450510421732, 51.5463493547082], [-0.850677807173489, 51.54642891042725], [-0.850994850981171, 51.546552505063595], [-0.852786328510159, 51.547342426670774], [-0.85300310746802, 51.547496506935786], [-0.853571212311598, 51.54778799706584], [-0.854020445083318, 51.54798930492918], [-0.854581807452525, 51.548205193183556], [-0.85478620907829, 51.54827822314386], [-0.854963577157503, 51.54833660211785], [-0.855161244465997, 51.54839068294659], [-0.855663052553423, 51.5485088736389], [-0.856166529832507, 51.54867563412252], [-0.856279761006, 51.54870371304979], [-0.856530960852844, 51.54875111981111], [-0.856804082121709, 51.54878705024175], [-0.857112033920981, 51.54881432744164], [-0.857381573472553, 51.548820548731904], [-0.857549123049589, 51.54881049056259], [-0.857844479857821, 51.548764809719025], [-0.858057604662229, 51.54872012637499], [-0.858337617310588, 51.54865361386837], [-0.858552497890933, 51.54859635820055], [-0.859049392399301, 51.548450127924276], [-0.859439117962245, 51.5483792842905], [-0.859697682244768, 51.54836291412634], [-0.859779823131423, 51.54836551056866], [-0.860170027263243, 51.548390881318824], [-0.860456238387038, 51.54842243448379], [-0.861009536104037, 51.548500639150554], [-0.861158816462501, 51.54852906321894], [-0.861352413335375, 51.54857320311727], [-0.861544411683264, 51.54862362144007], [-0.861731905414109, 51.5486811891874], [-0.862073439754406, 51.548807688741114], [-0.86254414698236, 51.54901726458452], [-0.86282747298222, 51.54916477803516], [-0.863015068128655, 51.549276295417606], [-0.863120154717426, 51.549342054318615], [-0.863285809311142, 51.54946594721784], [-0.863418211576468, 51.54959311456195], [-0.863530092020445, 51.54973357070672], [-0.863653360363745, 51.549937978681236], [-0.863733641061499, 51.550131180181424], [-0.863790336700716, 51.5503448343906], [-0.863824973966162, 51.550691353426465], [-0.863841717303786, 51.55100353042492], [-0.863889686614544, 51.55116225019172], [-0.863971345177536, 51.55135816235228], [-0.864192531443895, 51.5518009005184], [-0.864636908176204, 51.552606367995786], [-0.864885616784935, 51.55304487507487], [-0.864984710926909, 51.55317801261536], [-0.865042267578469, 51.5532415116859], [-0.86524661818949, 51.553434113390985], [-0.866448255146234, 51.55464702695421], [-0.866553639357719, 51.55475954277147], [-0.86713929523259, 51.555454866418074], [-0.86728119491555, 51.55560729781788], [-0.867357192432134, 51.55568356216347], [-0.867846797612144, 51.55612348793147], [-0.867948777192819, 51.5561991033314], [-0.868039688780355, 51.55625572917072], [-0.868162193200772, 51.55631805467487], [-0.868334859667638, 51.55639345221028], [-0.868507816648064, 51.556457162985154], [-0.868686743286876, 51.556512838449954], [-0.868885971532242, 51.55656421341042], [-0.869870431325262, 51.55700170522159], [-0.870538382015661, 51.557289577406756], [-0.87065953954758, 51.55734829060127], [-0.870968323528286, 51.55751940747054], [-0.871084688448939, 51.55759695683154], [-0.871173919806704, 51.55766345498963], [-0.871421843971099, 51.55790412108149], [-0.871517352960249, 51.558008444760674], [-0.871560414081151, 51.55807539786269], [-0.871689483441928, 51.558339198343305], [-0.871715457861831, 51.558455441841], [-0.871819115572425, 51.558871857901316], [-0.872116688986198, 51.559438501590606], [-0.87224925001588, 51.559678057158926], [-0.872395481580982, 51.5598898694294], [-0.872503199025109, 51.56002578071336], [-0.872616797176149, 51.56015725249727], [-0.872767427555836, 51.560307962534345], [-0.873712440787397, 51.560887112412736], [-0.874019840047307, 51.56105730856152], [-0.874413245272104, 51.56124990894107], [-0.875159636577155, 51.56157807024888], [-0.875469862748955, 51.561692540724444], [-0.875618818634067, 51.561736229028845], [-0.87605776549836, 51.56183754414599], [-0.876366373823489, 51.56190074371407], [-0.87668521195865, 51.561958645316366], [-0.876968369886447, 51.56200091867397], [-0.877197163756339, 51.56202468778881], [-0.877516822654725, 51.5620493254706], [-0.878098847659676, 51.56208186543848], [-0.879220205739232, 51.56212315048378], [-0.879742407250114, 51.562124539056946], [-0.8803196812009, 51.56211566057546], [-0.88047709073344, 51.562109069498774], [-0.880781923890852, 51.5620912956137], [-0.881058065229737, 51.56206695318683], [-0.881262135404653, 51.56204012483733], [-0.881418631531618, 51.562011943580096], [-0.881649213834679, 51.56196288783239], [-0.882003250428868, 51.56187993977645], [-0.882376388095226, 51.56178278572967], [-0.882764299497775, 51.56167138432022], [-0.883194585739291, 51.561537905452155], [-0.883498576630078, 51.5614364931922], [-0.883756281221724, 51.56134003501421], [-0.884086956514705, 51.56120920221847], [-0.884407665982054, 51.56107287871968], [-0.885457870533961, 51.5606602434964], [-0.885606584631741, 51.56059601575753], [-0.88578613479336, 51.56050960117672], [-0.88595858283258, 51.56041862303493], [-0.886091760097573, 51.560340759581955], [-0.886521253482028, 51.56006159461465], [-0.886883345687433, 51.559824949307504], [-0.887389733197074, 51.559468282123994], [-0.887580604245187, 51.55927227271282], [-0.887708691217493, 51.559107139161064], [-0.888191015763102, 51.55861266662589], [-0.888192457957821, 51.55861268028735], [-0.888287760756616, 51.55849039596854], [-0.888562664893145, 51.558278995716826], [-0.888677108662246, 51.55814070717499], [-0.888887527216288, 51.55791161122132], [-0.889030158653071, 51.55774121885465], [-0.889203011709727, 51.557514464273005], [-0.88945350380216, 51.55717964382524], [-0.889600043815338, 51.556967026485395], [-0.889736358446423, 51.55670036168757], [-0.889858423154084, 51.55648571413559], [-0.889957478394766, 51.55626815130874], [-0.88999480235023, 51.556157006507235], [-0.890171676314085, 51.5555274577222], [-0.89040150985715, 51.554855248874496], [-0.891496918227321, 51.55316795557777], [-0.892148150167392, 51.55212836271704], [-0.892302414411729, 51.5517746441604], [-0.892679622502675, 51.55097074336506], [-0.892968782461996, 51.55046633574481], [-0.893655961353766, 51.54930928124159], [-0.894173495307085, 51.548604708475054], [-0.894625223197592, 51.54805597035748], [-0.895275002004698, 51.547308578527485], [-0.895581553072133, 51.54691762432374], [-0.89567259455686, 51.54679079793778], [-0.895853734572665, 51.54651645501248], [-0.896746527292651, 51.54508077321264], [-0.896901839906062, 51.544860136456265], [-0.897255891587921, 51.54494888564188], [-0.898115394177492, 51.545187148067974], [-0.89822539056202, 51.54523044209882], [-0.898280925208036, 51.54525973711452], [-0.898317695099433, 51.54528975512979], [-0.898473190139101, 51.54530020648797], [-0.899619101095523, 51.54544313546729], [-0.901006352145532, 51.54562517973134], [-0.901825064903737, 51.54570208025918], [-0.903152296119515, 51.54586195719927], [-0.903215411109321, 51.54587603470979], [-0.903297183099556, 51.545893883241035], [-0.903017403675823, 51.54655396139701], [-0.902616538461231, 51.54745118838641], [-0.902395351374664, 51.54801290343283], [-0.902224993241029, 51.54837997226972], [-0.902166365216381, 51.54859882282856], [-0.902146545476892, 51.54876318664974], [-0.902208891983797, 51.54892921824649], [-0.902230894835185, 51.549033728477525], [-0.902380735585514, 51.54999904656443], [-0.902673692529055, 51.551610411429984], [-0.902806620567669, 51.55250003963136], [-0.902816651036337, 51.55268266601908], [-0.902804979597758, 51.55292803179951], [-0.902756997764027, 51.55318384821566], [-0.902654701329301, 51.55353896524768], [-0.902427419928527, 51.55423280167036], [-0.901847751389036, 51.555843197130926], [-0.901770133963284, 51.556011515784924], [-0.90172081219273, 51.556082988265544], [-0.902203201151337, 51.55617741874876], [-0.906010818638152, 51.55679743475821], [-0.906204734572883, 51.556771367660915], [-0.906311884484255, 51.55675438267928], [-0.906358975073264, 51.55689599188705], [-0.90638590166065, 51.55691602462513], [-0.906615524939952, 51.55696492104195], [-0.907278267614382, 51.55705831304524], [-0.907858939004531, 51.55720578727805], [-0.908174621569804, 51.5572752632291], [-0.908339760107985, 51.55730647205926], [-0.908420198492941, 51.557320707807335], [-0.908923514869315, 51.557385632424236], [-0.909322889103033, 51.5574540848968], [-0.909506497855653, 51.557497152980005], [-0.909658336207082, 51.557541723987356], [-0.909754316957776, 51.55756959081508], [-0.909871264277585, 51.557625526703404], [-0.91002439519459, 51.55767640345812], [-0.91014009429463, 51.557724234915874], [-0.910363938659539, 51.55783421414451], [-0.910769828656022, 51.55805288423369], [-0.910899633150579, 51.55817457810929], [-0.911134211672749, 51.55843931338367], [-0.911191431662737, 51.558519870694006], [-0.911262279817118, 51.55863382382822], [-0.911345597527786, 51.558829717406], [-0.911347039740573, 51.55882973078292], [-0.911354152248679, 51.55895478193117], [-0.911501156990394, 51.55932300828838], [-0.911744284152759, 51.55977395051585], [-0.911784714781588, 51.55983277167005], [-0.911848028397377, 51.559899897522016], [-0.911951124589094, 51.55999256899618], [-0.912043240814804, 51.56006176008463], [-0.912343203354435, 51.560247072388215], [-0.91252735254784, 51.560389049785144], [-0.912663001694362, 51.56050809825428], [-0.913644040185922, 51.561715780647766], [-0.914729932802775, 51.56149024267299], [-0.915936249212879, 51.561720788632314], [-0.917099342153636, 51.56255696600573], [-0.917716153850379, 51.56209778262442], [-0.918510926061236, 51.561494569835055], [-0.919190082061234, 51.56187308324347], [-0.919265061021478, 51.56187467281339], [-0.919319677161742, 51.561883268238525], [-0.919395565855925, 51.56190734542486], [-0.919450182060758, 51.561915940789575], [-0.919451624375034, 51.56191595406745], [-0.919612764956992, 51.561873377936905], [-0.919684473323871, 51.562134798108005], [-0.919731696029427, 51.56227280618616], [-0.919795125391412, 51.562396576626476], [-0.919877773921036, 51.56250074208832], [-0.920024454979703, 51.56264236275641], [-0.920273793481437, 51.562835281288635], [-0.920455811890565, 51.56300779833283], [-0.92054707457537, 51.56311384087594], [-0.920622684574115, 51.56321074767881], [-0.920768557091237, 51.56344767224896], [-0.920815933327546, 51.56357938704838], [-0.92087756775181, 51.56365728255545], [-0.920897207761338, 51.56368084160506], [-0.920950783915168, 51.5637334861553], [-0.921113636188415, 51.563862665653886], [-0.921195103215065, 51.56395602921301], [-0.921351882125165, 51.56422002842434], [-0.921395592904906, 51.56432383493418], [-0.921420893006769, 51.56441308549212], [-0.921438619701684, 51.56451755238376], [-0.921413985191466, 51.56464410933019], [-0.92167481147157, 51.56453500840272], [-0.923479752756133, 51.56373602685831], [-0.924155377789785, 51.5634113259626], [-0.924873111301507, 51.56399247344971], [-0.924951149378637, 51.56404803772923], [-0.925274524870032, 51.56428388466152], [-0.92664770764064, 51.56515336065692], [-0.927393574791524, 51.56558368874587], [-0.927927453464337, 51.5659491340051], [-0.92835633038721, 51.56599441223158], [-0.928244524844939, 51.56725223174753], [-0.928125342518282, 51.56741209518939], [-0.9281054698832, 51.56745956981058], [-0.927839528670842, 51.568092855254655], [-0.93052584537502, 51.568532778436946], [-0.930434864440691, 51.56872077542371], [-0.930290537945866, 51.568968530677175], [-0.93032458943141, 51.568993118606556], [-0.930407160146686, 51.56904062792432], [-0.930494248489543, 51.56908008580425], [-0.93056005729139, 51.5691040638391], [-0.930644619283805, 51.56912821268005], [-0.930755210497826, 51.569149901051155], [-0.931002865082897, 51.56917193845677], [-0.931506345671459, 51.5692367670135], [-0.9319179887186, 51.56928007686346], [-0.93222706378822, 51.569328746497334], [-0.932389335623021, 51.56936169347699], [-0.932508352034028, 51.56939334769875], [-0.932608510110525, 51.56942932617174], [-0.932871163025979, 51.56955040480943], [-0.933086053531851, 51.569616199317096], [-0.933414865356232, 51.569684826955594], [-0.93386895042082, 51.56976448240679], [-0.934635570791928, 51.5700537823344], [-0.934785550106084, 51.57011898456062], [-0.934985327167408, 51.57021431104797], [-0.935122135234023, 51.5702874858722], [-0.935333952219633, 51.570423383659445], [-0.935683954424458, 51.570697207984594], [-0.935948857561102, 51.57084617434456], [-0.936321009353978, 51.57109861741231], [-0.936776166293208, 51.57138058458356], [-0.936874033955222, 51.57139136186155], [-0.937185388877335, 51.57140497135624], [-0.937358713203379, 51.57139754881963], [-0.937474500211682, 51.571382411871916], [-0.937604964789291, 51.57135661760672], [-0.938082770631526, 51.571224267138255], [-0.938303744516349, 51.57115343316592], [-0.938622419406116, 51.57103852370375], [-0.938583754985448, 51.57127375671787], [-0.938615426417796, 51.5714008261012], [-0.938651384040882, 51.57152973256723], [-0.938810396393867, 51.572013125409214], [-0.938917102284257, 51.5723881447753], [-0.938977920287056, 51.572564931845086], [-0.939147081147104, 51.57298457478389], [-0.93921529881351, 51.57340150695511], [-0.939295227462625, 51.57374930879435], [-0.939359853061118, 51.57401065198471]]]}} diff --git a/benchmarks/json-data/integers.json b/benchmarks/json-data/integers.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/integers.json @@ -0,0 +1,1 @@ +[1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 2, 2, 2, 2, 2, 2, 2, 3, 3, 3, 3, 3, 4, 4, 4, 4, 5, 5, 5, 6, 6, 7, 7, 7, 8, 9, 9, 10, 10, 11, 12, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 23, 24, 26, 27, 29, 31, 33, 35, 37, 39, 42, 44, 47, 50, 53, 56, 60, 63, 67, 72, 76, 81, 86, 91, 96, 102, 109, 115, 122, 130, 138, 146, 155, 165, 175, 186, 197, 209, 222, 236, 250, 266, 282, 299, 318, 337, 358, 380, 403, 428, 454, 482, 511, 543, 576, 611, 649, 688, 730, 775, 823, 873, 926, 983, 1043, 1107, 1175, 1247, 1323, 1404, 1490, 1582, 1679, 1781, 1890, 2006, 2129, 2259, 2398, 2544, 2700, 2865, 3041, 3227, 3425, 3634, 3857, 4093, 4343, 4609, 4891, 5191, 5509, 5846, 6204, 6583, 6986, 7414, 7868, 8349, 8860, 9403, 9978, 10589, 11237, 11925, 12655, 13430, 14252, 15124, 16050, 17032, 18075, 19181, 20355, 21601, 22923, 24326, 25815, 27396, 29072, 30852, 32740, 34744, 36871, 39128, 41523, 44064, 46762, 49624, 52661, 55884, 59305, 62935, 66787, 70875, 75213, 79817, 84702, 89887, 95389, 101227, 107423, 113998, 120976, 128381, 136239, 144578, 153427, 162818, 172784, 183360, 194583, 206493, 219132, 232545, 246778, 261883, 277912, 294923, 312975, 332131, 352460, 374034, 396928, 421223, 447005, 474365, 503400, 534212, 566911, 601610, 638433, 677511, 718980, 762987, 809688, 859247, 911840, 967652, 1026880, 1089734, 1156434, 1227217, 1302333, 1382046, 1466638, 1556408, 1651673, 1752769, 1860052, 1973902, 2094721, 2222934, 2358996, 2503385, 2656613, 2819219, 2991777, 3174898, 3369227, 3575451, 3794297, 4026539, 4272995, 4534536, 4812086, 5106625, 5419191, 5750889, 6102889, 6476435, 6872845, 7293518, 7739939, 8213686, 8716429, 9249944, 9816115, 10416939, 11054539, 11731166, 12449207, 13211198, 14019829, 14877955, 15788605, 16754994, 17780533, 18868844, 20023768, 21249383, 22550016, 23930257, 25394980, 26949356, 28598872, 30349352, 32206975, 34178300, 36270285, 38490317, 40846232, 43346349, 45999492, 48815029, 51802899, 54973651, 58338478, 61909260, 65698602, 69719882, 73987297, 78515911, 83321713, 88421668, 93833782, 99577160, 105672079, 112140056, 119003924, 126287916, 134017747, 142220706, 150925751, 160163614, 169966908, 180370243, 191410345, 203126189, 215559137, 228753081, 242754599, 257613123, 273381107, 290114218, 307871529, 326715729, 346713346, 367934976, 390455540, 414354543, 439716356, 466630515, 495192035, 525501749, 557666661, 591800322, 628023236, 666463282, 707256166, 750545902, 796485316, 845236589, 896971830, 951873682, 1010135966, 1071964368, 1137577163, 1207205986, 1281096650, 1359510014, 1442722903, 1531029087, 1624740315, 1724187420, 1829721484, 1941715077, 2060563573, 2186686548, 2320529259, 2462564214, 2613292844, 2773247272, 2942992191, 3123126858, 3314287206, 3517148098, 3732425698, 3960880011, 4203317554, 4460594215, 4733618266, 5023353573, 5330822998, 5657112012, 6003372524, 6370826950, 6760772526, 7174585891, 7613727944, 8079749004, 8574294281, 9099109685, 9656047991, 10247075377, 10874278366, 11539871197, 12246203633, 12995769265, 13791214310, 14635346955, 15531147272, 16481777734, 17490594386, 18561158687, 19697250088, 20902879371, 22182302812, 23540037202, 24980875800, 26509905246, 28132523526, 29854459026, 31681790754, 33620969802, 35678842122, 37862672691, 40180171161, 42639519077, 45249398761, 48019023960, 50958172379, 54077220194, 57387178688, 60899733121, 64627283986, 68582990784, 72780818484, 77235586822, 81963022620, 86979815309, 92303675844, 97953399235, 103948930895, 110311437058, 117063379497, 124228594829, 131832378662, 139901574895, 148464670491, 157551896043, 167195332496, 177429024407, 188289100133, 199813899374, 212044108527, 225022904322, 238796106249, 253412338321, 268923200725, 285383451995, 302851202324, 321388118716, 341059642687, 361935221296, 384088552321, 407597844432, 432546093294, 459021374572, 487117154867, 516932621682, 548573033590, 582150091830, 617782334651, 655595555791, 695723248569, 738307077168, 783497376747, 831453684183, 882345301285, 936351892486, 993664119121, 1054484312524, 1119027188325, 1187520604468, 1260206365627, 1337341076854, 1419197049486, 1506063262491, 1598246382662, 1696071847252, 1799885012878, 1910052374747, 2026962860500, 2151029203266, 2282689398739, 2422408251457, 2570679015712, 2728025136906, 2895002099486, 3072199387991, 3260242568131, 3459795495242, 3671562657914, 3896291665080, 4134775885316, 4387857247705, 4656429214122, 4941439933460, 5243895588908, 5564863950114, 5905478142772, 6266940648935, 6650527552175, 7057593042589, 7489574197539, 7947996055022, 8434476997558, 8950734465625, 9498591020797, 10079980779998, 10696956243580, 11351695541337, 12046510122031, 12783852913581, 13566326982715, 14396694724673, 15277887615381, 16213016560543, 17205382878181, 18258489953389, 19376055606456, 20562025218016, 21820585657560, 23156180064488, 24573523533875, 26077619762337, 27673778712750, 29367635360200, 31165169585327, 33072727285306, 35097042776985, 37245262571278, 39524970602741, 41944215003394, 44511536515321, 47235998642351, 50127219647252, 53195406507421, 56451390948928, 59906667686130, 63573435001862, 67464637811456, 71594013362620, 75976139732519, 80626487293267, 85561473327514, 90798519986944, 96356115798305, 102253880934088, 108512636478302, 115154477931865, 122202853217119, 129682645456833, 137620260819954, 146043721744222, 154982765864743, 164468950997792, 174535766550465, 185218751749486, 196555621106568, 208586397563259, 221353553785311, 234902162105402, 249280053643550, 264537987166964, 280729828285480, 297912739615178, 316147382581544, 335498131574595, 356033301212013, 377825387512598, 400951323831468, 425492752460545, 451536312853150, 479173947490266, 508503226468250, 539627691953919, 572657223723034, 607708427072674, 644905044476938, 684378392439283, 726267825083707, 770721226121430, 817895530929871, 867957280587026, 921083209817197, 977460870923688, 1037289295911185, 1100779699135317, 1168156222959992, 1239656729054927, 1315533638126921, 1396054821049394, 1481504544536185, 1572184474698156, 1668414742025481, 1770535071555377, 1878905982215138, 1993910059574563, 2115953306501003, 2245466576485316, 2382907094698829, 2528760072151156, 2683540418647385, 2847794560591953] diff --git a/benchmarks/json-data/jp10.json b/benchmarks/json-data/jp10.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/jp10.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":15,"page":1,"completed_in":0.104827,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"} diff --git a/benchmarks/json-data/jp100.json b/benchmarks/json-data/jp100.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/jp100.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:40:04 +0000","from_user":"ChuriSta_gt","id_str":"41190705623732224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3072\u3089\u304c\u306a\u306e\u300c\u3064\u300d\u306f\u3082\u3046Twitter\u306e\u300c\u3064\u300d\u3060\uff01","id":41190705623732224,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"71746558","profile_image_url":"http://a2.twimg.com/profile_images/591641547/wwd_normal.gif","created_at":"Fri, 25 Feb 2011 17:40:02 +0000","from_user":"fuckkilldiestar","id_str":"41190699571494912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u306b\u3057\u3066\u3082Twitter\u3084pixiv\u96e2\u308c\u3092\u3069\u3046\u306b\u304b\u3057\u308d\u674f\u4ec1\u30d6\u30eb\u30de","id":41190699571494912,"from_user_id":71746558,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"131230176","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"proory_bot","id_str":"41190683922546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30ea\u30cd\u30f3\u30dd\u30fc\u30c1 http://bit.ly/btjqlH","id":41190683922546688,"from_user_id":131230176,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://proory.com/" rel="nofollow">proory tems</a>"},{"from_user_id_str":"120359038","profile_image_url":"http://a1.twimg.com/profile_images/946521484/200805161826000_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:58 +0000","from_user":"tukinosuke","id_str":"41190680835391488","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190680835391488,"from_user_id":120359038,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"166512109","profile_image_url":"http://a3.twimg.com/profile_images/1224583217/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:50 +0000","from_user":"yurii1129","id_str":"41190649839620096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u6c17\u4ed8\u3044\u305f\u2026\u307f\u3043\u304f\u3093\u306eTwitter\u540d\u3001\u3084\u307e\u306d\u3084\u3093(\uffe3\u25c7\uffe3;)","id":41190649839620096,"from_user_id":166512109,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"228999619","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:39:49 +0000","from_user":"takami926","id_str":"41190644793745408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7530\u539f\u3055\u3093\u3001\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002WEB\u3082TWITTER\u3082\u62dd\u898b\u3057\u3066\u307e\u3059\u3002\u7530\u539f\u3055\u3093\u304c\u653f\u6cbb\u5bb6\u306b\u306a\u3063\u3066\u3001\u65e5\u672c\u3092\u5909\u3048\u3066\u304f\u3060\u3055\u3044\u3002\u5c16\u95a3\u3001\u5317\u65b9\u554f\u984c\u5171\u306b\u65e5\u672c\u306e\u653f\u6cbb\u306e\u5931\u6557\u3067\u3059\u3002\u8a55\u8ad6\u5bb6\u306f\u8272\u3005\u8a00\u3063\u3066\u307e\u3059\u304c\u3001\u4e2d\u6771\u307b\u3069\u56fd\u6c11\u306e\u71b1\u6c17\u304c\u7121\u304f\u3001\u683c\u5dee\u304c\u3042\u308a\u3001\u4f55\u3082\u5909\u308f\u3089\u306a\u3044\u666f\u6c17\u4f4e\u8ff7\u306e\u65e5\u672c\u306b\u56fd\u6c11\u306f\u8ae6\u3081\u3066\u308b\u3093\u3067\u3059\u3002","id":41190644793745408,"from_user_id":228999619,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"151773701","profile_image_url":"http://a0.twimg.com/profile_images/1213699753/obi_nao_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:44 +0000","from_user":"obi_nao","id_str":"41190622949941248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3060\u3044\u3076\u5e74\u4e0b\u306e\u5f8c\u8f29\u306b\u3001\u30d3\u30b8\u30cd\u30b9\u3084\u308b\u306a\u3089\u771f\u5263\u306bTwitter\u3084\u308c\uff01\u3063\u3066\u6012\u3089\u308c\u305f\u3002\u306a\u306e\u3067\u4eca\u65e5\u304b\u3089\u771f\u5263\u306b\u3064\u3076\u3084\u304f\u3053\u3068\u306b\u3057\u307e\u3059\u3002\u3088\u308d\u3057\u304f\u3067\u3059\u3002","id":41190622949941248,"from_user_id":151773701,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"20817229","profile_image_url":"http://a0.twimg.com/profile_images/1212012721/205_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"allte","id_str":"41190619804082176","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7206\u7b11\u3057\u3066\u547c\u5438\u56f0\u96e3\u3067\u75d9\u6523\u3059\u308b\u5618\u304f\u3093\u304c\u898b\u308c\u308b\u306e\u306fTwitter\u3060\u3051","id":41190619804082176,"from_user_id":20817229,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"166907967","profile_image_url":"http://a2.twimg.com/profile_images/1250526230/___normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:43 +0000","from_user":"NTTYAHOOOOOOOI","id_str":"41190618235412480","metadata":{"result_type":"recent"},"to_user_id":106469594,"text":"@takahirororo \u3066\u304b\u4f55\u3067twitter\u4e0a\u3067\u30a2\u30c9\u30d0\u30a4\u30b9\u3082\u3089\u3063\u3066\u3093\u306d\u3093\uff57","id":41190618235412480,"from_user_id":166907967,"to_user":"takahirororo","geo":null,"iso_language_code":"ja","to_user_id_str":"106469594","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"82581287","profile_image_url":"http://a0.twimg.com/profile_images/774721566/miyaru2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:38 +0000","from_user":"kine_rahchaos","id_str":"41190598132244480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093\u304cTwitter\u59cb\u3081\u305f\u3060\u3068\u2026","id":41190598132244480,"from_user_id":82581287,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"136633905","profile_image_url":"http://a2.twimg.com/profile_images/1247161991/yama_normal.png","created_at":"Fri, 25 Feb 2011 17:39:35 +0000","from_user":"yamachi39","id_str":"41190584706285568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3084\u3063\u3071\u308amixi\u3088\u308atwitter\u306e\u304c\u597d\u304d\u304b\u3082","id":41190584706285568,"from_user_id":136633905,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://jigtwi.jp/?p=1" rel="nofollow">jigtwi</a>"},{"from_user_id_str":"44029295","profile_image_url":"http://a2.twimg.com/profile_images/1112965522/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:32 +0000","from_user":"no2yosee","id_str":"41190572769280000","metadata":{"result_type":"recent"},"to_user_id":97721124,"text":"@hn0345 \u3042\u3001\u500b\u4eba\u7684\u306b\u306f\u4eca\u306ftwitter\u306e\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u306b\u66f8\u3044\u3066\u3042\u308b\u30d6\u30ed\u30b0\u306e\u30e6\u30cb\u30c3\u30c8\u3092\u306e\u3093\u3073\u308a\u3084\u3063\u3066\u307e\u3059w","id":41190572769280000,"from_user_id":44029295,"to_user":"hn0345","geo":null,"iso_language_code":"ja","to_user_id_str":"97721124","source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"149872179","profile_image_url":"http://a0.twimg.com/profile_images/1145770150/Winter11_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:31 +0000","from_user":"xmyyyxx","id_str":"41190566951653376","metadata":{"result_type":"recent"},"to_user_id":95069405,"text":"@rindofu \u653b\u7565\u672c\u3042\u308c\u3070\u3044\u3044\u306e\u306b\u3063\u3066\u601d\u3044\u307e\u3059(T\u03c9T)/~~~ \u79c1\u3082\u76f4\u3057\u305f\u3044\u3068\u3053\u3044\u3063\u3071\u3044\u3060\u3051\u3069\u3001\u3042\u306860\u5e74\u304f\u3089\u3044\u3044\u304d\u3089\u308c\u308b\u306f\u305a\u3060\u3057\u3001\u306e\u3093\u3073\u308a\u76f4\u308c\u3070\u3044\u3044\u306a\u3042 \u304a\u3084\u3059\u307f\u3067\u3059^^\uff01\u308a\u3093\u3055\u3093\u3068twitter\u3067\u4ef2\u826f\u304f\u306a\u308c\u3066\u3088\u304b\u3063\u305f\u3067\u3059\u3063","id":41190566951653376,"from_user_id":149872179,"to_user":"rindofu","geo":null,"iso_language_code":"ja","to_user_id_str":"95069405","source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"105579892","profile_image_url":"http://a0.twimg.com/profile_images/1212950455/love_happy_pink_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"love_happy_pink","id_str":"41190566494601216","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u308c\u898b\u305f\u3044\u306a\u266aRT @kazukt \u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41190566494601216,"from_user_id":105579892,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com/" rel="nofollow">TwitBird iPad</a>"},{"from_user_id_str":"16996368","profile_image_url":"http://a0.twimg.com/profile_images/1198892387/pochi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:30 +0000","from_user":"HyoYoshikawa","id_str":"41190564187611136","metadata":{"result_type":"recent"},"to_user_id":1800565,"text":"@shinichiro_beck \u73fe\u5730\u304b\u3089\u306a\u3089\u826f\u304f\u3066\u4ed6\u306e\u5730\u57df\u304b\u3089\u3060\u4f59\u8a08\u306a\u3089\u3001\u4f55\u306e\u305f\u3081\u306bTwitter\u304c\u3042\u308b\u306e\u304b\u308f\u304b\u3089\u306a\u3044\u3088\u3002\u3044\u307e\u8d77\u304d\u3066\u308b\u3053\u3068\u306e\u8aac\u660e\u3082\u3064\u304b\u306a\u3044\u3002\u30a2\u30eb\u30b8\u30e3\u30b8\u30fc\u30e9\u304c\u4f1d\u3048\u3066\u308b\u3053\u3068\u304c\u5168\u3066\u3058\u3083\u306a\u3044\u3057\u3001\u65e5\u672c\u306eTV\u306f\u4f1d\u3048\u306a\u3044\u3067\u3057\u3087\u3046\u3002\u77e5\u308a\u305f\u304c\u3063\u3066\u308b\u4eba\u3082\u305f\u304f\u3055\u3093\u3044\u308b\u3002","id":41190564187611136,"from_user_id":16996368,"to_user":"shinichiro_beck","geo":null,"iso_language_code":"ja","to_user_id_str":"1800565","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"119070802","profile_image_url":"http://a2.twimg.com/profile_images/1229773005/346d8435099798113a1326e1ba4949ee_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:39:25 +0000","from_user":"takotako726","id_str":"41190545439207424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5\u5c11\u5973\u307e\u3069\u304b\u30de\u30ae\u30ab\u306e\u53cd\u97ff\u304ctwitter\u3067\u306f\u3093\u3071\u306d\u3048\u4ef6\u3002","id":41190545439207424,"from_user_id":119070802,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"165695316","profile_image_url":"http://a1.twimg.com/profile_images/681748782/ring_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:21 +0000","from_user":"pandora_shotbar","id_str":"41190526447390720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30b7\u30e7\u30c3\u30c8\u30d0\u30fc\u3000\u30d1\u30f3\u30c9\u30e9\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u2026\uff5chttp://pandora-twitter.seesaa.net/article/187809936.html","id":41190526447390720,"from_user_id":165695316,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"88862311","profile_image_url":"http://a2.twimg.com/profile_images/1182243698/161113_100001897885617_169366_q_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:16 +0000","from_user":"amebaguide","id_str":"41190504926416896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300e\u30a2\u30e1\u30d6\u30ed\u653b\u7565\u30ac\u30a4\u30c9\u306e\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u300f\u30d6\u30ed\u30b0\u306e\u653b\u7565\u3000\u30c4\u30a4\u30c3\u30bf\u30fc\u306e\u3064\u3076\u3084\u304d\u96c6\uff5chttp://accessup-twitter.seesaa.net/article/187809931.html","id":41190504926416896,"from_user_id":88862311,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.seesaa.jp/" rel="nofollow">SeesaaBlog</a>"},{"from_user_id_str":"186895007","profile_image_url":"http://a2.twimg.com/profile_images/1229610799/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:11 +0000","from_user":"zizikt","id_str":"41190486123356161","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u308c\u306f\u500b\u4eba\u7684\u306b\u306f\u91cd\u5b9d\u3067\u3059\u3002\n\u25c6iPhone&iPad\u5411\u3051Twitter\u30a2\u30d7\u30ea\u300c\u3064\u3044\u3063\u3077\u308b\u300d\u306bEvernote\u3068\u306e\u9023\u643a\u6a5f\u80fd\u3092\u8ffd\u52a0 \nhttp://bit.ly/hPf44u","id":41190486123356161,"from_user_id":186895007,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"132320738","profile_image_url":"http://a3.twimg.com/profile_images/1229760475/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:04 +0000","from_user":"faina_","id_str":"41190453592334336","metadata":{"result_type":"recent"},"to_user_id":167894537,"text":"@gjmorley \u30e2\u30fc\u30ea\u30fc\u3055\u3093\u306e\u7ffb\u8a33\u306e\u8a00\u8449\u306e\u30bb\u30f3\u30b9\u304c\u3059\u304d\u3067\u3059\u3002\u305d\u3057\u3066\u3001Twitter\u3067\u77e5\u308b\u3001\u73fe\u5730\u306e\u4eba\u306e\u76ee\u306e\u529b\u3084\u3001\u60c5\u5831\u3092\u4f1d\u3048\u3066\u304f\u308c\u308b\u7686\u3055\u3093\u306e\u60c5\u71b1\u306b\u611f\u52d5\u3057\u3066\u3044\u307e\u3059\u3002\u611f\u52d5\u3059\u308b\u3063\u3066\u3059\u3054\u3044\u30a8\u30cd\u30eb\u30ae\u30fc\u3067\u3059\uff01\uff01","id":41190453592334336,"from_user_id":132320738,"to_user":"gjmorley","geo":null,"iso_language_code":"ja","to_user_id_str":"167894537","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"24870552","profile_image_url":"http://a3.twimg.com/profile_images/907130634/4_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:03 +0000","from_user":"tana1192","id_str":"41190450480021504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u500b\u4eba\u7684\u306b\u306f\u3001\u30bf\u30b0\u5f3e\u304d\u3059\u308c\u3070\u3044\u3044\uff08\u5f3e\u3051\u308b\u30c4\u30fc\u30eb\u3092\u4f7f\u3063\u3066Twitter\u3092\u3059\u308c\u3070\u3044\u3044\uff09\u3068\u601d\u3046\u3093\u3060\u3051\u3069\u306a\u3042\u3002\u307f\u3093\u306a\u305d\u308c\u306a\u308a\u306bTwitter\u3084\u308b\u4eba\u3060\u3057\u3001\u30c4\u30fc\u30eb\u9078\u3073\u304f\u3089\u3044\u5e45\u3092\u6301\u3063\u3066\u3084\u3063\u3066\u3082\u3002 \u307e\u3042\u3001\u4ffa\u30a2\u30cb\u30e1\u306f\u89b3\u308b\u89b3\u308b\u8a50\u6b3a\u3059\u308b\u3060\u3051\u306e\u4eba\u3060\u304b\u3089\u95a2\u4fc2\u306a\u3044\u3093\u3060\u3051\u3069\u3082\uff57\uff57\u5b9f\u6cc1\u306f\u697d\u3057\u305d\u3046\u306b\u898b\u3048\u308b\u3088\u3002","id":41190450480021504,"from_user_id":24870552,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"58509646","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Fri, 25 Feb 2011 17:39:02 +0000","from_user":"kakuyas","id_str":"41190446663344128","metadata":{"result_type":"recent"},"to_user_id":107076877,"text":"@Dayspool \u6df1\u591c\uff12\uff19\u6642\u304f\u3089\u3044\u307e\u3067\u306f\u6bce\u65e5\u55b6\u696d\u3057\u3066\u308b\u306e\u3067\u3001twitter\u3001\u30e1\u30c3\u30bb\u3001PS3\u306a\u3069\u3067\u3088\u3093\u3067\u3051\u308c\u3002\u3053\u3063\u3061\u304b\u3089\u58f0\u304b\u3051\u308b\u3053\u3068\u3082\u3042\u308b\u304b\u3082\u3060\u304c\uff57","id":41190446663344128,"from_user_id":58509646,"to_user":"Dayspool","geo":null,"iso_language_code":"ja","to_user_id_str":"107076877","source":"<a href="http://cheebow.info/chemt/archives/2007/04/twitterwindowst.html" rel="nofollow">Twit for Windows</a>"},{"from_user_id_str":"149128527","profile_image_url":"http://a2.twimg.com/profile_images/1254922702/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:39:00 +0000","from_user":"uni13yoki","id_str":"41190437087748096","metadata":{"result_type":"recent"},"to_user_id":119468594,"text":"@kuro_wr84 \u304a\u308c\u3068\u304a\u524d\u3067Twitter\u3067\u4f1a\u8a71\u3057\u305f\u3089\u3001\u5927\u5909\u306a\u3053\u3068\u306b\u306a\u308b\u306a","id":41190437087748096,"from_user_id":149128527,"to_user":"kuro_wr84","geo":null,"iso_language_code":"ja","to_user_id_str":"119468594","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"18670595","profile_image_url":"http://a2.twimg.com/profile_images/1250674062/ProfilePhoto_normal.png","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"nyuuuuun","id_str":"41190436450222080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3078\u30fc\u3053\u3093\u306a\u306b\u3088\u304f\u4f3c\u308b\u3053\u3068\u3082\u3042\u308b\u3093\u3060\u30fc\nhttp://twitter.com/Re_44/status/35943233016168448\nhttp://twitter.com/3510_misaka/status/36122114821988352","id":41190436450222080,"from_user_id":18670595,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"96267603","profile_image_url":"http://a3.twimg.com/profile_images/1245253473/DSiLL3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:59 +0000","from_user":"arivis","id_str":"41190433119940608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://twitter.com/#!/arivis/status/40636755380142080 \u306a\u3093\u3064\u3046\u304b\u3053\u308c\u3067\u8d64\u3063\u3066\u306e\u3082\u3061\u3087\u3063\u3068\u3042\u308c\u3063\u3059\u306d\u3002\u305d\u3057\u3066\u4e88\u671f\u3057\u3066\u3044\u305f\u304b\u306e\u3088\u3046\u3060","id":41190433119940608,"from_user_id":96267603,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"148097776","profile_image_url":"http://a3.twimg.com/profile_images/1166904064/broken-heart_normal.png","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"ReajuBreaker_A","id_str":"41190422135058432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u672c\u57a2\u30d5\u30a9\u30ed\u30fc\u3088\u308d\u3057\u304f\u3067\u3059\u2192 http://twitter.com/ReajuBreaker \uff08\uff20\u3060\u3068\u30ea\u30d7\u30e9\u30a4\u304c\u57cb\u307e\u308b\u305f\u3081\u3001URL\u306b\u3057\u3066\u3042\u308a\u307e\u3059\uff09","id":41190422135058432,"from_user_id":148097776,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.twitter.com/ReajuBreaker" rel="nofollow">\u73fe\u5145\u6bba\u3057\u306e\u7121\u4eba\u9023\u545f\uff1c\u30aa\u30fc\u30c8\u30c4\u30a4\u30fc\u30c8\uff1e</a>"},{"from_user_id_str":"59711654","profile_image_url":"http://a2.twimg.com/profile_images/416212928/flowers-06-1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:56 +0000","from_user":"agamo45","id_str":"41190421522546688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41190421522546688,"from_user_id":59711654,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"145311373","profile_image_url":"http://a3.twimg.com/profile_images/1187802576/a_gam_02_normal.png","created_at":"Fri, 25 Feb 2011 17:38:55 +0000","from_user":"nogic1008","id_str":"41190418141937664","metadata":{"result_type":"recent"},"to_user_id":88117317,"text":"@runasoru \u307e\u3042\u5acc\u306a\u3089\u6df1\u591c\u5e2f\u306bTwitter\u898b\u306a\u304d\u3083\u3044\u3044\u3060\u3051\u3067\u3059\u304b\u3089\u306d\u30fc \u30103/19BDM\u30aa\u30d5http://twvt.us/bdoff_kansai\u3011","id":41190418141937664,"from_user_id":145311373,"to_user":"runasoru","geo":null,"iso_language_code":"ja","to_user_id_str":"88117317","source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"195851300","profile_image_url":"http://a2.twimg.com/profile_images/1124572815/be7b4c0a06cb60e8_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:49 +0000","from_user":"LoveLAscrewDoll","id_str":"41190391147540480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @jp_mjp: SCREW TV SHOW Vol.6\u306e\u653e\u9001\u304c\u7121\u4e8b\u306b\u7d42\u4e86\u3044\u305f\u3057\u307e\u3057\u305f\u3002\u3054\u89a7\u9802\u304d\u3042\u308a\u304c\u3068\u3046\u3054\u3056\u3044\u307e\u3057\u305f\uff01\u6b21\u56de\u653e\u9001\u306f3\u670818\u65e5(\u91d1)\u3067\u3059\u3002\u8996\u8074\u8005\u30d7\u30ec\u30bc\u30f3\u30c8\u306e\u8a73\u7d30\u306f\u5f8c\u65e5MJP\u3067\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u3002\u305d\u306e\u969b\u306b\u306f\u3001\u3053\u306eTwitter\u3067\u3082\u304a\u77e5\u3089\u305b\u3044\u305f\u3057\u307e\u3059\u306e\u3067\u3001\u304a\u697d\u3057\u307f\u306b\uff01#SCREWTV","id":41190391147540480,"from_user_id":195851300,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"178045354","profile_image_url":"http://a0.twimg.com/profile_images/1214479381/154722_10100141954893059_808622_55276626_7445050_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"ChuriSta_gt","id_str":"41190389549510656","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u3053\u4e00\u9031\u9593Twitter\u304c\u3084\u305f\u3089\u697d\u3057\u3044\u306e\u3067\u3059\u3051\u3069\u30fc\u30fc\u30fc\uff01\u306b\u3072\u3072\u3063\u7b11","id":41190389549510656,"from_user_id":178045354,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"50592111","profile_image_url":"http://a0.twimg.com/profile_images/1252176582/lFjpi_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:48 +0000","from_user":"crowNeko","id_str":"41190387271864320","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a8\u30ed\u30b2\u30d7\u30ec\u30a4\u3057\u306a\u304c\u3089\u307e\u3069\u30de\u30aeTL\u3092\u898b\u306a\u3044\u3088\u3046\u306b\u534a\u76ee\u306b\u306a\u308a\u306a\u304c\u3089Twitter\u3057\u3066\u308b\u6df1\u591c2\u6642\u534a\u3002","id":41190387271864320,"from_user_id":50592111,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://stone.com/Twittelator" rel="nofollow">Twittelator</a>"},{"from_user_id_str":"7141467","profile_image_url":"http://a3.twimg.com/profile_images/1198540741/icon12912579345276_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:40 +0000","from_user":"hina_geshi","id_str":"41190355961380864","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7d50\u5c40\u30cd\u30bf\u30d0\u30ec\u3059\u3093\u306a\u3063\u3066\u8a00\u3046\u65b9\u304c\u30a2\u30ec\u3060\u3088\u306d\u3001\u3057\u306a\u3044\u308f\u3051\u7121\u3044\u3058\u3083\u306a\u3044\u8133\u5185\u5782\u308c\u6d41\u3057\u304cTwitter\u306a\u3093\u3060\u304b\u3089\u3055","id":41190355961380864,"from_user_id":7141467,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"149608984","profile_image_url":"http://a0.twimg.com/profile_images/1205950885/090702_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"Mr_Tsubaki","id_str":"41190349447774208","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3069\u304b\u306fTwitter\u5408\u308f\u305b\u3066\uff11\u6642\u9593\u306f\u697d\u3057\u3044","id":41190349447774208,"from_user_id":149608984,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"122271550","profile_image_url":"http://a0.twimg.com/profile_images/961936499/neoneko_bot5jpg_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:39 +0000","from_user":"neoneko_bot5","id_str":"41190348726345728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30c6\u30b9\u30c8\uff1a23\u3011\u4eca\u65e5\u304b\u3089\u5ba3\u4f1d\u958b\u59cb\u2606\u306d\u304a\u306d\u3053\u306eTwitter \u3067 EasyBottex\u3000\u3067\u304d\u308b\u307e\u3067\uff01\u2192http://neoneko.blog31.fc2.com/","id":41190348726345728,"from_user_id":122271550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www20.atpages.jp/neoneko/" rel="nofollow">neoneko_bot5</a>"},{"from_user_id_str":"127069188","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:38:37 +0000","from_user":"MYCHEBOT","id_str":"41190340908163074","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30eb\u30d5\u3055\u3093\u304c\u914d\u4fe1\u3092\u7d42\u4e86\u3057\u307e\u3057\u305f\uff01/ http://777labo.com/mychecker/view/745.php / \u30c8\u30d4\u30c3\u30af:XSplit\u30c6\u30b9\u30c8\u3000twitter\u2192http://twitter.com/rukh01","id":41190340908163074,"from_user_id":127069188,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://777labo.com/mychecker/" rel="nofollow">MYCHEBOT</a>"},{"from_user_id_str":"107626142","profile_image_url":"http://a1.twimg.com/profile_images/1104968421/SuperMaika1_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:34 +0000","from_user":"MaikaPaPa","id_str":"41190328614666240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"75\u5e74\u524d\u306e\u4eca\u65e52\u670826\u65e5\u672a\u660e\u3001\u82e5\u304d\u9752\u5e74\u5c06\u6821\u3089\u304c\u653f\u6cbb\u8150\u6557\u3068\u8fb2\u6751\u306e\u56f0\u7aae\u306b\u5bfe\u3057\u3066\u6c7a\u8d77\u3057\u307e\u3057\u305f\u3002\u3082\u3061\u308d\u3093\u5f53\u6642\u306fTwitter\u3082FB\u3082\u3001\u307e\u305f\u5f53\u7136\u306a\u304c\u3089Internet\u3082\u3042\u308a\u307e\u305b\u3093\u3067\u3057\u305f\u3002\u4e00\u65b9\u3001\u30c1\u30e5\u30cb\u30b8\u30a2\u3001\u30a8\u30b8\u30d7\u30c8\u3001\u4e2d\u6771\u306b\u5e83\u304c\u308b\u53cd\u653f\u5e9c\u30c7\u30e2\u3068\u5f37\u6a29\u4f53\u5236\u306e\u5d29\u58ca\u3002\u73fe\u5728\u306e\u65e5\u672c\u3067\u306f\u8003\u3048\u3089\u308c\u306a\u3044\u3053\u3068\u3067\u3059\u3002","id":41190328614666240,"from_user_id":107626142,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"11111695","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"kumatchipooh","id_str":"41190306145775617","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @inosenaoki: \u306a\u308b\u307b\u3069\u306d\u3002 RT @dansrmz @inosenaoki \u3053\u3061\u3089\u304c\u30bd\u30d5\u30c8\u30d0\u30f3\u30af\u526f\u793e\u9577\u306e\u677e\u672c\u5fb9\u4e09\u3055\u3093\u306e\u3001Twitter\u306b\u95a2\u3059\u308b\u8ad6\u8003\u3067\u3059\u3002 \u25b6 "Twitter\u306e2\u30c1\u30e3\u30f3\u30cd\u30eb\u5316\u306f\u9632\u6b62\u51fa\u6765\u308b\u304b" http://t.co/Mwzb8Zf","id":41190306145775617,"from_user_id":11111695,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"212161909","profile_image_url":"http://a1.twimg.com/profile_images/1252895790/natm01_normal.gif","created_at":"Fri, 25 Feb 2011 17:38:28 +0000","from_user":"n34hitman","id_str":"41190303830511616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u30fb\u30d6\u30ed\u30b0\u30a2\u30d5\u30a3\u30ea\u30a8\u30a4\u30c8\u81ea\u52d5\u6295.... http://goo.gl/a4RHB 4054","id":41190303830511616,"from_user_id":212161909,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twibow.net/" rel="nofollow">Twibow</a>"},{"from_user_id_str":"105945593","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:38:24 +0000","from_user":"nakano_bot","id_str":"41190285710983168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3053\u306ebot\u306f\u4e0d\u52d5\u7523\u4f1a\u793e\u69d8\u5411\u3051\u306e\u4e0d\u52d5\u7523\u30dd\u30fc\u30bf\u30eb\u30b5\u30a4\u30c8\u3078\u306e\u4e00\u62ec\u8ee2\u9001\uff0bTwitter\u7121\u6599\u8ee2\u9001\u30b5\u30fc\u30d3\u30b9\u306b\u3088\u308a\u3064\u3076\u3084\u304d\u307e\u3059\u3002\u3054\u5229\u7528\u306b\u306a\u308a\u305f\u3044\u5834\u5408\u306f http://bit.ly/demey0 \u306b\u304a\u6c17\u8efd\u306b\u304a\u554f\u3044\u5408\u308f\u305b\u4e0b\u3055\u3044\u3002","id":41190285710983168,"from_user_id":105945593,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.teramax.jp/aboutus.html" rel="nofollow">tmxbot</a>"},{"from_user_id_str":"170904226","profile_image_url":"http://a2.twimg.com/profile_images/1249020397/1789kb_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:21 +0000","from_user":"1789kb","id_str":"41190274428305408","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3068\u308a\u3042\u3048\u305a\u4eca\u56de\u521d\u3081\u3066\u30ea\u30a2\u30eb\u30bf\u30a4\u30e0\u3067\u898b\u3066\u308f\u304b\u3063\u305f\u306e\u306f\u3001QB\u306f\u5168\u8eab\u304c\u30a2\u30f3\u30d1\u30f3\u30bf\u30a4\u30d7\u3060\u3068\u3044\u3046\u3053\u3068\u3068\u3001\u307e\u3069\u30de\u30ae\u7d42\u4e86\u5f8c\u306eTwitter\u306e\u3056\u308f\u3064\u304d\u304c\u3059\u3054\u3044\u3068\u3044\u3046\u3053\u3068","id":41190274428305408,"from_user_id":170904226,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"166169644","profile_image_url":"http://a1.twimg.com/profile_images/1217017679/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:18 +0000","from_user":"Okkkkkkkkkkun","id_str":"41190262420017152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3063\u3066Twitter\u3067\u3064\u3076\u3084\u304f\u81ea\u5206\u3082\u76f8\u5f53\u5c0f\u3055\u3044\u306a\u3002","id":41190262420017152,"from_user_id":166169644,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"196623456","profile_image_url":"http://a3.twimg.com/profile_images/1219076661/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:06 +0000","from_user":"NoMoneyClub","id_str":"41190213342601216","metadata":{"result_type":"recent"},"to_user_id":195462431,"text":"@yosal15 \nTwitter\u3084\u3063\u3066\u308b\u3089\u3057\u3044\u3002\u3051\u3069\u3001\u898b\u3064\u304b\u3089\u306a\u3044\u3002","id":41190213342601216,"from_user_id":196623456,"to_user":"yosal15","geo":null,"iso_language_code":"ja","to_user_id_str":"195462431","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"126984048","profile_image_url":"http://a3.twimg.com/profile_images/1254579571/zipyaru-20090829-23-0012_normal.png","created_at":"Fri, 25 Feb 2011 17:38:02 +0000","from_user":"minaduki_naduki","id_str":"41190196418584576","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u203b\u30e1\u30fc\u30eb\u3067\u5973\u306e\u5b50\u53e3\u8aac\u304f\u306e\u306b\u5fd9\u3057\u3044\u3093\u3060\u305d\u3046\u3067\u3059\u3000\u307e\u3058\u3058\u3054\u308d RT @yowano_k: \u5fd9\u3057\u304f\u3066\u3082Twitter\u306b\u9854\u3092\u51fa\u3057\u305f\u304f\u306a\u308b\u50d5\u30a7\u2026\u2026","id":41190196418584576,"from_user_id":126984048,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"200568705","profile_image_url":"http://a3.twimg.com/profile_images/1242179765/101230_1355_01_normal.jpg","created_at":"Fri, 25 Feb 2011 17:38:01 +0000","from_user":"hammerstrap","id_str":"41190190428979200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6628\u65e5\u91d1\u66dc\u65e5\u306f\u732e\u8840\u306b\u5f80\u304f\u3002\u4eca\u306e\u50d5\u306e\u4eba\u9593\u3068\u3057\u3066\u306e\u4fa1\u5024\u306f\u3001\u7cbe\u3005\u3053\u306e\u7a0b\u5ea6\u3002\u8179\u304c\u6e1b\u3063\u305f\u3002\u5374\u8aac\u3002twitter\u306e\u767e\u56db\u5341\u6587\u5b57\u306b\u82db\u3005\u3068\u3057\u3066\u3001\u4e00\u3064\u306e\u4eee\u8aac\u306b\u4fe1\u6191\u6027\u3092\u5f97\u308b\u3002\u6226\u6642\u4e0b\u306e\u7d19\u306e\u7d71\u5236\u3068\u3001\u4e2d\u5cf6\u6566\u306e\u6587\u7ae0\u306e\u95a2\u4fc2\u6027\u3002\u73fe\u5728\u30a6\u30a7\u30d6\u30ed\u30b0\u306b\u3001\u7e8f\u3081\u3066\u3044\u308b\u6700\u4e2d\u3002\u8fd1\u65e5\u516c\u958b\u4e88\u5b9a\u3002","id":41190190428979200,"from_user_id":200568705,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164970427","profile_image_url":"http://a0.twimg.com/profile_images/1227176662/9192b021ef85ce9902c28955f86e604b_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:59 +0000","from_user":"syuigetsuIT","id_str":"41190184041197569","metadata":{"result_type":"recent"},"to_user_id":141926331,"text":"@iliad_tga \u30a4\u30ea\u30a2\u30b9\u3055\u3093\u304c\u305d\u306e\u8fba\u7406\u89e3\u306e\u3042\u308b\u3053\u3068\u306f\u5206\u304b\u3063\u3066\u307e\u3059\uff57\u3000\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u306ftwitter\u306e\u6c7a\u5b9a\u7684\u306a\u6b20\u70b9\u3060\u3068\u601d\u3044\u307e\u3059\u306d\u3047\u3002","id":41190184041197569,"from_user_id":164970427,"to_user":"iliad_tga","geo":null,"iso_language_code":"ja","to_user_id_str":"141926331","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94526795","profile_image_url":"http://a0.twimg.com/profile_images/679411954/akb48_in_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:56 +0000","from_user":"akb48_in","id_str":"41190171248431104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"AKB48\u67cf\u6728\u7531\u7d00 \u304a\u75b2\u308c\u69d8\u3002: \n\u3053\u3093\u3070\u3093\u306f(^O^)\uff0f\u266a\n\u3000\n\u3000\n\u3000\n\u4eca\u65e5\u306e\u516c\u6f14\u697d\u3057\u304b\u3063\u305f\u301c\n\u3000\n\u3000\n\u4e45\u3057\u3076\u308a\u3067\u7dca\u5f35\u3057\u305f\u3051\u3069\u3001\u306f\u3058\u3051\u307e\u304f\u3063\u305f\u305c\u3043\uff01\uff01\n\u3000\n\u3000\n\u3000\nMC\u306f\u565b\u307f\u307e\u304f\u308a\u306e\u30c6\u30f3\u30d1\u308a\u307e\u304f... http://bit.ly/ie8bEa akb48 twitter","id":41190171248431104,"from_user_id":94526795,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"222270374","profile_image_url":"http://a3.twimg.com/profile_images/1250946143/P1040062_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:53 +0000","from_user":"chrxpac","id_str":"41190158455943168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671f\u3011Twitter\u306f\uff8a\uff9f\uff7f\uff7a\uff9d\u304b\u3089\u3057\u304b\u3067\u304d\u306a\u3044\u306e\u3067\uff98\uff8c\uff9f\u8fd4\u3057\u304c\u9045\u304f\u306a\u308a\u307e\u3059(\u00b4\u30fb\u03c9\u30fb\uff40)\u3054\u4e86\u627f\u4e0b\u3055\u3044!!","id":41190158455943168,"from_user_id":222270374,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"64009258","profile_image_url":"http://a2.twimg.com/profile_images/1154025023/Mixi___normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:52 +0000","from_user":"Tatsuyuko","id_str":"41190153447944192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4f01\u696d\u304c\u5c31\u6d3b\u751f\u306bFacebook\u3092\u4f7f\u3063\u3066\u7533\u8acb\u305b\u3088\u3068\u3044\u3044\u3001\u4f01\u696d\u304cFacebook\u3092\u4f7f\u3048\u3068\u4f01\u696d\u304c\u8a00\u3063\u3066\u304d\u305f\u308a\u3059\u308c\u3070\u305d\u308c\u3069\u3053\u308d\u3058\u3083\u306a\u3044\u304b\u3068\u3002\u5c11\u306a\u304f\u3068\u3082\u5c31\u6d3b\u3067Twitter\u306e\u8a00\u52d5\u3084\u30d5\u30a9\u30ed\u30ef\u30fc\u3092\u8abf\u67fb\u3059\u308b\u4f01\u696d\u306f\u304b\u306a\u308a\u591a\u3044\u3067\u3059 RT @Isshee: \u4f01\u696d\u3067\u3082\u540c\u3058\u3067\u3057\u3087 RT","id":41190153447944192,"from_user_id":64009258,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"105145175","profile_image_url":"http://static.twitter.com/images/default_profile_normal.png","created_at":"Fri, 25 Feb 2011 17:37:49 +0000","from_user":"snao813","id_str":"41190141703753728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @yumisaiki: \u795e\u69d8\u306f\u672c\u5f53\u306b\u4eba\u9593\u3092\u3059\u3070\u3089\u3057\u3044\u30d0\u30e9\u30f3\u30b9\u3067\u914d\u7f6e\u3057\u3066\u304a\u3089\u308c\u308b\u3002\u795d\u5cf6\u307f\u305f\u3044\u306a\u5c0f\u3055\u3044\u3068\u3053\u308d\u306b\u306a\u3093\u3067\u3053\u3093\u306a\u306b\u7acb\u6d3e\u306a\u4eba\u304c\u305f\u304f\u3055\u3093\u3044\u308b\u3093\u3060\u308d\u3046\u3002\u795e\u69d8\u3042\u308a\u304c\u3068\u3046\u3002\u672c\u5f53\u306b\u3042\u308a\u304c\u3068\u3046\u3002\u4eba\u9593\u3063\u3066\u3059\u3070\u3089\u3057\u3044\u3068\u601d\u3048\u305f\u3002twitter\u3082\u3042\u308a\u304c\u3068\u3046\u3002\u3000#kaminoseki","id":41190141703753728,"from_user_id":105145175,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://seesmic.com/seesmic_desktop/sd2" rel="nofollow">Seesmic Desktop</a>"},{"from_user_id_str":"203667204","profile_image_url":"http://a2.twimg.com/profile_images/1254664000/eve_blackcat_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:46 +0000","from_user":"eve_blackcat","id_str":"41190129292943361","metadata":{"result_type":"recent"},"to_user_id":146894340,"text":"@kuroiso02 \u3057\u308a\u3068\u308a\u3068\u304b\uff1f\n\u2026\u3067\u3082Twitter\u3060\u3068\u7d42\u308f\u3089\u306a\u304f\u306a\u308b\u30b1\u30c9\u2026","id":41190129292943361,"from_user_id":203667204,"to_user":"kuroiso02","geo":null,"iso_language_code":"ja","to_user_id_str":"146894340","source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"6528403","profile_image_url":"http://a0.twimg.com/profile_images/1240591244/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:45 +0000","from_user":"sortiee","id_str":"41190125924917248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30cb\u30e1\u5b9f\u6cc1\u306ftwitter\u306e\u764c","id":41190125924917248,"from_user_id":6528403,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/peraperaprv/Home" rel="nofollow">P3:PeraPeraPrv</a>"},{"from_user_id_str":"186058304","profile_image_url":"http://a0.twimg.com/profile_images/1250454564/IMG_0210_normal.JPG","created_at":"Fri, 25 Feb 2011 17:37:37 +0000","from_user":"00o8o00","id_str":"41190090386448384","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41190090386448384,"from_user_id":186058304,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49219631","profile_image_url":"http://a2.twimg.com/profile_images/1231873117/__2-colornow__2__normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:33 +0000","from_user":"irisgazer","id_str":"41190073227550720","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3059\u3088\u306d\u3047 RT @minamitaiheiyou: \u6545\u306b\u30cd\u30bf\u30d0\u30ec\u3092\u3059\u308b\u306e\u3082\u81ea\u7531\u3002\u30cd\u30bf\u3070\u308c\u3057\u305f\u4eba\u3092\u30c7\u30a3\u30b9\u308b\u306e\u3082\u81ea\u7531\u3002\u3042\u3068\u306f\u5404\u3005\u306e\u88c1\u91cf\u3067\u4e57\u308a\u5207\u3063\u3066\u304f\u3060\u3055\u3044\u3088\u3081\u3093\u3069\u304f\u3055\u3044\u306a RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41190073227550720,"from_user_id":49219631,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"98560114","profile_image_url":"http://a0.twimg.com/profile_images/1252332545/IMGP8170_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:32 +0000","from_user":"qess0093","id_str":"41190070706905088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30b7\u30e5\u30fc\u30c6\u30a3\u304f\u305d\u3046\u305c\u3048\uff57 RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41190070706905088,"from_user_id":98560114,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:37:31 +0000","from_user":"SyokoShiratori","id_str":"41190064243478528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.50kg \u540c\u3058\u304f\u30c0\u30a4\u30a8\u30c3\u30c8\u4e2d\u3067\u3059\u3002\u3088\u304f\u3053\u306e\u30b5\u30a4\u30c8\u3067\u4f53\u91cd\u5831\u544a\u3057\u3066\u307e\u3059\u266a http://bit.ly/fhN2fM RT @msophiah \u3046\u3046\u3046\u30fb\u30fb\u30fb\u304a\u8179\u3059\u3044\u305f\u301c\u30fb\u30fb\u30fb\u6211\u6162\u3001\u6211\u6162\u3001\u6211\u6162\u3002\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3001\u30c0\u30a4\u30a8\u30c3\u30c8\u3002","id":41190064243478528,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"180410237","profile_image_url":"http://a3.twimg.com/profile_images/1254473979/icon_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:30 +0000","from_user":"ka_ph","id_str":"41190062184079360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u5b9a\u671fpost\u3011\u30d5\u30a7\u30eb\u30c7\u30a3\u30ca\u30f3\u30c8bot( http://twitter.com/ferdinand_bot )\u4f5c\u308a\u307e\u3057\u305f\u3002\u304a\u5b50\u69d8\u306e\u540d\u524d\u304a\u501f\u308a\u3055\u305b\u3066\u304f\u308c\u308b\u65b9\u3044\u307e\u3057\u305f\u3089@ka_ph\u307e\u3067\u304a\u9858\u3044\u3057\u307e\u3059\u3002","id":41190062184079360,"from_user_id":180410237,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"52283906","profile_image_url":"http://a3.twimg.com/profile_images/387644016/10100654519_s_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"rolling_bean","id_str":"41190043313913856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3081\u307e\u3044\u304c\u3057\u307e\u3059\u306d\u301cRT @yurikalin:\u30b3\u30a4\u30c4\u30e9\u5168\u54e1\u3044\u306a\u304f\u306a\u3063\u305f\u3089\u3001\u660e\u308b\u304f\u306a\u308b\u3060\u308d\u3046\u306a\u3041\uff5e\u266a\uff1e\u65e5\u672c\u306e\u30d3\u30b8\u30e7\u30f3 RT roll \u65e5\u7d4c\uff06CSIS\u30b7\u30f3\u30dd\u30b8\u30a6\u30e0\u300c\u5b89\u4fdd\u6539\u5b9a50\u5468\u5e74\u3001\u3069\u3046\u306a\u308b\u65e5\u7c73\u95a2\u4fc2\u300d http://bit.ly/dES8PY\u3000http://bit.ly/ihg0GT","id":41190043313913856,"from_user_id":52283906,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tabtter.jp" rel="nofollow">\u30bf\u30d6\u30c3\u30bf\u30fc</a>"},{"from_user_id_str":"351896","profile_image_url":"http://a3.twimg.com/profile_images/1179865336/icon12911887173020_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:26 +0000","from_user":"cicada","id_str":"41190043292925952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4e2d\u5b66\u53d7\u9a13\u7a0b\u5ea6\u306e\u7b97\u6570\u306e\u554f\u984c\u3092\u51fa\u3059BOT http://twitter.com/arithmetic_bot \u6c17\u306b\u306f\u306a\u308b\u304c\u3001\u3061\u3083\u3093\u3068\u898b\u308b\u65e5\u304c\u6765\u308b\u3060\u308d\u3046\u304b\u30fb\u30fb\u3000#tearai\uff1a\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c http://locolabo.com/mz/ #mzlf","id":41190043292925952,"from_user_id":351896,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://locolabo.com/mz/" rel="nofollow">\u30ed\u30b3\u30e9\u30dc\u5bae\u5d0e\u770c</a>"},{"from_user_id_str":"744554","profile_image_url":"http://a1.twimg.com/profile_images/1088753125/11868894_normal.gif","created_at":"Fri, 25 Feb 2011 17:37:20 +0000","from_user":"Febreze","id_str":"41190019020505088","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u3042\u307e\u308a\u6c17\u306b\u3057\u306a\u3044\u30bf\u30a4\u30d7\u3060\u3051\u3069\u306a\u3093\u304b\u3053\u3046Twitter\u958b\u304f\u3060\u3051\u3067\u30ac\u30f3\u30ac\u30f3\u30cd\u30bf\u30d0\u30ec\u5165\u3063\u3066\u304f\u308b\u306e\u306f\u306a\u3093\u3068\u3082\u8a00\u3048\u306a\u3044\u306a\u3002","id":41190019020505088,"from_user_id":744554,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"203371794","profile_image_url":"http://a1.twimg.com/profile_images/1226537594/___normal.png","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"himeko24","id_str":"41190004139114496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b21\u3044\u3063\u3066\u307f\u3088\u30fc\u3000\u306f\u3044\u3053\u308c\u3000 \u6fc0\u5b89\u26052010\u5e74\u590f\u65b0\u30c7\u30b6\u30a4\u30f3\u2605\u30bb\u30af\u30b7\u30fc\u306a\u9023\u4f53\u5f0f\u7121\u5730\u6c34\u7740 \u80f8\u30d1\u30c3\u30c9\u4ed8\u304dQ122 http://bit.ly/h72C4i","id":41190004139114496,"from_user_id":203371794,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.google.co.jp" rel="nofollow">himeko24</a>"},{"from_user_id_str":"119988932","profile_image_url":"http://a3.twimg.com/profile_images/1214344633/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:16 +0000","from_user":"7na_love_6sa","id_str":"41190002000007169","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0\u3057\u307e\u3057\u305f\uff01Twitter\uff06mixi\u304b\u3089\u3082\u30b3\u30e1\u30f3\u30c8\u5b9c\u3057\u304f\u306d\u266a\n\u300c\u30cd\u30a4\u30eb\u30c1\u30a7\u30f3\u30b8\u266a\u300d http://amba.to/hy0Do2","id":41190002000007169,"from_user_id":119988932,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217408835","profile_image_url":"http://a1.twimg.com/profile_images/1215428655/____4.0157_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"nikubenki1123","id_str":"41189985424125952","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189985424125952,"from_user_id":217408835,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"139137996","profile_image_url":"http://a0.twimg.com/profile_images/1087408006/cut_work_18_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:12 +0000","from_user":"fujiokayouko","id_str":"41189984354566144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u591c\u4e2d\u306bTwitter\u3092\u306a\u3093\u3068\u306a\u304f\u8997\u3044\u305f\u3089\u3082\u306e\u3059\u3054\u3044\u307e\u3069\u30de\u30aeTL\u3067","id":41189984354566144,"from_user_id":139137996,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Mobile Web</a>"},{"from_user_id_str":"61221002","profile_image_url":"http://a3.twimg.com/profile_images/554916301/_1259757374_61_normal.png","created_at":"Fri, 25 Feb 2011 17:37:08 +0000","from_user":"hiromk63","id_str":"41189970613903360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kenji_kohashi \u7121\u4e8b\u6620\u753b\u88fd\u4f5c\u306e\u5831\u544a\u306f\u3067\u304d\u305f\u3051\u3069\u4eca\u3060\u7de8\u96c6\u306f\u7d9a\u3044\u3066\u307e\u3059w \u305d\u3093\u306a\u3068\u3053\u3067 \u6620\u753b\u300cDON'T STOP!\u300d\u306eTwitter \u30a2\u30ab\u30a6\u30f3\u30c8 @DONTSTOPMOVIE \u3082\u958b\u59cb\u3001\u3082\u3057\u826f\u304b\u3063\u305f\u3089\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u304f\u3060\u3055\u3044\uff01\u50d5\u3082\u542b\u3081\u6620\u753b\u88fd\u4f5c\u95a2\u4fc2\u8005\u304c\u6c17\u9577\u306b\u3064\u3076\u3084\u304d\u307e\u3059","id":41189970613903360,"from_user_id":61221002,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147393812","profile_image_url":"http://a1.twimg.com/profile_images/1114001122/hana_10_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"tubasa_uki","id_str":"41189965924667392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff10\uff10\uff17\u3082\u3073\u3063\u304f\u308a\u3000\u5927\u56fd\u306e\u5927\u7d71\u9818\u9078\u304b\u3089\u3000\u5cf6\u56fd\u306e\u5730\u65b9\u9078\u306e\u9078\u6319\u307e\u3067\u306b\u3082\u3000\u6697\u8e8d\u3057\u3066\u3044\u308b\uff3e\uff3e\u3000\u3053\u306eTwitter \u30b9\u30ad\u30e3\u30f3\u30c0\u30eb\u3084\u60aa\u8cea\u306a\u4e8b\u4ef6\u306b\u3082\u7d61\u3080\u304c\u3000Twitter\u304b\u3089\u767a\u4fe1\u3055\u308c\u305f\u3000\u5e73\u548c\u3078\u306e\u8ca2\u732e\u306f\u3000\u307e\u3055\u306b\u30ce\u30fc\u3079\u30eb\u5e73\u548c\u8cde\u3082\u306e http://bit.ly/esjWDG #dotubo_ss","id":41189965924667392,"from_user_id":147393812,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"96081746","profile_image_url":"http://a0.twimg.com/profile_images/1244505419/illust832_normal.png","created_at":"Fri, 25 Feb 2011 17:37:07 +0000","from_user":"kazukt","id_str":"41189963131387904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308b\u304a\u307c\u7d75\u3001\u4ed6\u306e\u4eba\u306e\u3082\u898b\u3066\u3044\u305f\u3089\u3084\u305f\u3089\u30de\u30f3\u30ac\u306e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u3067\u3080\u3061\u3083\u304f\u3061\u3083\u4e0a\u624b\u3044\u4eba\u304c\uff01\u2026\u3068\u3001\u30d7\u30ed\u30d5\u30a3\u30fc\u30eb\u898b\u305f\u3089\u3001\u306a\u3093\u3068\u3054\u672c\u4eba\u304c\u66f8\u3044\u3066\u3044\u3089\u3063\u3057\u3083\u3063\u305f\u3002Twitter\u3063\u3066\u30b9\u30b4\u30a4\u308f\u3002","id":41189963131387904,"from_user_id":96081746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"86306230","profile_image_url":"http://a1.twimg.com/profile_images/593004766/j2j_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:03 +0000","from_user":"excite_j2j","id_str":"41189949927596032","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u79c1\u306f\u3001\u65e9\u7a32\u7530\u5927\u5b66\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u306e\u5b66\u751f\u306e\u8003\u3048\u3066\u3044\u308b\u3001\u5352\u696d\u751fSoudai /\u65e9\u7a32\u7530\u30ab\u30fc\u30c9\u4f1a\u54e1/ Soudai\u5b66\u751f\u89aa/\u3001\u8ab0\u304b\u304c\u30aa\u30fc\u30d7\u30f3\u30ab\u30ec\u30c3\u30b8\u65e9\u7a32\u7530\u5927\u5b662000\u5186\u306e\u5165\u5834\u6599\u306e\u30e1\u30f3\u30d0\u30fc\u3092\u7d39\u4ecb\u3057\u3066\u304f\u308c\u305f\u65b9\u304c\u305a\u3063\u3068\u5b89\u4e0a\u304c\u308a\u3060\u3002 (\u5143\u767a\u8a00 http://bit.ly/esxiwT )","id":41189949927596032,"from_user_id":86306230,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://d.hatena.ne.jp/fn7" rel="nofollow">\u65e5\u672c\u8a9e\u65e5\u672c\u8a9e\u7ffb\u8a33\u30b8\u30a7\u30cd\u30ec\u30fc\u30bf</a>"},{"from_user_id_str":"120927161","profile_image_url":"http://a0.twimg.com/profile_images/1230006483/20110131_13022_26776_normal.jpg","created_at":"Fri, 25 Feb 2011 17:37:00 +0000","from_user":"FRISKFOSSILFANG","id_str":"41189933855158272","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189933855158272,"from_user_id":120927161,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"228973151","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:59 +0000","from_user":"daisuke1589","id_str":"41189931887890432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u3063\u3066\u52dd\u624b\u306b\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u3082\u3044\u3044\u3093\u3060\u3063\u3051\uff1f","id":41189931887890432,"from_user_id":228973151,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"54314110","profile_image_url":"http://a2.twimg.com/profile_images/1193541240/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:57 +0000","from_user":"Alohazuki","id_str":"41189922668953600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u306e\u5e83\u5cf6\u5f01\u3082\u3042\u3063\u305f\u3093\u3060\u306d\u3002","id":41189922668953600,"from_user_id":54314110,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"72594681","profile_image_url":"http://a3.twimg.com/profile_images/1227240916/____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:56 +0000","from_user":"uri4ichi","id_str":"41189916922744832","metadata":{"result_type":"recent"},"to_user_id":226852303,"text":"@7_fuka Twitter\u304b\u3076\u308c\u306f\u3001\u3059\u3050\u306bD\u306b\u8d70\u308b\u306e\u3067\u3002\u306a\u3093\u3060\u304b\u5fae\u7b11\u307e\u3057\u3044\u306e\u3067\u3059( \u2579\u25e1\u2579)","id":41189916922744832,"from_user_id":72594681,"to_user":"7_fuka","geo":null,"iso_language_code":"ja","to_user_id_str":"226852303","source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"168393854","profile_image_url":"http://a3.twimg.com/profile_images/1253554518/GuNp3xVS_normal","created_at":"Fri, 25 Feb 2011 17:36:55 +0000","from_user":"makonyanhime","id_str":"41189913701515264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6589\u85e4\u3055\u3093\u3082\u30c0\u30e1\u3060...\u4eca\u591c\u306fTwitter\u5909\u3060\u306a\u3041(;_;)","id":41189913701515264,"from_user_id":168393854,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122636787","profile_image_url":"http://a2.twimg.com/profile_images/1189607563/DSC01987_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:54 +0000","from_user":"enpy1217","id_str":"41189908500594688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter\u4e45\u3057\u3076\u308a\u306b\u958b\u3044\u305f\u3002\u3068\u3066\u3082\u591a\u5fd9\u3060\u3063\u305f\u3002\u75b2\u308c\u305f\u3002\u304a\u98a8\u5442\u306b\u3082\u5165\u308c\u306a\u304b\u3063\u305f\u3002\u30ad\u30bf\u30cd\u2026","id":41189908500594688,"from_user_id":122636787,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.flight.co.jp/iPhone/TweetMe/" rel="nofollow">TweetMe for iPhone</a>"},{"from_user_id_str":"81663694","profile_image_url":"http://a3.twimg.com/profile_images/1177576126/__normal.png","created_at":"Fri, 25 Feb 2011 17:36:51 +0000","from_user":"progmiya","id_str":"41189895494049792","metadata":{"result_type":"recent"},"to_user_id":94050844,"text":"@hirasai_skyhigh \u6674\u308c\u541b\u3002\u30cd\u30bf\u30d0\u30ec\u306f\u898b\u305f\u304f\u306a\u3044\u3051\u3069\u30012ch\u3082twitter\u3082\u3084\u308a\u305f\u3044\u306e\u304c\u4eba\u3068\u8a00\u3046\u3082\u306e\u3088","id":41189895494049792,"from_user_id":81663694,"to_user":"hirasai_skyhigh","geo":null,"iso_language_code":"ja","to_user_id_str":"94050844","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"159237469","profile_image_url":"http://a3.twimg.com/profile_images/1140433484/______2_normal.png","created_at":"Fri, 25 Feb 2011 17:36:50 +0000","from_user":"hikari_juku","id_str":"41189892096532480","metadata":{"result_type":"recent"},"to_user_id":135634241,"text":"@sssukimasuky \n\u4f55\u304b\u3042\u3063\u305f\u98a8\u3067\u3059\u306d\uff08\u7b11\uff09\u3000\u78ba\u304b\u306bTwitter\u306f\u6c17\u8efd\u3067\u3059\u3057\u306d\u3002\u30e1\u30fc\u30eb\u306b\u306a\u308b\u3068\u30d5\u30c3\u30c8\u30ef\u30fc\u30af\u304c\u91cd\u304f\u306a\u308b\u5834\u5408\u3082\u3042\u308b\u304b\u3082\u3057\u308c\u307e\u305b\u3093\u306d\u3002\u305d\u3046\u8003\u3048\u308b\u3068\u3059\u3054\u3044\u6642\u4ee3\u3060\u3002","id":41189892096532480,"from_user_id":159237469,"to_user":"sssukimasuky","geo":null,"iso_language_code":"ja","to_user_id_str":"135634241","source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"141915990","profile_image_url":"http://a0.twimg.com/profile_images/1248969898/icon679566266564378764images_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:48 +0000","from_user":"adashino_","id_str":"41189886878949376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189886878949376,"from_user_id":141915990,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"111308629","profile_image_url":"http://a1.twimg.com/profile_images/1137421845/mmooton_normal.png","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"mmooton","id_str":"41189877940748288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @minponjp: \u3010\u3064\u3076\u3084\u304f\u3060\u3051\u306710000\u5186\u5546\u54c1\u5238GET\u3011<<visa\u30ae\u30d5\u30c8\u30ab\u30fc\u30c910000\u5186\u5206\u3092\u6bce\u6708\u62bd\u9078\u3067\u30d7\u30ec\u30bc\u30f3\u30c8>> \u21d2\u8a73\u3057\u304f\u306f\u4e0b\u306e\uff35\uff32\uff2c\u3088\u308a\u2193\u2193\u2193\u2193\u2193 http://minpon.jp/user_data/twitter_campaign.php","id":41189877940748288,"from_user_id":111308629,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"140945098","profile_image_url":"http://a0.twimg.com/profile_images/1198948281/b7664c71-87bc-4187-9d46-a61ab8d41b96_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:46 +0000","from_user":"waruimayuko","id_str":"41189877122867200","metadata":{"result_type":"recent"},"to_user_id":113371008,"text":"@toumeisyoujyo \u3042\u3053\u3061\u3083\u3093Twitter\u3084\u3063\u3066\u305f\u306e\u306d\u3002\u307e\u3060\u304a\u5e2d\u3042\u308b\u305d\u3046\u306a\u306e\u3067\u662f\u975e\uff01","id":41189877122867200,"from_user_id":140945098,"to_user":"toumeisyoujyo","geo":null,"iso_language_code":"ja","to_user_id_str":"113371008","source":"<a href="http://twimi.jp/?r=via" rel="nofollow">twimi\u2606new</a>"},{"from_user_id_str":"167512527","profile_image_url":"http://a1.twimg.com/profile_images/1172286365/newspaper_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"KoranKaget","id_str":"41189871775252480","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://bit.ly/93Eeud RT @motocentrism \u30d6\u30ed\u30b0\u8a18\u4e8b\u66f8\u304d\u307e\u3057\u305f\u30fc\uff1a MotoGP\u3000\u30d6\u30c3\u30af\u30e1\u30fc\u30ab\u30fc\u306b\u898b\u308b\u5404\u30e9\u30a4\u30c0\u30fc\u306e\u4e0b\u99ac\u8a55 - http://goo.gl/xVe6... http://bit.ly/hDYxyx @motogpudpate","id":41189871775252480,"from_user_id":167512527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"160251772","profile_image_url":"http://a3.twimg.com/profile_images/1150692471/_____normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:45 +0000","from_user":"keikochaki","id_str":"41189870781075456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u305a\u3063\u3068twitter\u3084\u3063\u3066\u308b\u3088\u306d\u300d\u3068\u6012\u3089\u308c\u3066\u3057\u307e\u3063\u305f(\u82e6\u7b11)","id":41189870781075456,"from_user_id":160251772,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"211565766","profile_image_url":"http://a2.twimg.com/sticky/default_profile_images/default_profile_5_normal.png","created_at":"Fri, 25 Feb 2011 17:36:42 +0000","from_user":"sayap1yo","id_str":"41189858236043264","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u98df\u4e8b\u4f1a\u884c\u304d\u305f\u304b\u3063\u305f\u3051\u3069\n\u53cb\u9054\u3068\u904a\u3093\u3067\u307e\u3093\u305f\ue056\ue326\n\nTwitter\u898b\u3066\u307e\u3057\u305f\u3051\u3069\n\u3064\u3076\u3084\u304f\u30bf\u30a4\u30df\u30f3\u30b0\n\u5931\u3063\u3066\u305f\u3060\u3051\u3067\u3059( \u00b4 \u25bd ` )\uff89\u7b11","id":41189858236043264,"from_user_id":211565766,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.nibirutech.com" rel="nofollow">TwitBird</a>"},{"from_user_id_str":"19603191","profile_image_url":"http://a1.twimg.com/profile_images/1254077264/116_normal.gif","created_at":"Fri, 25 Feb 2011 17:36:40 +0000","from_user":"Purple_Flash","id_str":"41189851873157120","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @syu_thi_bot: \u3044\u3064\u307e\u3067Twitter\u3084\u3063\u3066\u308b\u3093\u3060\u3044\uff1f\u3044\u3044\u52a0\u6e1b\u73fe\u5b9f\u306b\u623b\u308a\u306a\u3088\u3002\u3053\u3053\u306f\u30ad\u30df\u305f\u3061\u4e09\u6b21\u5143\u306e\u4eba\u9593\u304c\u3044\u308b\u3079\u304d\u5834\u6240\u3058\u3083\u306a\u3044\u3093\u3060\u3088\u3002\u305d\u3093\u306a\u306e\u57fa\u672c\u3060\u308d\uff01\uff01","id":41189851873157120,"from_user_id":19603191,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"215930291","profile_image_url":"http://a0.twimg.com/profile_images/1247906106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"minori_millie","id_str":"41189810055938048","metadata":{"result_type":"recent"},"to_user_id":212972774,"text":"@c_c_chika \u7b11\u3063\u3066\u305d\u3046\u3060\u306a\u3063\u3066\u601d\u3063\u3066\u305f(o^^o)\u30c1\u30ab\u306e\u7b11\u3044\u58f0\u304c\u805e\u3053\u3048\u3066\u304d\u305f\u3082\u3093\u3002mail\u306bTwitter\u3067\u5927\u5fd9\u3057\u3084\u3002","id":41189810055938048,"from_user_id":215930291,"to_user":"c_c_chika","geo":null,"iso_language_code":"ja","to_user_id_str":"212972774","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"197459334","profile_image_url":"http://a3.twimg.com/profile_images/1210698414/shiratorishoko_normal.png","created_at":"Fri, 25 Feb 2011 17:36:30 +0000","from_user":"SyokoShiratori","id_str":"41189809586311168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"+0.90kg \u30c0\u30a4\u30a8\u30c3\u30c8\u5fdc\u63f4\u3057\u3066\u307e\u3059\u3002(*^^*)\u30c0\u30a4\u30a8\u30c3\u30c8\u4f53\u91cd\u5831\u544a\u306e\u3064\u3076\u3084\u304d\u3067\u3059\u3002 http://bit.ly/fhN2fM RT @hayayumi \u3053\u3093\u306a\u6642\u9593\u306b\u3084\u304d\u306b\u304f\u30fc\u266b\u30c0\u30a4\u30a8\u30c3\u30c8\u671f\u9593\u306a\u306e\u306b\u306d....","id":41189809586311168,"from_user_id":197459334,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mob-mc.com" rel="nofollow">\uff08\u4eee\u79f0\uff09\u30c4\u30a4\u30af\u30ea\u30c3\u30af twiclick</a>"},{"from_user_id_str":"12337665","profile_image_url":"http://a0.twimg.com/profile_images/1146194926/pixiv-icon_normal.png","created_at":"Fri, 25 Feb 2011 17:36:27 +0000","from_user":"t_a_k_i","id_str":"41189797364121600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Google\u30ea\u30fc\u30c0\u30fc\u3067\u30b5\u30a4\u30c8\u306e\u66f4\u65b0\u30c1\u30a7\u30c3\u30af\u3059\u308b\u3088\u308a\u3001Twitter\u30a2\u30ab\u30a6\u30f3\u30c8\u3092\u30d5\u30a9\u30ed\u30fc\u3057\u3066\u66f4\u65b0\u3092\u77e5\u308b\u307b\u3046\u304c\u4fbf\u5229\u3060\u306a\u3053\u308c","id":41189797364121600,"from_user_id":12337665,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"104862453","profile_image_url":"http://a3.twimg.com/profile_images/1248609864/Image014_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:25 +0000","from_user":"yuz_ume","id_str":"41189787943714816","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @fuefukioyasumi: \u3082\u3046\u3044\u3044\u3002\u300c\u671d\u751f\u300d\u306a\u3093\u304b\u3044\u3044\u3002BBC\u3082CNN\u3082\u82f1\u8a9e\u653e\u9001\u3060\u3002\u307f\u3093\u306a\u3001\u30c6\u30ec\u30d3\u3092\u3076\u3061\u3063\u3068\u5207\u3063\u3066Twitter\u3092\u898b\u3088\u3046\u3002\u3053\u3053\u306b\u300c\u751f\u304d\u305f\u60c5\u5831\u300d\u304c\u6d41\u308c\u3066\u3044\u308b\u3002\u300c\u751f\u304d\u305f\u53eb\u3073\u300d\u304c\u3042\u308b\u3002\u3053\u3053\u304b\u3089\u3067\u3082\u6b74\u53f2\u306e\u8ee2\u63db\u70b9\u3092\u611f\u3058\u308b\u4e8b\u304c\u3067\u304d\u308b\u306e\u3060\u3002 @gjmorley #libjp","id":41189787943714816,"from_user_id":104862453,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"213846746","profile_image_url":"http://a1.twimg.com/profile_images/1242263342/haruhi1_normal.png","created_at":"Fri, 25 Feb 2011 17:36:23 +0000","from_user":"sloth888jpgame","id_str":"41189778409922560","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u643a\u5e2f\u96fb\u8a71\u7528\u306eTwitter\u3092\u5229\u7528\u3057\u305f\u30b2\u30fc\u30e0\u3092\u77e5\u3063\u3066\u3044\u308b\u4eba\u306f\u3001\u7d39\u4ecb\u3057\u3066\u304f\u3060\u3055\u3044\u3002 #TwitterGame","id":41189778409922560,"from_user_id":213846746,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"17484724","profile_image_url":"http://a2.twimg.com/profile_images/1138677235/iconue_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:22 +0000","from_user":"tsutcho","id_str":"41189777831231490","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30a2\u30aa\u30b7\u30de\u3055\u3093twitter\u306b\u7acb\u3064\u30fb\u30fb\u30fb\u3060\u3068\u30fb\u30fb\u30fb\uff1f\uff12\u756a\u76ee\u306e\u30d5\u30a9\u30ed\u30ef\u30fc\u306e\u5ea7\u3092\u3044\u305f\u3060\u3044\u3066\u304a\u3053\u3046","id":41189777831231490,"from_user_id":17484724,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"220041064","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"sloth888jp_bot5","id_str":"41189772521254914","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6642\u3005\u3001TwiAll\uff08\u30c4\u30a4\u30aa\u30fc\u30eb\uff09\u3067Twitter\u306e\u81ea\u52d5\u30d5\u30a9\u30ed\u30fc\u30fb\u30d5\u30a9\u30ed\u30fc\u8fd4\u3057\u3092\u3057\u3066\u3044\u307e\u3059\u3002","id":41189772521254914,"from_user_id":220041064,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twittbot.net/" rel="nofollow">twittbot.net</a>"},{"from_user_id_str":"177693537","profile_image_url":"http://a0.twimg.com/profile_images/1240130924/20110207213206_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:21 +0000","from_user":"Na_Okinawa","id_str":"41189769912397824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ebizo66: \u30ea\u30d3\u30a2\u30fb\u30c8\u30ea\u30dd\u30ea\u306eTw\uff1a\u6551\u6025\u8eca\u304c\u6765\u305f\u304c\u3001\u8ca0\u50b7\u8005\u3092\u8eca\u5185\u3067\u6bba\u5bb3\u3057\u3066\u3044\u305f\u3001\u3068\u3002\uff08\u6ec5\u8336\u82e6\u8336\u3060\uff01\uff09http://ow.ly/43pQ2 #libjp","id":41189769912397824,"from_user_id":177693537,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"147006592","profile_image_url":"http://a2.twimg.com/profile_images/1251306448/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"takasu_rika","id_str":"41189763532865536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kihirokiro: Twitter\u3067\u30cd\u30bf\u30d0\u30ec\u4e91\u3005\u3044\u3063\u3066\u3082\u5143\u3005Twitter\u3063\u3066\u300c\u500b\u4eba\u306e\u72ec\u308a\u8a00\u300d\u3060\u308d","id":41189763532865536,"from_user_id":147006592,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"100239985","profile_image_url":"http://a1.twimg.com/profile_images/733461294/CIMG0207_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:19 +0000","from_user":"strangebarjun","id_str":"41189762182152192","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u3092\u59cb\u3081\u3066\u3001\u305d\u308d\u305d\u308d\u4e00\u5e74\u306b\u306a\u308a\u307e\u3059\u3002\u632f\u308a\u8fd4\u308b\u3068\u3001\u307c\u304f\u306e\u4eba\u9593\u6027\u3092\u305d\u3063\u304f\u308a\u53cd\u6620\u3059\u308b\u304c\u5982\u304f\u3001\u534a\u7aef\u3067\u3059\u306d\u3002\u60c5\u5831\u53ce\u96c6\u30c4\u30fc\u30eb\u3001\u60c5\u5831\u767a\u4fe1\u30c4\u30fc\u30eb\u3001\u30b3\u30df\u30e5\u30cb\u30b1\u30fc\u30b7\u30e7\u30f3\u30c4\u30fc\u30eb\u3001\u3069\u308c\u3082\u6a5f\u80fd\u3057\u5207\u308c\u3066\u3044\u306a\u3044\u306a\u3042\u3001\u3068\u3002\u305d\u3057\u3066\u3042\u308b\u306e\u306f\u300c\u3069\u3053\u304b\u3089\u3082\u76f8\u624b\u306b\u3055\u308c\u3066\u3044\u306a\u3044\u300d\u3068\u3044\u3046\u3001\u65e2\u77e5\u306e\u73fe\u5b9f\u3067\u3059\u3002","id":41189762182152192,"from_user_id":100239985,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"126390384","profile_image_url":"http://a2.twimg.com/profile_images/1176065038/nemunemu_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:18 +0000","from_user":"gesukapper","id_str":"41189757476286464","metadata":{"result_type":"recent"},"to_user_id":80935865,"text":"@tatsugorou \u306a\u3093\u304b\u4e16\u306e\u4e2d\u306b\u306f\u611a\u75f4\u3082\u4e0b\u30cd\u30bf\u3082\u8a00\u3044\u653e\u984c\u306etwitter\u3068\u3044\u3046\u3082\u306e\u304c\u3042\u308b\u305d\u3046\u3067\u3059\u3002","id":41189757476286464,"from_user_id":126390384,"to_user":"tatsugorou","geo":null,"iso_language_code":"ja","to_user_id_str":"80935865","source":"<a href="http://janetter.net/" rel="nofollow">Janetter</a>"},{"from_user_id_str":"196059029","profile_image_url":"http://a1.twimg.com/profile_images/1208831726/ruka2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:17 +0000","from_user":"luka_m_bot","id_str":"41189756666777600","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u308f\u305f\u3057\u3082twitter\u306f\u3058\u3081\u307e\u3057\u305f","id":41189756666777600,"from_user_id":196059029,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www24.atpages.jp/aoi2/bot.php" rel="nofollow">\u5de1\u308b\u97f3</a>"},{"from_user_id_str":"88135613","profile_image_url":"http://a3.twimg.com/profile_images/1088552877/P9280150_normal.JPG","created_at":"Fri, 25 Feb 2011 17:36:14 +0000","from_user":"Roko38","id_str":"41189740321587200","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\uff46\uff42\u306b\u30ed\u30b0\u30a4\u30f3\u3059\u308b\u6a5f\u4f1a\u304c\u65e5\u306b\u65e5\u306b\u5897\u3048\u3066\u304d\u305f\uff3e\uff3e \u6163\u308c\u3066\u304f\u308b\u3068\u3042\u3063\u3061\u306e\u304c\u9762\u767d\u3044\uff06\u4f7f\u3044\u52dd\u624b\u304c\u3044\u3044\u3088\u3046\u306a\u6c17\u304c\u3059\u308b\u3002\u8907\u5408\u7684\u306b\u8272\u3005\u51fa\u6765\u307e\u3059\u3088\u306d\u2026\u3063\u3066\u3001\u601d\u3063\u305f\u3053\u3068\u3092\u545f\u304f\u306e\u306fTwitter\u3060\u3063\u305f\u308a\u3067\u3059\u304c\u2026(^_^; \u305d\u3057\u3066\u81ea\u5206\u306e\u5834\u5408\u306f\u30c4\u30a4\u3068\u9023\u52d5\u3057\u3065\u3089\u3044\u72b6\u6cc1\u3060\u3063\u305f\u308a\u3067\u2026\u3002","id":41189740321587200,"from_user_id":88135613,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"110825211","profile_image_url":"http://a2.twimg.com/profile_images/1108977866/o_t_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:12 +0000","from_user":"kou_nanjyo","id_str":"41189731941363712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @x68k: \u57fa\u672c\u7684\u306bTwitter\u4e0a\u3067\u306f"\u597d\u304d\u306b\u3084\u308c\u3070\u3044\u3044"\u3060\u3051\u3069\u3001\u540d\u524d\u3082\u30a2\u30a4\u30b3\u30f3\u3082\u30a2\u30f3\u30bf\u3058\u3083\u306a\u3044\u305f\u304f\u3055\u3093\u306e\u4eba\u305f\u3061\u306e\u9b42\u304c\u3053\u3082\u3063\u305f\u3082\u306e\u306a\u306e\u3060\u304b\u3089\u3001\u305d\u308c\u3060\u3051\u306f"\u80cc\u8ca0\u3048"\u3068\u601d\u3046\uff1e\u30ad\u30e3\u30e9\u30af\u30bf\u30fc\u30a2\u30ab\u30a6\u30f3\u30c8","id":41189731941363712,"from_user_id":110825211,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://tweetlogix.com" rel="nofollow">Tweetlogix</a>"},{"from_user_id_str":"2095960","profile_image_url":"http://a2.twimg.com/profile_images/1248999075/majiresu2_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:10 +0000","from_user":"guldeen","id_str":"41189726945947648","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3083\u307e\u3041\u3002\u25bchttp://bit.ly/et4vVa \uff3b\u89d2\u5ddd\u66f8\u5e97\uff3d\u300c\u30b6\u30fb\u30b9\u30cb\u30fc\u30ab\u30fc\u300d\u4f11\u520a\u3078\u3000\u300c\u6dbc\u5bae\u30cf\u30eb\u30d2\u300d\u751f\u3093\u3060\u30e9\u30ce\u30d9\u96d1\u8a8c18\u5e74\u3067\u5e55 via http://twitter.com/lkj777","id":41189726945947648,"from_user_id":2095960,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"164121549","profile_image_url":"http://a1.twimg.com/profile_images/1251758789/m_108-07ae3_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:09 +0000","from_user":"hachi_touhi","id_str":"41189719299727360","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30cd\u30bf\u30d0\u30ec\u6c17\u306b\u3057\u3066\u305f\u3089Twitter\u3084\u3063\u3066\u3089\u308c\u306a\u3044ww","id":41189719299727360,"from_user_id":164121549,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twicca.r246.jp/" rel="nofollow">twicca</a>"},{"from_user_id_str":"194494659","profile_image_url":"http://a3.twimg.com/profile_images/1249717822/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:36:08 +0000","from_user":"tomonattomo","id_str":"41189715415801856","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3046\u308f\u3001\u660e\u65e5\u671d\u304b\u3089\u30d0\u30a4\u30c8\u3084\u306e\u306b\u306a\u3093\u3060\u3053\u306e\u306d\u3075\u304b\u3057\u3002\u3042\u3001\u591c\u66f4\u304b\u3057\u3002\u30d1\u30d4\u30eb\u30b9\u3068BUMP\u3001\u3048\u307f\u3068Twitter\u306eDM\u3057\u3059\u304e\u305f\u306a\u2026","id":41189715415801856,"from_user_id":194494659,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://mixi.jp/promotion.pl?id=voice_twitter" rel="nofollow"> mixi \u30dc\u30a4\u30b9 </a>"},{"from_user_id_str":"97224364","profile_image_url":"http://a3.twimg.com/profile_images/1150074355/fb8bcca60d340862c053a756377bfae8_normal.jpeg","created_at":"Fri, 25 Feb 2011 17:36:06 +0000","from_user":"xxxheat","id_str":"41189709174677504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter\u5b8c\u5168\u306b\u30d0\u30b0\u3063\u3066\u308borz","id":41189709174677504,"from_user_id":97224364,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"}],"max_id":41190705623732224,"since_id":38643906774044672,"refresh_url":"?since_id=41190705623732224&q=twitter","next_page":"?page=2&max_id=41190705623732224&rpp=100&lang=ja&q=twitter","results_per_page":100,"page":1,"completed_in":0.093336,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41190705623732224","query":"twitter"} diff --git a/benchmarks/json-data/jp50.json b/benchmarks/json-data/jp50.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/jp50.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"2458313","profile_image_url":"http://a2.twimg.com/profile_images/1203653060/fure091226_normal.png","created_at":"Thu, 27 Jan 2011 20:30:04 +0000","from_user":"19princess","id_str":"30724239224995840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6d77\u6674\u300c\u672c\u65e5\u306e\u6771\u4eac\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u3057\u3087\u3046\u3002\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3001\u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3059\u3002\u3042\u306a\u305f\u306e\u4eca\u65e5\u306e\u4eba\u751f\u306b\u3068\u3073\u3063\u304d\u308a\u306e\u304a\u5929\u6c17\u3092\u2665\u300d","id":30724239224995840,"from_user_id":2458313,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://babyprincess.sakura.ne.jp/about/" rel="nofollow">\u5929\u4f7f\u5bb6\u306e\u88cf\u5c71</a>"},{"from_user_id_str":"66578965","profile_image_url":"http://a0.twimg.com/profile_images/1183763267/fossetta_normal.png","created_at":"Thu, 27 Jan 2011 20:00:04 +0000","from_user":"Fossetta_Tokyo","id_str":"30716689779785729","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u304a\u306f\u3088\u3046\u3054\u3056\u3044\u307e\u3059!!\u6771\u4eac\u90fd\u3001\u672c\u65e5\u306e\u304a\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3002\u6700\u9ad8\u6c17\u6e298\u5ea6\u3001\u6700\u4f4e\u6c17\u6e291\u5ea6\u3002\u6771\u4eac\u5730\u65b9\u3067\u306f\u3001\u7a7a\u6c17\u306e\u4e7e\u71e5\u3057\u305f\u72b6\u614b\u304c\u7d9a\u3044\u3066\u3044\u307e\u3059\u3002\u706b\u306e\u53d6\u308a\u6271\u3044\u306b\u6ce8\u610f\u3057\u3066\u4e0b\u3055\u3044\u3002\u4f0a\u8c46\u8af8\u5cf6\u3068\u5c0f\u7b20\u539f\u8af8\u5cf6\u306b\u306f\u3001\u5f37\u98a8\u3001\u6ce2\u6d6a\u3001\u4e7e\u71e5\u3001\u971c\u306e\u6ce8\u610f\u5831\u3092\u767a\u8868\u4e2d\u3067\u3059\u3002","id":30716689779785729,"from_user_id":66578965,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bit.ly/Fossetta" rel="nofollow">\u30d5\u30a9\u30bb\u30c3\u30bf ver.3.1.1</a>"},{"from_user_id_str":"104041146","profile_image_url":"http://a2.twimg.com/profile_images/863965118/001jwatokyo_normal.jpg","created_at":"Thu, 27 Jan 2011 19:44:33 +0000","from_user":"jwa_tokyo","id_str":"30712787537756160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6c17\u8c61\u5e81\u304b\u3089\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u304c\u767a\u8868\u3055\u308c\u307e\u3057\u305f\u3000\u305d\u306e\u5929\u6c17\u4e88\u5831\u3092\u3053\u3053\u3067\u3064\u3076\u3084\u3053\u3046\u304b\u306a\u3041\uff5e\uff1f\u3000\u8003\u3048\u4e2d\u3000\u307e\u3066\u6b21\u53f7\uff08\u7b11","id":30712787537756160,"from_user_id":104041146,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.docodemo.jp/twil/" rel="nofollow">Twil2 (Tweet Anytime, Anywhere by Mail)</a>"},{"from_user_id_str":"144500192","profile_image_url":"http://a3.twimg.com/a/1294874399/images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 18:59:33 +0000","from_user":"kyo4to4","id_str":"30701462774358016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u90fd \u516b\u4e08\u5cf6 - \u4eca\u65e5\u306e\u5929\u6c17\u306f\u30fb\u30fb\u30fb\u66c7\u306e\u3061\u6674\u3067\u3059\u306e\uff01","id":30701462774358016,"from_user_id":144500192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/kyo4to4" rel="nofollow">lost-sheep-bot</a>"},{"from_user_id_str":"165724582","profile_image_url":"http://a0.twimg.com/profile_images/1222842347/163087_1256281064506_1753997852_484926_2761052_n_normal.jpg","created_at":"Thu, 27 Jan 2011 17:39:06 +0000","from_user":"Rifqi_19931020","id_str":"30681213748387840","metadata":{"result_type":"recent"},"to_user_id":113796067,"text":"@CHLionRagbaby \u30b1\u30f3\u3061\u3083\u3093\u3001\u671d\u4eca\u307e\u3067\u306e\u81ea\u5206\u306e\u30db\u30fc\u30e0\u30a8\u30ea\u30a2\u304b\u3089\u307e\u3060\u975e\u5e38\u306b\u5bd2\u3044\u3068\u96e8\u304c\u964d\u3063\u3066\u3044\u305f..\u3069\u306e\u3088\u3046\u306b\u73fe\u5728\u306e\u6771\u4eac\u306e\u5929\u6c17\uff1f","id":30681213748387840,"from_user_id":165724582,"to_user":"CHLionRagbaby","geo":null,"iso_language_code":"ja","to_user_id_str":"113796067","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 17:28:30 +0000","from_user":"Cirno_fan","id_str":"30678546020040705","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u66c7\u6642\u3005\u6674\u3067\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\uff01 \u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3060\u3063\u305f\u3088\uff01 RT @mimi22999 \uff08\uff65\u2200\uff65\uff09\uff4c\u3001\u865a\u5f31\u306a\u8005\u306b\u3068\u3063\u3066\u3001\u6717\u3089\u304b\u306a\u9854\u306f\u4e0a\u5929\u6c17\u3068\u540c\u3058\u304f\u3089\u3044\u3046\u308c\u3057\u3044\u3082\u306e\u3060\u3002\u30d5\u30e9\u30f3\u30af\u30ea\u30f3 #tenki #bot","id":30678546020040705,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 17:00:03 +0000","from_user":"heta_weather01","id_str":"30671388754845696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Tere hommikust.\u30a8\u30b9\u30c8\u30cb\u30a2\u3067\u3059\u3002\u4eca\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u6642\u3005\u66c7\u3067\u660e\u65e5\u306f\u66c7\u308a\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u50d5\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067\u6c17\u6e29-7\u2103\u3067\u3059\u3002\u3061\u306a\u307f\u306b\u30b9\u30ab\u30a4\u30d7\u306e\u958b\u767a\u672c\u90e8\u306f\u50d5\u306e\u5bb6\u306b\u3042\u308b\u3093\u3067\u3059\u3002","id":30671388754845696,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"7278433","profile_image_url":"http://a3.twimg.com/profile_images/1218965303/michael-1_normal.png","created_at":"Thu, 27 Jan 2011 16:50:16 +0000","from_user":"shimohiko","id_str":"30668926035689472","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u308a\u3002\n\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u3055\u3042\u3084\u3093\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/29(\u571f)\u306f\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u738740%\u3001\u6700\u9ad8\u6c17\u6e29\u306f6\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3twnl0 #bt_tenki","id":30668926035689472,"from_user_id":7278433,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"61770","profile_image_url":"http://a3.twimg.com/profile_images/1206955079/tw172a_normal.png","created_at":"Thu, 27 Jan 2011 16:40:52 +0000","from_user":"rsky","id_str":"30666561853333504","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3075\u3068\u591c\u7a7a\u3092\u898b\u4e0a\u3052\u3066\u30aa\u30ea\u30aa\u30f3\u304c\u898b\u3048\u306a\u304f\u3066\u300c\u6771\u4eac\u306b\u306f\u7a7a\u304c\u306a\u3044\u300d\u3068\u667a\u6075\u5b50\u306e\u3088\u3046\u306a\u3053\u3068\u3092\u601d\u3063\u305f\u308f\u3051\u3060\u304c\u3001\u305f\u3076\u3093\u534a\u5206\u3050\u3089\u3044\u306f\u5929\u6c17\u306e\u305b\u3044\u3067\u3059","id":30666561853333504,"from_user_id":61770,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"103259265","profile_image_url":"http://a0.twimg.com/profile_images/767857973/anime_icon_normal.gif","created_at":"Thu, 27 Jan 2011 16:37:42 +0000","from_user":"liveshowonly","id_str":"30665765698928640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"iPhone\u5929\u6c17\u3002\u6771\u4eac4\u2103\u3063\u3066\u7d50\u69cb\u5bd2\u304f\u306a\u3044\u3058\u3083\u3093\u3002\uff08\u78ba\u304b\u306b\u3082\u306e\u51c4\u304f\u5bd2\u3044\u8a33\u3067\u306f\u7121\u3044\uff09\u3002\u798f\u5ca1\u5e02\u306f1\u2103\u3060\u3002\u52dd\u3061\u3060\u305c\u3002Rock'n'roll","id":30665765698928640,"from_user_id":103259265,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"165242761","profile_image_url":"http://a1.twimg.com/profile_images/1147334744/SN3E00600001_normal.jpg","created_at":"Thu, 27 Jan 2011 16:37:35 +0000","from_user":"deuxavril0502","id_str":"30665736556912640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6b8b\u5ff5\u3001\u79c1\u306f\u6c96\u7e04\u3067\u3059(>_<)\u3067\u3082\u304a\u5929\u6c17\u826f\u3055\u305d\u3046\u3067\u826f\u304b\u3063\u305f\u306d\u3002\u3053\u3061\u3089\u306f\u96e8\u3088\uff5eRT @rinandy2010: \u305d\u3046\u3067\u3059\u3063\u266a\u51fa\u5f35\u3067(^^)\u304a\u306d\u3048\u3055\u307e\u306f\u6771\u4eac\u3067\u3059\u304b\uff1f\u3081\u3063\u3061\u3083\u5929\u6c17\u826f\u304f\u3066\u3073\u3063\u304f\u308a\u3067\u3059\u3002\u624b\u888b\u3068\u304b\u5168\u7136\u3044\u3089\u306a\u3044\u3067\u3059\u306d\u30fc RT @deuxavril0502 \u6771\u4eac\u306a\u306e\u30fc\uff1f","id":30665736556912640,"from_user_id":165242761,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"163900288","profile_image_url":"http://a1.twimg.com/profile_images/1210224823/icon12945064955238_normal.jpg","created_at":"Thu, 27 Jan 2011 16:24:37 +0000","from_user":"nyao_yurichan","id_str":"30662472734089216","metadata":{"result_type":"recent"},"to_user_id":100985873,"text":"@ray_ko302 \u767a\u898b\u3042\u308a\u304c\u3068\u3067\u3059\u3045\u3002\u3053\u3061\u3089\u3067\u3082\u3088\u308d\u3057\u304f\u306d\u3002\u6771\u4eac\u306f\u4eca\u65e5\u3082\u4e7e\u71e5\u3067\u5927\u5909\u3088\u3002\u305d\u3063\u3061\u3068\u771f\u9006\u306e\u5929\u6c17\u3060\u306d\u3002\u30a2\u30a4\u30b9\u30d0\u30fc\u30f3\u304d\u3092\u3064\u3051\u3066\u3088\u306d\u3002","id":30662472734089216,"from_user_id":163900288,"to_user":"ray_ko302","geo":null,"iso_language_code":"ja","to_user_id_str":"100985873","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"49227098","profile_image_url":"http://a3.twimg.com/profile_images/965007882/____normal.jpg","created_at":"Thu, 27 Jan 2011 15:52:26 +0000","from_user":"dosannko6","id_str":"30654371016478720","metadata":{"result_type":"recent"},"to_user_id":108570870,"text":"@peke_hajiP \u4ffa\u304c\u6771\u4eac \u6765\u3066\u6700\u521d\u306b\u9a5a\u3044\u305f\u306e\u304c\u3001\u5929\u6c17\u4e88\u5831\u3067\u82b1\u7c89\u60c5\u5831\u304c\u6d41\u308c\u308b\u3053\u3068\u3067\u3001\u6700\u521d\u306b\u8a66\u3057\u305f\u306e\u304c \u30b4\u30ad\u69d8 \u53ec\u559a\u306e\u5100\u5f0f\u3067\u3059\u304a\uff1f","id":30654371016478720,"from_user_id":49227098,"to_user":"peke_hajip","geo":null,"iso_language_code":"ja","to_user_id_str":"108570870","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"71148934","profile_image_url":"http://a0.twimg.com/profile_images/1209223630/image_normal.jpg","created_at":"Thu, 27 Jan 2011 15:46:49 +0000","from_user":"123keiko","id_str":"30652958311981058","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9727\u5cf6\u306e\u964d\u7070\u306e\u30cb\u30e5\u30fc\u30b9\u3092\u898b\u3066\u601d\u3044\u51fa\u3057\u307e\u3057\u305f\u3002\u4e0a\u4eac\u3057\u305f\u59cb\u3081\u306e\u9803\u3001\u6771\u4eac\u306f1\u5e74\u4e2d\u3001\u7070\u304c\u964d\u3089\u306a\u3044\u304b\u3089\u7a7a\u6c17\u304c\u6f84\u3093\u3067\u3066\u904e\u3054\u3057\u3084\u3059\u3044\u306a\u3041\u3001\u3068\u601d\u3063\u305f\u306a\u3041\u3001\u3063\u3066\u3002\n\u5b9f\u5bb6\u306f\u51ac\u306e\u5b63\u7bc0\u98a8\u3067\u685c\u5cf6\u306e\u7070\u304c\u964d\u308b\u5730\u533a\u3067\u3057\u305f\u3002\u9e7f\u5150\u5cf6\u306e\u5929\u6c17\u4e88\u5831\u3067\u306f\u3001\u6bce\u65e5\u3001\u685c\u5cf6\u4e0a\u7a7a\u306e\u98a8\u5411\u304d\u4e88\u5831\u304c\u3067\u307e\u3059\u3002\u3053\u308c\u304b\u3089\u306f\u9727\u5cf6\u3082\u304b\u306a\uff1f","id":30652958311981058,"from_user_id":71148934,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"91124773","profile_image_url":"http://a3.twimg.com/profile_images/1139308356/prof101007_3-1_normal.jpg","created_at":"Thu, 27 Jan 2011 15:43:35 +0000","from_user":"sanposuruhito","id_str":"30652146277945345","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u5bb5\u306e\u90fd\u5fc3\u306f\u3001\u8eab\u3082\u5f15\u304d\u7de0\u307e\u308b\u3068\u3044\u3046\u3088\u308a\u306f\u51cd\u3048\u308b\u7a0b\u306e\u51b7\u6c17\u3092\u611f\u3058\u308b\u5bd2\u3044\u591c\u3067\u3059\u3002\u660e\u65e5\u65e5\u4e2d\u306e\u6771\u4eac\u306e\u5929\u6c17\u306f\u3001\u5915\u65b9\u306b\u591a\u5c11\u96f2\u304c\u51fa\u308b\u5834\u6240\u304c\u3042\u308a\u305d\u3046\u306a\u3082\u306e\u306e\u6982\u306d\u6674\u308c\u7a7a\u304c\u5e83\u304c\u308a\u7d9a\u3051\u305d\u3046\u3067\u3059\u3002\u6700\u9ad8\u6c17\u6e29\u306f\u30015-6\u5ea6\u4f4d\u3068\u306a\u308a\u305d\u3046\u3067\u3059\u3002#weather_tokyo","id":30652146277945345,"from_user_id":91124773,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://projects.playwell.jp/go/Saezuri" rel="nofollow">Saezuri</a>"},{"from_user_id_str":"104712480","profile_image_url":"http://a3.twimg.com/profile_images/1204016928/icon5087697006727791368kuro2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:31:51 +0000","from_user":"asongfor_xx","id_str":"30649192296751104","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u7f8e\u4eba\u5929\u6c17\u304b\u3089tweet\u3059\u308b\u3068\u3053\u3093\u306a\u611f\u3058\u306a\u3093\u3060\u306a\u3002 RT asongfor_xx: \u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u304b\u306a\u3053\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u6674\u6642\u3005\u304f\u3082\u308a\u3067\u3001\u964d\u6c34\u78ba\u73870%\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f1\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th","id":30649192296751104,"from_user_id":104712480,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b for iPhone</a>"},{"from_user_id_str":"165965113","profile_image_url":"http://a0.twimg.com/profile_images/1200885316/shogomeguro_normal.jpg","created_at":"Thu, 27 Jan 2011 15:24:35 +0000","from_user":"shogomeguro","id_str":"30647362477105152","metadata":{"result_type":"recent"},"to_user_id":null,"text":"2011.1.26 \u793e\u7a93\u304b\u3089\u3002\u4e0d\u601d\u8b70\u306a\u5929\u6c17\u3067\u3053\u306e\u5f8c\u96ea\u304c\u3061\u3089\u3064\u3044\u305f\u3093\u3060\u3088\u306d\u3002\u6771\u4eac\u306e\u521d\u96ea\u3067\u3057\u305f\u3002 http://instagr.am/p/BO_xn/","id":30647362477105152,"from_user_id":165965113,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://instagr.am" rel="nofollow">instagram</a>"},{"from_user_id_str":"166018520","profile_image_url":"http://a0.twimg.com/profile_images/1207460953/100-40030_normal.jpg","created_at":"Thu, 27 Jan 2011 15:18:17 +0000","from_user":"115nayume","id_str":"30645776254238722","metadata":{"result_type":"recent"},"to_user_id":118384679,"text":"@dancinpea09 \u6771\u4eac\u3001\u660e\u65e5\u3082\u5929\u6c17\u826f\u3044\u307f\u305f\u3044\u3067\u3001\u3088\u304b\u3063\u305f\u3067\u3059\u306d\u30fc\u266a \u30ca\u30a4\u30b9\u30c8\u30ea\u30c3\u30d7\uff01\u304a\u3084\u3059\u307f\u306a\u3055\u3044\u3002 http://twitpic.com/3tvun3","id":30645776254238722,"from_user_id":166018520,"to_user":"dancinpea09","geo":null,"iso_language_code":"ja","to_user_id_str":"118384679","source":"<a href="http://tweetli.st/" rel="nofollow">TweetList!</a>"},{"from_user_id_str":"202937674","profile_image_url":"http://a1.twimg.com/profile_images/1218797578/______2_normal.jpg","created_at":"Thu, 27 Jan 2011 15:11:48 +0000","from_user":"ryuusisan","id_str":"30644146498699264","metadata":{"result_type":"recent"},"to_user_id":203058384,"text":"@manaasutakshi \u6771\u4eac\u306f\u964d\u3063\u3066\u306a\u3044\u3093\u3067\u3059\u304b\u30fb\u30fb\u30fb\u5929\u6c17\u4e88\u5831\u306b\u3088\u308b\u3068\u660e\u65e5\u3082\u6771\u4eac\u306f\u964d\u3089\u306a\u3044\u305d\u3046\u3067\u3059\u306d\uff01\uff01\u79c1\u306e\u4f4f\u3093\u3067\u3044\u308b\u3068\u3053\u308d\u306f\u5fae\u5999\u306b\u964d\u308a\u305d\u3046\u3067\u51fa\u52e4\u6642\u306b\u964d\u3063\u3066\u305f\u3089\u3061\u3087\u3063\u3068\u5acc\u3060\u306a\u3041\u3000\u306a\u3093\u3066\u601d\u3044\u307e\u3059","id":30644146498699264,"from_user_id":202937674,"to_user":"manaasutakshi","geo":null,"iso_language_code":"ja","to_user_id_str":"203058384","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"3222182","profile_image_url":"http://a0.twimg.com/profile_images/1199090957/ProfilePhoto_normal.png","created_at":"Thu, 27 Jan 2011 15:09:35 +0000","from_user":"44mune","id_str":"30643589545459713","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u306e\u308a\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/28(\u91d1)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d http://twitpic.com/3tvruh","id":30643589545459713,"from_user_id":3222182,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"154341982","profile_image_url":"http://a0.twimg.com/profile_images/1155496864/_____normal.jpg","created_at":"Thu, 27 Jan 2011 15:02:39 +0000","from_user":"slave_420_bot","id_str":"30641845490946049","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u30f3\u3068\u3053\u899a\u3048\u3066\u308b\u306e\u306f\u300c\u672d\u5e4c\u300d\u300c\u4ed9\u53f0\u300d\u300c\u6771\u4eac\u300d\u300c\u5927\u962a\u300d\u300c\u540d\u53e4\u5c4b\u300d\u300c\u798f\u5ca1\u300d\u306e\u4eca\u65e5\u3068\u660e\u65e5\u306e\u5929\u6c17\u3060\u306a\u3002\u5929\u6c17\u304c\u77e5\u308a\u305f\u3044\u6642\u306f\u300c\u5834\u6240\u300d\u3068\u300c\u4eca\u65e5\u306e\u5929\u6c17\u300d\u304b\u300c\u660e\u65e5\u306e\u5929\u6c17\u300d\u3092\u304a\u7533\u3057\u4ed8\u3051\u304f\u3060\u3055\u3044\u3001\u304a\u5b22\u69d8\uff1f","id":30641845490946049,"from_user_id":154341982,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bot.syoyu.net/" rel="nofollow">\u7adc\u30f6\u5cf0\u90b8\u306e\u3069\u3053\u304b</a>"},{"from_user_id_str":"72042678","profile_image_url":"http://a3.twimg.com/profile_images/1198771027/larxene_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:57 +0000","from_user":"larxene_bot","id_str":"30641668772339712","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u65e5\u306e\u5929\u6c17\u306f \u672d\u5e4c\u304c\u6674\u308c \u4ed9\u53f0\u304c\u66c7\u6642\u3005\u96ea \u6771\u4eac\u304c\u6674\u306e\u3061\u66c7 \u540d\u53e4\u5c4b\u304c\u6674\u6642\u3005\u66c7 \u5927\u962a\u304c\u6674\u6642\u3005\u66c7 \u798f\u5ca1\u304c\u6674\u308c \u3089\u3057\u3044\u308f\u3088 \u6ce8\u610f\u3057\u306a\u3055\u3044","id":30641668772339712,"from_user_id":72042678,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www4.kiwi-us.com/~yuuna/larxene_bot_manual/index.html" rel="nofollow">\u5fd8\u5374\u306e\u57ce \u5730\u4e0a\u306e12\u968e</a>"},{"from_user_id_str":"101331893","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 15:01:34 +0000","from_user":"yoshiftan","id_str":"30641572240424961","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3073\u3063\u304f\u308a\uff01\u6691\u305d\u3046\u3060\u306a\u3053\u308a\u3083\u3002","id":30641572240424961,"from_user_id":101331893,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"Keitai Mail"},{"from_user_id_str":"65207550","profile_image_url":"http://a3.twimg.com/profile_images/448731969/_________R_normal.jpg","created_at":"Thu, 27 Jan 2011 15:01:33 +0000","from_user":"kabuyo","id_str":"30641566469066752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u5929\u6c17\u4e88\u5831\u3067\u306f\u6771\u4eac\u3067\u306f\u4e7e\u71e5\u6ce8\u610f\u5831\u304c\u7d9a\u3044\u3066\u3044\u308b\u3089\u3057\u3044\u306e\u306b\u3001\u306a\u305c\u79c1\u304c\u5e72\u3057\u305f\u6d17\u6fef\u7269\u306f\u96e8\u306b\u6fe1\u308c\u3066\u3057\u307e\u3063\u305f\u306e\u3060\u308d\u3046\u304b\u2025\u3000\u3088\u3063\u307d\u3069\u904b\u304c\u60aa\u3044\u3089\u3057\u3044\u2025","id":30641566469066752,"from_user_id":65207550,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:54:30 +0000","from_user":"mikutyan","id_str":"30639792026812416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066","id":30639792026812416,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"80309352","profile_image_url":"http://a1.twimg.com/profile_images/1223620418/image_normal.jpg","created_at":"Thu, 27 Jan 2011 14:53:06 +0000","from_user":"mikutyan","id_str":"30639439847890944","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u660e\u65e5\u306e\u6771\u4eac\u306e\u5929\u6c17\u306a\u3093\u3060\u308d\u3046 \u96e8\u964d\u3063\u305f\u3089\u56f0\u308b\u3002","id":30639439847890944,"from_user_id":80309352,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"120911929","profile_image_url":"http://a0.twimg.com/profile_images/772435076/20100312___capture2_normal.png","created_at":"Thu, 27 Jan 2011 14:47:19 +0000","from_user":"Cirno_fan","id_str":"30637984684449792","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3042\u305f\u3044\u30c1\u30eb\u30ce\uff01\u30dc\u30c3\u30c8\u3060\u3051\u3069\u5929\u6c17\u4e88\u5831\u3082\u3067\u304d\u308b\u3088\uff01\u300c\u6771\u4eac\u306e\u4eca\u65e5\u306e\u5929\u6c17\u6559\u3048\u3066\u300d\u307f\u305f\u3044\u306bTL\u767a\u8a00\u3057\u3066\u304f\u308c\u308c\u3070\u8abf\u3079\u3066\u3042\u3052\u308b\uff01 #followme #followmejp #followmevip #tenki","id":30637984684449792,"from_user_id":120911929,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://blog.livedoor.jp/fairycirno/archives/34686.html" rel="nofollow">\u5e7b\u60f3\u90f7 \u9727\u306e\u6e56</a>"},{"from_user_id_str":"33858777","profile_image_url":"http://a0.twimg.com/profile_images/352864695/muga_normal.jpg","created_at":"Thu, 27 Jan 2011 14:46:12 +0000","from_user":"collonist","id_str":"30637702105796610","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u3063\u3066\u51ac\u306f\u57fa\u672c\u7684\u306b\u6674\u308c\u3066\u308b\u304b\u3089\u3001\u5929\u6c17\u4e88\u5831\u898b\u306a\u304f\u3066\u3082\u5168\u7136\u554f\u984c\u306a\u3044\u3002\u5c71\u5f62\u3060\u3068\u660e\u65e5\u306f\u3069\u3093\u3060\u3051\u96ea\u304c\u964d\u308b\u306e\u304b\u3001\u3069\u3093\u3060\u3051\u5bd2\u3044\u306e\u304b\u628a\u63e1\u3057\u3066\u3068\u304d\u305f\u3044\u306e\u3067\u3001\u5929\u6c17\u4e88\u5831\u306f\u5fc5\u305a\u30c1\u30a7\u30c3\u30af\u3057\u3066\u305f\u306e\u3060\u304c\u3002","id":30637702105796610,"from_user_id":33858777,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"79336228","profile_image_url":"http://a0.twimg.com/profile_images/1130029876/zmanmu_normal.png","created_at":"Thu, 27 Jan 2011 14:30:23 +0000","from_user":"atsuki777","id_str":"30633725041573890","metadata":{"result_type":"recent"},"to_user_id":null,"text":"MXTV\u306e\u5929\u6c17\u4e88\u5831\u521d\u3081\u3066\u898b\u305f\u3051\u3069\u6771\u4eac\u753a\u7530\u516b\u738b\u5b50\u3063\u3066\u5730\u57df\u8868\u793a\u304c\u2026w\u516b\u738b\u5b50\u3068\u753a\u7530\u306f\u6771\u4eac\u3058\u3083\u306a\u3044\u306e\u304bwww","id":30633725041573890,"from_user_id":79336228,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"90576097","profile_image_url":"http://a0.twimg.com/profile_images/1203320254/nanami1_normal.png","created_at":"Thu, 27 Jan 2011 14:28:26 +0000","from_user":"dycroft","id_str":"30633234245099521","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633234245099521,"from_user_id":90576097,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"147215268","profile_image_url":"http://a2.twimg.com/profile_images/1198555202/ichika-7.4.0-3P_normal.gif","created_at":"Thu, 27 Jan 2011 14:28:23 +0000","from_user":"kiaran5032","id_str":"30633222211637248","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002\u6674\u308c\u6642\u3005\u304f\u3082\u308a #MX","id":30633222211637248,"from_user_id":147215268,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"1741599","profile_image_url":"http://a0.twimg.com/profile_images/1205744888/950637_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:21 +0000","from_user":"dasaitama","id_str":"30633212535382016","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u3001\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633212535382016,"from_user_id":1741599,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"34140879","profile_image_url":"http://a3.twimg.com/profile_images/1186413535/__6_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:17 +0000","from_user":"ryuji_chaos","id_str":"30633197016449024","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059\u3002","id":30633197016449024,"from_user_id":34140879,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"1400","profile_image_url":"http://a0.twimg.com/profile_images/1198556839/westerndog_20090104_320x320_normal.jpg","created_at":"Thu, 27 Jan 2011 14:28:16 +0000","from_user":"westerndog","id_str":"30633191232503808","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306e\u660e\u65e5\u306e\u304a\u5929\u6c17\u3067\u3059","id":30633191232503808,"from_user_id":1400,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"89239832","profile_image_url":"http://a3.twimg.com/profile_images/519522846/noriko_normal.jpg","created_at":"Thu, 27 Jan 2011 14:15:01 +0000","from_user":"Noriko_Fujimoto","id_str":"30629857234788352","metadata":{"result_type":"recent"},"to_user_id":115645219,"text":"@nossa430402 \u5bcc\u5c71\u306f\u3059\u3054\u3044\u96ea\u307f\u305f\u3044\u3067\u3059\u306d\uff5e\uff08\u5bd2\u3063\uff09\u3000\u6771\u4eac\u306f\u305d\u306e\u5206\u6bce\u65e5\u826f\u3044\u5929\u6c17\u3067\u3059\u3002\u5bd2\u3044\u3051\u3069\u30fb\u30fb\u30fb\u3002","id":30629857234788352,"from_user_id":89239832,"to_user":"nossa430402","geo":null,"iso_language_code":"ja","to_user_id_str":"115645219","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"107265539","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Thu, 27 Jan 2011 14:01:10 +0000","from_user":"kurumasuki330","id_str":"30626371826884608","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u4eca\u9031\u571f\u66dc\u65e5\u3001\u8eca\u3067\u6771\u4eac\u304b\u3089\u6771\u540d\u3001\u7c73\u539f\u7d4c\u7531\u3067\u91d1\u6ca2\u306e\u5b9f\u5bb6\u3078\u3002\u305d\u3057\u3066\u3001\u6708\u66dc\u65e5\u306b\u6771\u4eac\u3078\u5e30\u308b\u30b9\u30b1\u30b8\u30e5\u30fc\u30eb\u3002\u5929\u6c17\u4e88\u5831\u3060\u3068\u4eca\u9031\u672b\u3001\u5317\u9678\u5730\u65b9\u306f\u5927\u96ea\uff01\u5e30\u308c\u308b\u304b\u81ea\u4fe1\u304c\u306a\u304f\u306a\u3063\u3066\u304d\u305f\u3002\u307e\u305f\u3001\u305d\u306e\u6642\u5b9f\u6cc1\u4e2d\u7d99\u3057\u307e\u3059\u3002","id":30626371826884608,"from_user_id":107265539,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"},{"from_user_id_str":"155313166","profile_image_url":"http://a3.twimg.com/profile_images/1167554721/73931_1408370184003_1674923704_920888_5686998_n_normal.jpg","created_at":"Thu, 27 Jan 2011 14:00:50 +0000","from_user":"takuya_aoki","id_str":"30626287127105536","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3081\u3063\u3061\u3083\u3044\u3044\u5929\u6c17\u3067\u904e\u3054\u3057\u3084\u3059\u3044\u3051\u3069\u30c9\u30e9\u30a4\u30a2\u30a4\u306b\u306f\u3061\u3087\u3063\u3068\u304d\u3064\u3044\u306a\u30fb\u30fb\u30fb\u76ee\u85ac\u304c\u624b\u653e\u305b\u306a\u3044","id":30626287127105536,"from_user_id":155313166,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"179984398","profile_image_url":"http://a1.twimg.com/profile_images/1182382310/g4350_normal.jpg","created_at":"Thu, 27 Jan 2011 13:52:50 +0000","from_user":"aiilabo","id_str":"30624271902449664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u30d6\u30ed\u30b0\u66f4\u65b0 \u25c6\u611f\u60c5\u3092\u307f\u3064\u3081\u308b\u65b9\u6cd5 - \u3053\u3053\u6570\u65e5\u3001\u6642\u6298\u96e8\u304c\u30d1\u30e9\u30d1\u30e9\u3000\u5fae\u5999\u306a\u5929\u6c17\u306e\u6771\u4eac\u304b\u3089\u3042\u308b\u304c\u307e\u307e\u3067\u3059\u3002 \n\n \u4eca\u65e5\u306f\u3001\u6628\u65e5\u306e\u300c\u30de\u30a4\u30ca\u30b9\u611f\u60c5\u306f\u60aa\u3067\u3059\u304b\uff1f\n.. \u27aa http://am6.jp/e3e9tS","id":30624271902449664,"from_user_id":179984398,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://feedtweet.am6.jp/" rel="nofollow">\u261e feedtweet.jp \u261c</a>"},{"from_user_id_str":"185992391","profile_image_url":"http://a2.twimg.com/profile_images/1192695844/otenki_normal.png","created_at":"Thu, 27 Jan 2011 13:00:37 +0000","from_user":"otenki_luci_bot","id_str":"30611130938298368","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u767a\u58f2\u65e5\u304b\u2026\u2026\u541b\u305f\u3061\u306b\u3068\u3063\u3066\u306f\u591a\u5206\u300190\u65e5\u5f8c\u306e\u3053\u3068\u3060\u3002\u3055\u3066\u660e\u65e5\u306e\u6771\u4eac\u90fd\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3001\u6700\u9ad8\u6c17\u6e29\u306f8\u5ea6\u3060\u305d\u3046\u3060\u3002\u3055\u3059\u304c\u306b\u4f55\u304b\u7740\u305f\u65b9\u304c\u3044\u3044\u305e\u3001\u30a4\u30fc\u30ce\u30c3\u30af\u3002","id":30611130938298368,"from_user_id":185992391,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/otenki_luci_bot" rel="nofollow">\u304a\u3066\u3093\u304d\u308b\u3057\u3075\u3047\u308b</a>"},{"from_user_id_str":"65976527","profile_image_url":"http://a0.twimg.com/profile_images/452810990/little_italies_____normal.jpg","created_at":"Thu, 27 Jan 2011 13:00:04 +0000","from_user":"heta_weather01","id_str":"30610995843964928","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u30d8\u30bf\u5929\u3011Jo napot.\u30cf\u30f3\u30ac\u30ea\u30fc\u3067\u3059\u3002\u6771\u4eac\u306e\u5929\u6c17\u306f\u6674\u306e\u3061\u66c7\u3067\u660e\u65e5\u306f\u6674\u6642\u3005\u66c7\u3001\u79c1\u306e\u3068\u3053\u308d\u3067\u306f\u66c7\u308a\u3067-2\u2103\u3067\u3059\u3002\u3048\u3001\u3053\u306e\u30d5\u30e9\u30a4\u30d1\u30f3\u3067\u3059\u304b\uff1f\u2026\u3061\u3087\u3063\u3068\u500b\u4eba\u7684\u306b\u6bb4\u308a\u305f\u3044\u4eba\u304c\u3044\u308b\u3093\u3067\u3059\u266a","id":30610995843964928,"from_user_id":65976527,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www15.atpages.jp/~kageyanma/" rel="nofollow">\u5730\u7403\u306e\u4e2d</a>"},{"from_user_id_str":"109740077","profile_image_url":"http://a0.twimg.com/profile_images/1212763349/1d3d3821-6b3a-449f-a636-05b95ce3d5d8_normal.png","created_at":"Thu, 27 Jan 2011 12:59:41 +0000","from_user":"snow_arai","id_str":"30610896141156354","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u6771\u4eac\u306f\u3001\u30ab\u30e9\u30ab\u30e9\u9023\u7d9a\u3000\uff13\u4f4d\u30bf\u30a4 - \u65e9\u8d77\u304d\u2606\u304a\u5929\u6c17\u2606ONAIR\u65e5\u8a18\uff1a\u65e5\u7d4c\u30a6\u30fc\u30de\u30f3\u30aa\u30f3\u30e9\u30a4\u30f3 http://j.mp/hxP3Di","id":30610896141156354,"from_user_id":109740077,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"53407951","profile_image_url":"http://a1.twimg.com/profile_images/397960795/airman_normal.jpg","created_at":"Thu, 27 Jan 2011 12:57:32 +0000","from_user":"Airman2009","id_str":"30610355541508096","metadata":{"result_type":"recent"},"to_user_id":null,"text":". @04mmy22 @qsk1 \u98a8\u3068\u96f2\u30fb\u30fb\u30fb\u98db\u884c\u6a5f\u306e\u5927\u5c0f\u554f\u308f\u305a\u3001\u3053\u308c\u3070\u304b\u308a\u306f\u3069\u3046\u3057\u3088\u3046\u3082\u7121\u3044\u3067\u3059\u3088\u306d\u3002 \u6700\u8fd1\u306e\u5357\u6771\u4eac\u306e\u5929\u6c17\u306f\u5909\u3067\u3059\u306d\u3002\u3002\u3002","id":30610355541508096,"from_user_id":53407951,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sourceforge.jp/projects/tween/wiki/FrontPage" rel="nofollow">Tween</a>"},{"from_user_id_str":"111826019","profile_image_url":"http://a1.twimg.com/profile_images/1121742732/DVC00052_normal.jpg","created_at":"Thu, 27 Jan 2011 12:51:12 +0000","from_user":"nijiks","id_str":"30608762859421696","metadata":{"result_type":"recent"},"to_user_id":100014282,"text":"@sanaeru \u79c1\u3053\u3093\u306a\u5929\u6c17\u306e\u4e2d\uff64\u4e8c\u6cca\u4e09\u65e5\u3067\u660e\u65e5\u304b\u3089\u6771\u4eac\u884c\u304f\u3093\u3067\u3059\u3051\u3069\u2026\uff61\u65e5\u66dc\u65e5\u98db\u884c\u6a5f\u98db\u3076\u304b\u3057\u3089\u2026\uff1f","id":30608762859421696,"from_user_id":111826019,"to_user":"sanaeru","geo":null,"iso_language_code":"ja","to_user_id_str":"100014282","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"164951488","profile_image_url":"http://a3.twimg.com/profile_images/799082230/twitter_normal.jpg","created_at":"Thu, 27 Jan 2011 12:47:49 +0000","from_user":"minorif_jp","id_str":"30607912309096448","metadata":{"result_type":"recent"},"to_user_id":105078670,"text":"@ecco_HIRADO \u5e73\u6238\u725b\u3063\u3066\u5143\u306f\u30aa\u30e9\u30f3\u30c0\u304b\u3089\u304d\u305f\u725b\u306a\u3093\u3060\u306d\u3002\u304a\u3044\u3057\u305d\u3046\u2026\u3002\u5e73\u6238\u306f\u3088\u304b\u6240\u305f\u3043\u3002\u3042\u305f\u3044\u3052\u3047\u3093\u5b9f\u5bb6\u3093\u65b9\u306f\u30c0\u30d6\u30eb\u706b\u5c71\u3084\u9ce5\u30a4\u30f3\u30d5\u30eb\u3067\u5927\u5909\u3084\u3063\u3069\u3002\u6771\u4eac\u3093\u826f\u304b\u3068\u3053\u306f\u5929\u6c17\u306e\u5fc3\u914d\u305b\u305a\u66ae\u3089\u305b\u308b\u3068\u3053\u3058\u3083\u3063\u3069\u3093\u3002","id":30607912309096448,"from_user_id":164951488,"to_user":"ecco_HIRADO","geo":null,"iso_language_code":"ja","to_user_id_str":"105078670","source":"<a href="http://z.twipple.jp/" rel="nofollow">\u3064\u3044\u3063\u3077\u308b/twipple</a>"},{"from_user_id_str":"10456803","profile_image_url":"http://a1.twimg.com/profile_images/145280215/vot_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:43:37 +0000","from_user":"vot_","id_str":"30606853377363968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3086\u3063\u304f\u308a\u5929\u6c17\u4e88\u5831\u3067\u3059\u3002\u6771\u4eac\u90fd,\u5927\u5cf6\u5730\u65b9\u300228\u65e5\uff08\u91d1\u66dc\u65e5\u306e\u5929\u6c17\u306f\u6674\u308c\u306e\u3061\u66c7\u308a\u3001\u6700\u9ad8\u6c17\u6e29\u306f7\u5ea6 \u6700\u4f4e\u6c17\u6e29\u306f1\u5ea6\u3067\u3057\u3087\u3046\u3002","id":30606853377363968,"from_user_id":10456803,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://voiceoftwitter.com" rel="nofollow">\uff56\uff4f\uff49\uff43\uff45 \uff4f\uff46 \uff54\uff57\uff49\uff54\uff54\uff45\uff52</a>"},{"from_user_id_str":"23900716","profile_image_url":"http://a3.twimg.com/profile_images/1092646332/twitter_icon_normal.png","created_at":"Thu, 27 Jan 2011 12:38:00 +0000","from_user":"keiyama","id_str":"30605442639990784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3010\u7f8e\u4eba\u5929\u6c17/\u6771\u4eac\u3011\u7f8e\u4eba\u5929\u6c17\u30ad\u30e3\u30b9\u30bf\u30fc\u306e"\u30c8\u30e2\u30b3\u3055\u3093"\u306b\u3088\u308b\u3068\u300c1/27(\u6728)\u306f\u304f\u3082\u308a\u306e\u3061\u6674\u3067\u3001\u964d\u6c34\u78ba\u738710%\u3001\u6700\u9ad8\u6c17\u6e29\u306f9\u2103\u3067\u6700\u4f4e\u6c17\u6e29\u306f2\u2103\u3067\u3059\u300d\u7f8e\u4eba\u5929\u6c17\u21d2http://bit.ly/djB8th http://twitpic.com/3tuekm #bt_tenki","id":30605442639990784,"from_user_id":23900716,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://bijintenki.jp" rel="nofollow">bijintenki.jp</a>"},{"from_user_id_str":"32018516","profile_image_url":"http://a0.twimg.com/profile_images/1089472069/237_normal.jpg","created_at":"Thu, 27 Jan 2011 12:36:28 +0000","from_user":"DigJandG","id_str":"30605057460281344","metadata":{"result_type":"recent"},"to_user_id":196050661,"text":"@kosumoworld55 \u5929\u6c17\u4e88\u5831\u3092\u898b\u3066\u3044\u3064\u3082\u601d\u3046\u3093\u3060\u3002\u4f55\u3067\u6a2a\u6d5c\u3042\u305f\u308a\u306f\u3044\u3064\u3082\u597d\u3044\u5929\u6c17\u306a\u3093\u3060\u3002\u6771\u4eac\u3082\u3002\u3061\u306a\u307f\u306b\u516c\u9b5a\u306f\u3042\u3093\u307e\u308a\u597d\u304d\u3067\u306f\u3042\u308a\u307e\u305b\u3093\u3002\u306a\u3093\u304b\u81ed\u304f\u3063\u3066\u3002\u3067\u3082\u3001\u7435\u7436\u6e56\u3067\u516c\u9b5a\u3063\u3066\u3042\u307e\u308a\u805e\u304b\u306a\u3044\u69d8\u306a\u30fb\u30fb\u30fb\u3002\u4ffa\u304c\u91e3\u308a\u3092\u3057\u306a\u3044\u304b\u3089\u304b\u306a\uff1f","id":30605057460281344,"from_user_id":32018516,"to_user":"kosumoworld55","geo":null,"iso_language_code":"ja","to_user_id_str":"196050661","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90935348","profile_image_url":"http://a1.twimg.com/sticky/default_profile_images/default_profile_0_normal.png","created_at":"Thu, 27 Jan 2011 12:34:34 +0000","from_user":"sorakeiko","id_str":"30604575937396737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u95a2\u6771\u5730\u65b9\u306e\u660e\u65e5\u306e\u5929\u6c17\u2015\u7d9a\u304d\u3002\u660e\u65e5\u671d\u6700\u4f4e\u6c17\u6e29\u30fb\u8ed2\u4e26\u307f\u6c37\u70b9\u4e0b\u30fb\u5b87\u90fd\u5bae\u3001\u6c34\u6238\u30de\u30a4\u30ca\u30b95\u5ea6\u30fb\u6771\u4eac\u3001\u6a2a\u6d5c1\u5ea6\u3002\u6700\u9ad8\u6c17\u6e29\u30fb\u4eca\u65e5\u3088\u308a3\u5ea6\u524d\u5f8c\u4f4e\u304f5\uff5e8\u5ea6\u30fb\u6771\u4eac\u3001\u5343\u84498\u5ea6\u3002\u5411\u3053\u3046\u4e00\u9031\u9593\u30fb\u4e7e\u71e5\u3057\u305f\u6674\u308c\u7d9a\u304f\u30fb\uff08\u571f\uff09\u4f0a\u8c46\u8af8\u5cf6\u306b\u51b7\u305f\u3044\u96e8\u3084\u96ea\u304c\u898b\u3089\u308c\u305d\u3046\u3060\u304c\u3001\u95a2\u6771\u306e\u4e7e\u3044\u305f\u72b6\u614b\u7d9a\u304f\u3002","id":30604575937396737,"from_user_id":90935348,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"6113557","profile_image_url":"http://a3.twimg.com/profile_images/1227080026/profile_red_herencia_normal.png","created_at":"Thu, 27 Jan 2011 12:33:57 +0000","from_user":"fmoto7","id_str":"30604423327653888","metadata":{"result_type":"recent"},"to_user_id":null,"text":""\u6771\u4eac\u6c34\u904b\u7528\u30bb\u30f3\u30bf\u30fc\u306f\u3001\u524d\u534a\u6226\u304c\u7d42\u308f\u3063\u305f\u3068\u3053\u308d\u3067\u4e00\u6c17\u306b\u6c34\u5727\u9ad8\u3081\u3001\u5f8c\u534a\u6226\u59cb\u307e\u308b\u3068\u6c34\u5727\u4e0b\u3052\u3001\u7d42\u308f\u308b\u3068\u307e\u305f\u3059\u3050\u4e0a\u3052\u308b\u3002\u30c6\u30ec\u30d3\u306e\u8996\u8074\u3001\u305d\u306e\u65e5\u306e\u5929\u6c17\u306a\u3069\u30e9\u30a4..." http://tumblr.com/xjy1cwiwrm","id":30604423327653888,"from_user_id":6113557,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.tumblr.com/" rel="nofollow">Tumblr</a>"},{"from_user_id_str":"118092912","profile_image_url":"http://a3.twimg.com/profile_images/1225330653/____normal.PNG","created_at":"Thu, 27 Jan 2011 12:29:13 +0000","from_user":"saechuchun","id_str":"30603231042207744","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u3067\u3082\u5730\u9707\u306e\u8a71\u984c\u306e\u3068\u304d\u306e\u300c\u3082\u3057\u6771\u4eac\u3067\u76f4\u4e0b\u578b\u5730\u9707\u304c\u8d77\u304d\u305f\u3089\u300d\u3068\u304b\u5929\u6c17\u4e88\u5831\u306e\u3068\u304d\u306f\u897f\u3067\u96e8\u3060\u308d\u3046\u3068\u300c\u6771\u4eac\u3067\u306f\u301c\u65e5\u9593\u4e7e\u71e5\u3057\u3066\u307e\u3059\u306d\u30fc\u300d\u3068\u304b\u305d\u3046\u3044\u3046\u30ad\u30fc\u5c40\u306e\u95a2\u6771\u4e2d\u5fc3\u4e3b\u7fa9\u306f\u597d\u304d\u3067\u306f\u306a\u3044","id":30603231042207744,"from_user_id":118092912,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twtr.jp" rel="nofollow">Keitai Web</a>"}],"max_id":30724239224995840,"since_id":28179956995457024,"refresh_url":"?since_id=30724239224995840&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","next_page":"?page=2&max_id=30724239224995840&rpp=50&lang=ja&q=%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97","results_per_page":50,"page":1,"completed_in":0.170202,"warning":"adjusted since_id to 28179956995457024 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"28179956995457024","max_id_str":"30724239224995840","query":"%E6%9D%B1%E4%BA%AC%E3%80%80%E5%A4%A9%E6%B0%97"} diff --git a/benchmarks/json-data/numbers.json b/benchmarks/json-data/numbers.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/numbers.json @@ -0,0 +1,1 @@ +[1.15, 1.3224999999999998, 1.5208749999999998, 1.7490062499999994, 2.0113571874999994, 2.313060765624999, 2.6600198804687487, 3.0590228625390607, 3.5178762919199196, 4.045557735707907, 4.652391396064092, 5.350250105473706, 6.152787621294761, 7.075705764488975, 8.137061629162321, 9.357620873536668, 10.761264004567169, 12.375453605252241, 14.231771646040077, 16.36653739294609, 18.821518001888, 21.644745702171196, 24.891457557496874, 28.625176191121405, 32.918952619789614, 37.856795512758055, 43.535314839671756, 50.06561206562252, 57.57545387546589, 66.21177195678577, 76.14353775030362, 87.56506841284916, 100.69982867477653, 115.804802975993, 133.17552342239193, 153.15185193575073, 176.1246297261133, 202.5433241850303, 232.9248228127848, 267.86354623470254, 308.04307816990786, 354.24953989539404, 407.3869708797031, 468.49501651165855, 538.7692689884072, 619.5846593366683, 712.5223582371685, 819.4007119727437, 942.3108187686552, 1083.6574415839534, 1246.2060578215462, 1433.136966494778, 1648.1075114689947, 1895.323638189344, 2179.622183917745, 2506.565511505407, 2882.5503382312177, 3314.9328889659, 3812.172822310785, 4383.998745657402, 5041.598557506012, 5797.838341131914, 6667.5140923017, 7667.641206146955, 8817.787387068996, 10140.455495129345, 11661.523819398746, 13410.752392308557, 15422.365251154839, 17735.720038828065, 20396.078044652273, 23455.489751350113, 26973.813214052625, 31019.885196160518, 35672.867975584595, 41023.79817192228, 47177.36789771062, 54253.97308236721, 62392.06904472228, 71750.87940143062, 82513.5113116452, 94890.53800839197, 109124.11870965076, 125492.73651609836, 144316.6469935131, 165964.14404254008, 190858.76564892105, 219487.5804962592, 252410.71757069806, 290272.32520630275, 333813.17398724816, 383885.1500853353, 441467.9225981356, 507688.1109878559, 583841.3276360342, 671417.5267814393, 772130.1557986551, 887949.6791684533, 1021142.1310437213, 1174313.4507002793, 1350460.4683053212, 1553029.5385511192, 1785983.969333787, 2053881.564733855, 2361963.7994439327, 2716258.369360523, 3123697.124764601, 3592251.6934792907, 4131089.447501184, 4750752.864626361, 5463365.794320315, 6282870.663468362, 7225301.262988616, 8309096.452436907, 9555460.920302443, 10988780.058347808, 12637097.067099977, 14532661.627164973, 16712560.871239718, 19219445.001925673, 22102361.752214525, 25417716.0150467, 29230373.417303704, 33614929.42989926, 38657168.84438414, 44455744.17104176, 51124105.79669802, 58792721.66620272, 67611629.91613312, 77753374.40355308, 89416380.56408603, 102828837.64869894, 118253163.29600377, 135991137.79040432, 156389808.45896497, 179848279.7278097, 206825521.68698114, 237849349.94002828, 273526752.4310325, 314555765.2956874, 361739130.09004045, 415999999.60354644, 478399999.5440784, 550159999.4756901, 632683999.3970436, 727586599.3066001, 836724589.20259, 962233277.5829784, 1106568269.2204251, 1272553509.6034887, 1463436536.044012, 1682952016.4506137, 1935394818.9182055, 2225704041.755936, 2559559648.019326, 2943493595.222225, 3385017634.5055585, 3892770279.681392, 4476685821.6336, 5148188694.87864, 5920416999.1104355, 6808479548.977001, 7829751481.32355, 9004214203.522081, 10354846334.050394, 11908073284.157951, 13694284276.781643, 15748426918.29889, 18110690956.04372, 20827294599.450275, 23951388789.367817, 27544097107.772987, 31675711673.938934, 36427068425.02977, 41891128688.78423, 48174797992.10186, 55401017690.91714, 63711170344.5547, 73267845896.2379, 84258022780.67358, 96896726197.77461, 111431235127.4408, 128145920396.5569, 147367808456.04044, 169472979724.44647, 194893926683.11343, 224128015685.58044, 257747218038.41748, 296409300744.1801, 340870695855.80707, 392001300234.1781, 450801495269.3048, 518421719559.70044, 596184977493.6555, 685612724117.7037, 788454632735.3593, 906722827645.6631, 1042731251792.5125, 1199140939561.3892, 1379012080495.5974, 1585863892569.937, 1823743476455.4275, 2097304997923.7415, 2411900747612.3022, 2773685859754.1475, 3189738738717.2695, 3668199549524.8594, 4218429481953.5884, 4851193904246.626, 5578872989883.619, 6415703938366.162, 7378059529121.086, 8484768458489.248, 9757483727262.635, 11221106286352.03, 12904272229304.832, 14839913063700.555, 17065900023255.637, 19625785026743.98, 22569652780755.58, 25955100697868.91, 29848365802549.246, 34325620672931.63, 39474463773871.375, 45395633339952.07, 52204978340944.88, 60035725092086.61, 69041083855899.59, 79397246434284.53, 91306833399427.2, 105002858409341.27, 120753287170742.45, 138866280246353.81, 159696222283306.88, 183650655625802.88, 211198253969673.3, 242877992065124.28, 279309690874892.9, 321206144506126.8, 369387066182045.8, 424795126109352.6, 488514395025755.5, 561791554279618.75, 646060287421561.5, 742969330534795.8, 854414730115015.0, 982576939632267.1, 1129963480577107.2, 1299458002663673.2, 1494376703063224.0, 1718533208522707.5, 1976313189801113.5, 2272760168271280.5, 2613674193511972.0, 3005725322538767.5, 3456584120919582.5, 3975071739057519.5, 4571332499916147.0, 5257032374903569.0, 6045587231139104.0, 6952425315809969.0, 7995289113181464.0, 9194582480158682.0, 1.0573769852182484e+16, 1.2159835330009856e+16, 1.3983810629511332e+16, 1.6081382223938032e+16, 1.8493589557528736e+16, 2.1267627991158044e+16, 2.4457772189831748e+16, 2.8126438018306508e+16, 3.234540372105248e+16, 3.719721427921035e+16, 4.27767964210919e+16, 4.919331588425568e+16, 5.657231326689403e+16, 6.505816025692813e+16, 7.481688429546734e+16, 8.603941693978744e+16, 9.894532948075555e+16, 1.1378712890286886e+17, 1.3085519823829918e+17, 1.5048347797404406e+17, 1.7305599967015066e+17, 1.9901439962067325e+17, 2.288665595637742e+17, 2.6319654349834032e+17, 3.026760250230913e+17, 3.48077428776555e+17, 4.002890430930382e+17, 4.603323995569939e+17, 5.29382259490543e+17, 6.087895984141244e+17, 7.00108038176243e+17, 8.051242439026793e+17, 9.258928804880812e+17, 1.0647768125612933e+18, 1.224493334445487e+18, 1.4081673346123103e+18, 1.6193924348041567e+18, 1.8623013000247798e+18, 2.1416464950284966e+18, 2.462893469282771e+18, 2.8323274896751867e+18, 3.257176613126464e+18, 3.7457531050954337e+18, 4.3076160708597484e+18, 4.95375848148871e+18, 5.696822253712016e+18, 6.551345591768818e+18, 7.53404743053414e+18, 8.66415454511426e+18, 9.963777726881399e+18, 1.1458344385913608e+19, 1.3177096043800648e+19, 1.5153660450370744e+19, 1.7426709517926355e+19, 2.0040715945615307e+19, 2.30468233374576e+19, 2.650384683807624e+19, 3.047942386378767e+19, 3.505133744335582e+19, 4.030903805985919e+19, 4.635539376883806e+19, 5.330870283416377e+19, 6.130500825928833e+19, 7.0500759498181575e+19, 8.10758734229088e+19, 9.323725443634512e+19, 1.0722284260179688e+20, 1.233062689920664e+20, 1.4180220934087634e+20, 1.6307254074200778e+20, 1.8753342185330894e+20, 2.1566343513130526e+20, 2.4801295040100103e+20, 2.8521489296115116e+20, 3.2799712690532385e+20, 3.7719669594112236e+20, 4.337762003322907e+20, 4.988426303821342e+20, 5.7366902493945437e+20, 6.597193786803724e+20, 7.586772854824282e+20, 8.724788783047925e+20, 1.0033507100505113e+21, 1.1538533165580878e+21, 1.326931314041801e+21, 1.5259710111480708e+21, 1.7548666628202813e+21, 2.0180966622433234e+21, 2.3208111615798217e+21, 2.668932835816795e+21, 3.0692727611893135e+21, 3.529663675367711e+21, 4.059113226672867e+21, 4.667980210673796e+21, 5.368177242274866e+21, 6.173403828616095e+21, 7.099414402908508e+21, 8.164326563344784e+21, 9.388975547846502e+21, 1.0797321880023475e+22, 1.2416920162026996e+22, 1.4279458186331043e+22, 1.64213769142807e+22, 1.8884583451422802e+22, 2.171727096913622e+22, 2.497486161450665e+22, 2.872109085668265e+22, 3.3029254485185042e+22, 3.798364265796279e+22, 4.368118905665721e+22, 5.0233367415155795e+22, 5.7768372527429155e+22, 6.643362840654352e+22, 7.639867266752504e+22, 8.78584735676538e+22, 1.0103724460280185e+23, 1.1619283129322213e+23, 1.3362175598720545e+23, 1.5366501938528623e+23, 1.7671477229307915e+23, 2.0322198813704103e+23, 2.3370528635759717e+23, 2.687610793112367e+23, 3.090752412079222e+23, 3.554365273891105e+23, 4.0875200649747705e+23, 4.700648074720986e+23, 5.405745285929133e+23, 6.216607078818502e+23, 7.149098140641278e+23, 8.221462861737468e+23, 9.454682290998088e+23, 1.0872884634647801e+24, 1.250381732984497e+24, 1.4379389929321714e+24, 1.653629841871997e+24, 1.9016743181527962e+24, 2.1869254658757156e+24, 2.5149642857570727e+24, 2.8922089286206334e+24, 3.326040267913728e+24, 3.824946308100787e+24, 4.3986882543159046e+24, 5.05849149246329e+24, 5.817265216332783e+24, 6.6898549987827e+24, 7.693333248600105e+24, 8.84733323589012e+24, 1.0174433221273637e+25, 1.1700598204464681e+25, 1.3455687935134384e+25, 1.547404112540454e+25, 1.779514729421522e+25, 2.04644193883475e+25, 2.353408229659962e+25, 2.7064194641089563e+25, 3.1123823837253e+25, 3.5792397412840944e+25, 4.116125702476708e+25, 4.733544557848214e+25, 5.443576241525446e+25, 6.260112677754262e+25, 7.199129579417401e+25, 8.27899901633001e+25, 9.52084886877951e+25, 1.0948976199096437e+26, 1.25913226289609e+26, 1.4480021023305035e+26, 1.665202417680079e+26, 1.9149827803320907e+26, 2.202230197381904e+26, 2.5325647269891895e+26, 2.9124494360375676e+26, 3.349316851443203e+26, 3.8517143791596826e+26, 4.429471536033635e+26, 5.09389226643868e+26, 5.857976106404481e+26, 6.736672522365153e+26, 7.747173400719924e+26, 8.909249410827912e+26, 1.0245636822452099e+27, 1.1782482345819913e+27, 1.35498546976929e+27, 1.5582332902346833e+27, 1.7919682837698857e+27, 2.0607635263353683e+27, 2.3698780552856732e+27, 2.725359763578524e+27, 3.1341637281153025e+27, 3.6042882873325974e+27, 4.1449315304324867e+27, 4.7666712599973594e+27, 5.481671948996963e+27, 6.303922741346507e+27, 7.249511152548482e+27, 8.336937825430755e+27, 9.587478499245366e+27, 1.102560027413217e+28, 1.2679440315251995e+28, 1.4581356362539794e+28, 1.6768559816920761e+28, 1.9283843789458875e+28, 2.2176420357877703e+28, 2.5502883411559357e+28, 2.932831592329326e+28, 3.3727563311787245e+28, 3.8786697808555327e+28, 4.460470247983863e+28, 5.129540785181441e+28, 5.8989719029586575e+28, 6.783817688402455e+28, 7.801390341662823e+28, 8.971598892912247e+28, 1.0317338726849081e+29, 1.1864939535876443e+29, 1.3644680466257909e+29, 1.5691382536196593e+29, 1.8045089916626083e+29, 2.0751853404119993e+29, 2.3864631414737988e+29, 2.7444326126948684e+29, 3.1560975045990984e+29, 3.629512130288963e+29, 4.173938949832307e+29, 4.800029792307153e+29, 5.520034261153225e+29, 6.348039400326208e+29, 7.300245310375139e+29, 8.39528210693141e+29, 9.65457442297112e+29, 1.1102760586416787e+30, 1.2768174674379305e+30, 1.46834008755362e+30, 1.6885911006866628e+30, 1.941879765789662e+30, 2.2331617306581113e+30, 2.568135990256828e+30, 2.9533563887953516e+30, 3.396359847114654e+30, 3.905813824181852e+30, 4.491685897809129e+30, 5.165438782480498e+30, 5.940254599852573e+30, 6.831292789830458e+30, 7.855986708305026e+30, 9.034384714550779e+30, 1.0389542421733396e+31, 1.1947973784993405e+31, 1.3740169852742412e+31, 1.5801195330653773e+31, 1.817137463025184e+31, 2.0897080824789613e+31, 2.4031642948508052e+31, 2.7636389390784257e+31, 3.1781847799401893e+31, 3.6549124969312175e+31, 4.2031493714709e+31, 4.833621777191535e+31, 5.558665043770264e+31, 6.392464800335803e+31, 7.3513345203861735e+31, 8.454034698444098e+31, 9.722139903210713e+31, 1.1180460888692319e+32, 1.2857530021996165e+32, 1.478615952529559e+32, 1.7004083454089925e+32, 1.9554695972203414e+32, 2.2487900368033926e+32, 2.586108542323901e+32, 2.974024823672486e+32, 3.420128547223359e+32, 3.933147829306862e+32, 4.523120003702891e+32, 5.2015880042583246e+32, 5.981826204897073e+32, 6.879100135631634e+32, 7.910965155976377e+32, 9.097609929372833e+32, 1.0462251418778757e+33, 1.2031589131595571e+33, 1.3836327501334904e+33, 1.591177662653514e+33, 1.8298543120515409e+33, 2.104332458859272e+33, 2.4199823276881623e+33, 2.7829796768413863e+33, 3.200426628367594e+33, 3.6804906226227334e+33, 4.232564216016143e+33, 4.867448848418564e+33, 5.597566175681348e+33, 6.437201102033549e+33, 7.402781267338582e+33, 8.513198457439368e+33, 9.790178226055273e+33, 1.1258704959963564e+34, 1.2947510703958096e+34, 1.488963730955181e+34, 1.712308290598458e+34, 1.9691545341882266e+34, 2.2645277143164603e+34, 2.604206871463929e+34, 2.994837902183518e+34, 3.4440635875110457e+34, 3.960673125637702e+34, 4.554774094483357e+34, 5.237990208655861e+34, 6.023688739954239e+34, 6.927242050947375e+34, 7.96632835858948e+34, 9.161277612377902e+34, 1.0535469254234585e+35, 1.2115789642369772e+35, 1.3933158088725236e+35, 1.6023131802034022e+35, 1.8426601572339122e+35, 2.119059180818999e+35, 2.4369180579418488e+35, 2.8024557666331258e+35, 3.2228241316280944e+35, 3.706247751372308e+35, 4.262184914078154e+35, 4.901512651189877e+35, 5.636739548868358e+35, 6.482250481198611e+35, 7.454588053378403e+35, 8.572776261385162e+35, 9.858692700592935e+35, 1.1337496605681875e+36, 1.3038121096534156e+36, 1.499383926101428e+36, 1.7242915150166418e+36, 1.982935242269138e+36, 2.2803755286095084e+36] diff --git a/benchmarks/json-data/twitter1.json b/benchmarks/json-data/twitter1.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/twitter1.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"80430860","profile_image_url":"http://a2.twimg.com/profile_images/536455139/icon32_normal.png","created_at":"Wed, 26 Jan 2011 07:07:02 +0000","from_user":"kazu_yamamoto","id_str":"30159761706061824","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell Server Pages \u3063\u3066\u3001\u307e\u3060\u7d9a\u3044\u3066\u3044\u305f\u306e\u304b\uff01","id":30159761706061824,"from_user_id":80430860,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30159761706061824,"since_id":0,"refresh_url":"?since_id=30159761706061824&q=haskell","next_page":"?page=2&max_id=30159761706061824&rpp=1&q=haskell","results_per_page":1,"page":1,"completed_in":0.012606,"since_id_str":"0","max_id_str":"30159761706061824","query":"haskell"} diff --git a/benchmarks/json-data/twitter10.json b/benchmarks/json-data/twitter10.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/twitter10.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=10&q=haskell","results_per_page":10,"page":1,"completed_in":0.012714,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"} diff --git a/benchmarks/json-data/twitter100.json b/benchmarks/json-data/twitter100.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/twitter100.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"3646730","profile_image_url":"http://a3.twimg.com/profile_images/404973767/avatar_normal.jpg","created_at":"Wed, 26 Jan 2011 04:35:07 +0000","from_user":"nicolaslara","id_str":"30121530767708160","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 Python y Clojure. Obviamente son diferentes, y cada uno tiene sus ventajas y desventajas. De Haskell faltar\u00eda pattern matching","id":30121530767708160,"from_user_id":3646730,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"5912444","profile_image_url":"http://a2.twimg.com/profile_images/546261026/ssf0xg11_normal.jpg","created_at":"Wed, 26 Jan 2011 00:45:45 +0000","from_user":"shelarcy","id_str":"30063810773516288","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @Hackage: download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30063810773516288,"from_user_id":5912444,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:41:00 +0000","from_user":"kudzu_naoki","id_str":"30062613287141376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u9b54\u6cd5Haskell\u5c11\u5973\u5019\u88dc\u3092\u63a2\u3059\u306e\u3082\u5927\u5909\u306a\u3093\u3060","id":30062613287141376,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:40:25 +0000","from_user":"omasanori","id_str":"30062465656033280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9b54\u6cd5Haskell\u5c11\u5973\u306e\u4e00\u65e5\u306fGHC HEAD\u306e\u30d3\u30eb\u30c9\u304b\u3089\u59cb\u307e\u308b","id":30062465656033280,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Wed, 26 Jan 2011 00:37:12 +0000","from_user":"omasanori","id_str":"30061656331526144","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061656331526144,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"135993","profile_image_url":"http://a2.twimg.com/profile_images/1190667086/myface2010small_normal.jpg","created_at":"Wed, 26 Jan 2011 00:35:42 +0000","from_user":"kudzu_naoki","id_str":"30061282665168896","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30061282665168896,"from_user_id":135993,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"1631333","profile_image_url":"http://a1.twimg.com/profile_images/81268862/profile300_normal.jpg","created_at":"Wed, 26 Jan 2011 00:30:02 +0000","from_user":"qnighy","id_str":"30059855884582913","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tanakh: \u50d5\u3068\u5951\u7d04\u3057\u3066\u9b54\u6cd5Haskell\u5c11\u5973\u306b\u306a\u308d\u3046\u3088\uff01","id":30059855884582913,"from_user_id":1631333,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9093754","profile_image_url":"http://a1.twimg.com/profile_images/99435906/PHD_3d_col_blk_normal.jpg","created_at":"Wed, 26 Jan 2011 00:26:20 +0000","from_user":"phdwine","id_str":"30058925516656640","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Last weekend of Tri Nations Tasting with PHD wines at Haskell Vineyards. Hope you didn't miss the Pinot Noir tasting last week !","id":30058925516656640,"from_user_id":9093754,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"2119923","profile_image_url":"http://a2.twimg.com/profile_images/1096701078/djayprofile_normal.jpg","created_at":"Wed, 26 Jan 2011 00:21:14 +0000","from_user":"djay75","id_str":"30057639543050240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30057639543050240,"from_user_id":2119923,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"134323731","profile_image_url":"http://a2.twimg.com/profile_images/1225818824/IMG00518-20110125-1547_normal.jpg","created_at":"Wed, 26 Jan 2011 00:19:30 +0000","from_user":"PrinceOfBrkeley","id_str":"30057205554216960","metadata":{"result_type":"recent"},"to_user_id":167093027,"text":"@PayThaPrince go to haskell.","id":30057205554216960,"from_user_id":134323731,"to_user":"PayThaPrince","geo":null,"iso_language_code":"en","to_user_id_str":"167093027","source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"705857","profile_image_url":"http://a1.twimg.com/profile_images/429483912/ben_twitter_normal.jpg","created_at":"Wed, 26 Jan 2011 00:03:28 +0000","from_user":"bennadel","id_str":"30053166972141569","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Using #Homebrew to install Haskell - the last of the Seven Languages (in Seven Weeks) http://bit.ly/eA9Cv1 This has been some journey.","id":30053166972141569,"from_user_id":705857,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"251466","profile_image_url":"http://a2.twimg.com/profile_images/1194100934/pass_normal.jpg","created_at":"Wed, 26 Jan 2011 00:02:54 +0000","from_user":"simonszu","id_str":"30053025502466048","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Ouh yeah! Ich werde doch produktiv sein, diese Semesterferien. Ich werde funktional Programmieren lernen. #haskell, Baby.","id":30053025502466048,"from_user_id":251466,"geo":null,"iso_language_code":"de","to_user_id_str":null,"source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"357786","profile_image_url":"http://a0.twimg.com/profile_images/612044841/FM_2010_normal.jpg","created_at":"Tue, 25 Jan 2011 23:59:13 +0000","from_user":"diligiant","id_str":"30052100973006848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @paulrbrown: "...we only discovered a single bug after compilation." (http://t.co/K0wlEYz) #haskell","id":30052100973006848,"from_user_id":357786,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"101597523","profile_image_url":"http://a1.twimg.com/profile_images/1206183256/2010-12-12-204902_normal.jpg","created_at":"Tue, 25 Jan 2011 23:54:46 +0000","from_user":"wlad_kent","id_str":"30050977964892160","metadata":{"result_type":"recent"},"to_user_id":86297184,"text":"@Nilson_Neto Isso eh bem basico. quando vc estiver estudando recurs\u00e3o em Haskell, ai vc vai ver oq eh papo de nerd - kkk - 1\u00ba periodo isso.","id":30050977964892160,"from_user_id":101597523,"to_user":"Nilson_Neto","geo":null,"iso_language_code":"pt","to_user_id_str":"86297184","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 23:51:22 +0000","from_user":"listwarenet","id_str":"30050123383832577","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84336-haskell-cafe-monomorphic-let-bindings-and-darcs.html Haskell-cafe - Monomorph","id":30050123383832577,"from_user_id":144546280,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"5776901","profile_image_url":"http://a0.twimg.com/profile_images/472682157/lucabw_normal.JPG","created_at":"Tue, 25 Jan 2011 23:48:40 +0000","from_user":"lsbardel","id_str":"30049446469312512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Very interesting technology stack these guys use http://bit.ly/ghAjS7 #python #redis #haskell","id":30049446469312512,"from_user_id":5776901,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"3005901","profile_image_url":"http://a0.twimg.com/profile_images/278943006/Lone_Pine_Peak_-_Peter_200x200_normal.jpg","created_at":"Tue, 25 Jan 2011 23:45:48 +0000","from_user":"pmonks","id_str":"30048721110573056","metadata":{"result_type":"recent"},"to_user_id":203834278,"text":"@techielicous Haskell: http://bit.ly/gy3oFi ;-)","id":30048721110573056,"from_user_id":3005901,"to_user":"techielicous","geo":null,"iso_language_code":"en","to_user_id_str":"203834278","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"162697074","profile_image_url":"http://a2.twimg.com/profile_images/826205838/ryan3_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:47 +0000","from_user":"TheRonaldMCD","id_str":"30048468781244416","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Aldi Food Market (4122 Gaston Ave, Haskell, Dallas) http://4sq.com/ekqRY7","id":30048468781244416,"from_user_id":162697074,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"203834278","profile_image_url":"http://a0.twimg.com/profile_images/1223375080/me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:44:04 +0000","from_user":"techielicous","id_str":"30048286589067264","metadata":{"result_type":"recent"},"to_user_id":3005901,"text":"@pmonks I was thinking Haskell or Scheme","id":30048286589067264,"from_user_id":203834278,"to_user":"pmonks","geo":null,"iso_language_code":"en","to_user_id_str":"3005901","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"537690","profile_image_url":"http://a3.twimg.com/profile_images/45665122/nushiostamp_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:14 +0000","from_user":"nushio","id_str":"30046818658164737","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u305d\u3046\u3044\u3084\u5951\u7d04\u306b\u3088\u308b\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0\u3068\u304b\u3042\u3063\u305f\u306a\u3002Haskell\u306a\u3093\u304b\u3088\u308a\u3042\u3063\u3061\u306e\u65b9\u304c\u9b54\u6cd5\u5c11\u5973\u547c\u3070\u308f\u308a\u306b\u3075\u3055\u308f\u3057\u3044\u3002","id":30046818658164737,"from_user_id":537690,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"181192","profile_image_url":"http://a2.twimg.com/profile_images/1089890701/q530888600_9828_normal.jpg","created_at":"Tue, 25 Jan 2011 23:38:03 +0000","from_user":"aodag","id_str":"30046772223016960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046772223016960,"from_user_id":181192,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"5886055","profile_image_url":"http://a3.twimg.com/profile_images/85531669/ichi_normal.jpg","created_at":"Tue, 25 Jan 2011 23:37:53 +0000","from_user":"kanaya","id_str":"30046729243983873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u9e97\u3057\u3044\u3002\u201c@omasanori: \u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d\u201d","id":30046729243983873,"from_user_id":5886055,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/app/twitter/id333903271?mt=8" rel="nofollow">Twitter for iPad</a>"},{"from_user_id_str":"52620546","profile_image_url":"http://a1.twimg.com/profile_images/434693356/twitter-icon_normal.png","created_at":"Tue, 25 Jan 2011 23:36:26 +0000","from_user":"omasanori","id_str":"30046367187476481","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u300c\u3082\u3046\u4f55\u5e74\u3082Haskell\u306e\u3053\u3068\u3057\u304b\u8003\u3048\u3066\u306a\u304b\u3063\u305f\u304b\u3089\u306a\u3001\u30eb\u30fc\u30d7\u306e\u4f7f\u3044\u65b9\u5fd8\u308c\u3066\u305f\u300d","id":30046367187476481,"from_user_id":52620546,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.movatwi.jp" rel="nofollow">www.movatwi.jp</a>"},{"from_user_id_str":"1659992","profile_image_url":"http://a1.twimg.com/profile_images/504488750/1_normal.jpg","created_at":"Tue, 25 Jan 2011 23:16:13 +0000","from_user":"finalfusion","id_str":"30041278544609280","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30041278544609280,"from_user_id":1659992,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"272513","profile_image_url":"http://a2.twimg.com/profile_images/320244078/Mike_Painting2_normal.png","created_at":"Tue, 25 Jan 2011 23:05:09 +0000","from_user":"mikehadlow","id_str":"30038492373319680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just written the same simple program in C#, F# and Haskell: 18, 12 and 9 LoC respectively. And I'm much better at C# than F# or Haskell.","id":30038492373319680,"from_user_id":272513,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"89393264","profile_image_url":"http://a0.twimg.com/profile_images/1169486472/020_portland_me_normal.jpg","created_at":"Tue, 25 Jan 2011 23:01:28 +0000","from_user":"newsportlandme","id_str":"30037564589084673","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Governor's Choice to Run Maine DOC Under Scrutiny - MPBN: State Rep. Anne Haskell, a Portland Democrat, says Mai... http://bit.ly/fO30gC","id":30037564589084673,"from_user_id":89393264,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"38138","profile_image_url":"http://a3.twimg.com/profile_images/1212565885/Screen_shot_2011-01-11_at_5.28.47_PM_normal.png","created_at":"Tue, 25 Jan 2011 22:59:55 +0000","from_user":"michaelneale","id_str":"30037174615281664","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The haskell EvilMangler http://t.co/P2Tls7J","id":30037174615281664,"from_user_id":38138,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"45692","profile_image_url":"http://a3.twimg.com/profile_images/1177741507/dogkarno_r_normal.jpg","created_at":"Tue, 25 Jan 2011 22:45:06 +0000","from_user":"karno","id_str":"30033448286552064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3063\u3066\u95a2\u6570\u306b\u30ab\u30ec\u30fc\u7c89\u3076\u3061\u8fbc\u3080\u3068\u304b\u306a\u3093\u3068\u304b","id":30033448286552064,"from_user_id":45692,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://yubitter.com/" rel="nofollow">yubitter</a>"},{"from_user_id_str":"27605","profile_image_url":"http://a2.twimg.com/profile_images/15826632/meron_normal.jpg","created_at":"Tue, 25 Jan 2011 22:44:23 +0000","from_user":"celeron1ghz","id_str":"30033268761956352","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @necocen: Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30033268761956352,"from_user_id":27605,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:43:30 +0000","from_user":"necocen","id_str":"30033044035346432","metadata":{"result_type":"recent"},"to_user_id":null,"text":"\u307e\u3042Haskell\u77e5\u3089\u3093\u3057\u306d","id":30033044035346432,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"12901","profile_image_url":"http://a1.twimg.com/profile_images/56091349/haruhi_nagato-Y_normal.jpg","created_at":"Tue, 25 Jan 2011 22:42:54 +0000","from_user":"necocen","id_str":"30032894856531968","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u306e\u30df\u30b5\u30ef\u3001\u3068\u3044\u3046\u3082\u306e\u3092\u8003\u3048\u3066\u307f\u3066\u3071\u3063\u3068\u3057\u306a\u3044","id":30032894856531968,"from_user_id":12901,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"10821270","profile_image_url":"http://a0.twimg.com/profile_images/1195474259/Salto_Marlon_normal.jpg","created_at":"Tue, 25 Jan 2011 22:35:09 +0000","from_user":"jjedMoriAnktah","id_str":"30030942106025984","metadata":{"result_type":"recent"},"to_user_id":null,"text":""A Haskell program that outputs a Python program that outputs a Ruby program that outputs the original Haskell program" http://is.gd/E6Julu","id":30030942106025984,"from_user_id":10821270,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"7554762","profile_image_url":"http://a0.twimg.com/profile_images/100515212/ajay-photo_normal.jpg","created_at":"Tue, 25 Jan 2011 22:34:30 +0000","from_user":"comatose_kid","id_str":"30030780205899776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @bumptech: Bump Dev Blog - Why we use Haskell at Bump http://devblog.bu.mp/haskell-at-bump","id":30030780205899776,"from_user_id":7554762,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"148474705","profile_image_url":"http://a0.twimg.com/profile_images/1119234716/fur_hat_-_gilbeys_vodka_-_life_-_11-30-1962_normal.JPG","created_at":"Tue, 25 Jan 2011 22:29:19 +0000","from_user":"landmvintage","id_str":"30029476003840000","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @faerymoongodess: Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30029476003840000,"from_user_id":148474705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"37715508","profile_image_url":"http://a1.twimg.com/profile_images/1207891411/ballerina_normal.jpg","created_at":"Tue, 25 Jan 2011 22:24:52 +0000","from_user":"faerymoongodess","id_str":"30028356326002688","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Magnificent Miriam Haskell Baroque Pearl Necklace by @MercyMadge http://etsy.me/hqRl51","id":30028356326002688,"from_user_id":37715508,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 22:17:16 +0000","from_user":"Hackage","id_str":"30026442456694784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"base16-bytestring 0.1.0.0, added by BryanOSullivan: Fast base16 (hex) encoding and deconding for ByteStrings http://bit.ly/eu75TN","id":30026442456694784,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"199750997","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 22:12:07 +0000","from_user":"benreads","id_str":"30025146991382528","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Writing Systems Software in a Functional Language -- brief, but fun. I want to see how well they can make Systems Haskell perform at scale.","id":30025146991382528,"from_user_id":199750997,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"35359797","profile_image_url":"http://a1.twimg.com/profile_images/1173453785/48893_521140819_1896062_q_normal.jpg","created_at":"Tue, 25 Jan 2011 22:09:45 +0000","from_user":"jcawthorne1","id_str":"30024549265309696","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just saw Jeff Haskell give the middle finger!! Lol awesome","id":30024549265309696,"from_user_id":35359797,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Tue, 25 Jan 2011 22:06:44 +0000","from_user":"goodfox","id_str":"30023790381498369","metadata":{"result_type":"recent"},"to_user_id":null,"text":"At the Haskell Convocation. (@ Haskell Indian Nations U Auditorium) http://4sq.com/eKKXyn","id":30023790381498369,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"14674418","profile_image_url":"http://a2.twimg.com/profile_images/238230125/IMG_1030-1_normal.jpg","created_at":"Tue, 25 Jan 2011 22:02:31 +0000","from_user":"sanityinc","id_str":"30022731919523840","metadata":{"result_type":"recent"},"to_user_id":371289,"text":"@xshay Haskell's great, but Clojure's similarly lazy in all the ways that matter, and is more practical for day-to-day use.","id":30022731919523840,"from_user_id":14674418,"to_user":"xshay","geo":null,"iso_language_code":"en","to_user_id_str":"371289","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"371289","profile_image_url":"http://a2.twimg.com/profile_images/1113482439/me-brisbane_normal.jpg","created_at":"Tue, 25 Jan 2011 21:58:29 +0000","from_user":"xshay","id_str":"30021714444292096","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Just made a lazy sequence of prime numbers in haskell. I'm smitten.","id":30021714444292096,"from_user_id":371289,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"199453873","profile_image_url":"http://a3.twimg.com/a/1294785484/images/default_profile_3_normal.png","created_at":"Tue, 25 Jan 2011 21:48:40 +0000","from_user":"stackfeed","id_str":"30019243982454784","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Practical Scala reference manual, for searching things like method names: Hello, \n\nInspired by\nHaskell API Searc... http://bit.ly/g4zWZQ","id":30019243982454784,"from_user_id":199453873,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:32 +0000","from_user":"aapnoot","id_str":"30018455189065728","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018455189065728,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"aapnoot","id_str":"30018452601180160","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/eHfiJB","id":30018452601180160,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Tue, 25 Jan 2011 21:45:31 +0000","from_user":"Hackage","id_str":"30018451867176960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"download 0.3.1, added by MagnusTherning: High-level file download based on URLs http://bit.ly/i8mYvi","id":30018451867176960,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"138502705","profile_image_url":"http://a1.twimg.com/profile_images/1083845614/yclogo_normal.gif","created_at":"Tue, 25 Jan 2011 21:45:04 +0000","from_user":"newsyc100","id_str":"30018340839755777","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell improves log processing 4x over Python http://devblog.bu.mp/haskell-at-bump (http://bit.ly/gQxxR8)","id":30018340839755777,"from_user_id":138502705,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://news.ycombinator.com" rel="nofollow">newsyc</a>"},{"from_user_id_str":"1578246","profile_image_url":"http://a0.twimg.com/profile_images/59312315/avatar_simpson_small_normal.jpg","created_at":"Tue, 25 Jan 2011 21:43:32 +0000","from_user":"magthe","id_str":"30017953801969665","metadata":{"result_type":"recent"},"to_user_id":null,"text":"New version of download uploaded to #hackage #haskell","id":30017953801969665,"from_user_id":1578246,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://api.supertweet.net" rel="nofollow">MyAuth API Proxy</a>"},{"from_user_id_str":"135838970","profile_image_url":"http://a2.twimg.com/profile_images/1079929891/logo_normal.png","created_at":"Tue, 25 Jan 2011 21:37:51 +0000","from_user":"reward999","id_str":"30016525180084224","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Found Great Dane (Main & Haskell- Dallas): We found a great dane. 214-712-0000 http://bit.ly/fQ8iBw","id":30016525180084224,"from_user_id":135838970,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"137719265","profile_image_url":"http://a2.twimg.com/profile_images/1092224079/8__4__normal.jpg","created_at":"Tue, 25 Jan 2011 21:34:22 +0000","from_user":"WeiMatas","id_str":"30015646020411392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Fourth day Rez party Eddie Haskell County in second life \u2013 which took place in cabaret Tadd","id":30015646020411392,"from_user_id":137719265,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://dlvr.it" rel="nofollow">dlvr.it</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Tue, 25 Jan 2011 21:33:21 +0000","from_user":"listwarenet","id_str":"30015392571195392","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/83889-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Haskell-cafe -","id":30015392571195392,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"}],"max_id":30121530767708160,"since_id":0,"refresh_url":"?since_id=30121530767708160&q=haskell","next_page":"?page=2&max_id=30121530767708160&rpp=100&q=haskell","results_per_page":100,"page":1,"completed_in":1.195569,"since_id_str":"0","max_id_str":"30121530767708160","query":"haskell"} diff --git a/benchmarks/json-data/twitter20.json b/benchmarks/json-data/twitter20.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/twitter20.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"166199691","profile_image_url":"http://a2.twimg.com/profile_images/1252958188/38_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"_classicc","id_str":"41191052790603776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"my twitter is actin slow today.","id":41191052790603776,"from_user_id":166199691,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"138835410","profile_image_url":"http://a1.twimg.com/profile_images/1250985094/243321801_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"amereronday","id_str":"41191050307567616","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter jail, here i come.","id":41191050307567616,"from_user_id":138835410,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"359548","profile_image_url":"http://a2.twimg.com/profile_images/53612334/don_otvos_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"donnyo","id_str":"41191050110451712","metadata":{"result_type":"recent"},"to_user_id":7074534,"text":"@stlsmallbiz I see there is currently a Twitter promo too....tempting....","id":41191050110451712,"from_user_id":359548,"to_user":"stlsmallbiz","geo":null,"iso_language_code":"en","place":{"id":"82b7b2f97b12261d","type":"poi","full_name":"Yammer Inc, San Francisco"},"to_user_id_str":"7074534","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"122523770","profile_image_url":"http://a0.twimg.com/profile_images/1073533262/11646_1076222405045_1810798478_156114_3663737_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:26 +0000","from_user":"msBreChan","id_str":"41191049720238080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"so twitter gt spam now -_-","id":41191049720238080,"from_user_id":122523770,"geo":{"type":"Point","coordinates":[35.2213,-80.8276]},"iso_language_code":"en","place":{"id":"4d5ed95f830e9b41","type":"neighborhood","full_name":"Elizabeth, Charlotte"},"to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"229024950","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_6_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"NinaMaechik","id_str":"41191047853912064","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Glad I can remember my twitter password! LOL! Hugs to Nick from his aunties...","id":41191047853912064,"from_user_id":229024950,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"215545822","profile_image_url":"http://a2.twimg.com/profile_images/1239909540/RTL_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"RightToLaugh","id_str":"41191047371558912","metadata":{"result_type":"recent"},"to_user_id":null,"text":"#Bacon wrapped dates http://bit.ly/hUxVC9 Just like my grandma used to make http://twitter.com/#","id":41191047371558912,"from_user_id":215545822,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"217845526","profile_image_url":"http://a0.twimg.com/sticky/default_profile_images/default_profile_3_normal.png","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"TheShoeLooker","id_str":"41191047052804096","metadata":{"result_type":"recent"},"to_user_id":38033240,"text":"@ShoeDazzle love love love to twitter or blog about your deals and shoes!\ntheshoelooker.blogspot.com","id":41191047052804096,"from_user_id":217845526,"to_user":"shoedazzle","geo":null,"iso_language_code":"en","to_user_id_str":"38033240","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"24953438","profile_image_url":"http://a3.twimg.com/profile_images/1181252763/76820_10150100014748783_677998782_7386695_4377006_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"liljermaine32","id_str":"41191046025056256","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Twitter fam I gotta question 4 ya is texas south or midwest #arguments","id":41191046025056256,"from_user_id":24953438,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://mobile.twitter.com" rel="nofollow">Twitter for Android</a>"},{"from_user_id_str":"122451024","profile_image_url":"http://a2.twimg.com/profile_images/1143400129/100706-ETCanada_201134_1__normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:25 +0000","from_user":"Kim_DEon","id_str":"41191045161164801","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Help @CARE @EvaLongoria and ME use Twitter to change the lives of girls in poverty across the world! Ready? Go to http://TwitChange.com NOW!","id":41191045161164801,"from_user_id":122451024,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128351479","profile_image_url":"http://a3.twimg.com/profile_images/1150198829/Kirby_Photo__edit__normal.JPG","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"TheDaveKirby","id_str":"41191043894493184","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Maybe its time to clean house...MY HOUSE http://bit.ly/ejG22P","id":41191043894493184,"from_user_id":128351479,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"87512773","profile_image_url":"http://a0.twimg.com/profile_images/1252511106/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"supportthehood","id_str":"41191043206610946","metadata":{"result_type":"recent"},"to_user_id":2467330,"text":"@eastcoastmp3 #FF it's the way twitter works !!!","id":41191043206610946,"from_user_id":87512773,"to_user":"eastcoastmp3","geo":null,"iso_language_code":"en","to_user_id_str":"2467330","source":"<a href="http://twitter.com/" rel="nofollow">Twitter for iPhone</a>"},{"from_user_id_str":"149894545","profile_image_url":"http://a0.twimg.com/profile_images/1219334400/patrick_camo_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"suburbpat","id_str":"41191040912330752","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I havent had a rib session on twitter in a while.......I wanna Rib with a nigga with alot followers lol","id":41191040912330752,"from_user_id":149894545,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"97749622","profile_image_url":"http://a0.twimg.com/profile_images/1254640781/IMG1633A_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:24 +0000","from_user":"jrricardosantos","id_str":"41191040547430400","metadata":{"result_type":"recent"},"to_user_id":101017476,"text":"@yofzs pq tirou o CAPS LOCK? kkkk tava bem legal...hehehe eu estou no t\u00e9dio...kkk tbm estou no twitter e msn..aff!!","id":41191040547430400,"from_user_id":97749622,"to_user":"yofzs","geo":null,"iso_language_code":"en","to_user_id_str":"101017476","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"94381536","profile_image_url":"http://a1.twimg.com/profile_images/1174777929/41509_100001699300415_3521888_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"DonNieves","id_str":"41191038978752512","metadata":{"result_type":"recent"},"to_user_id":151926400,"text":"@TiiH13 cheira meu ovo, no email, no orkut, no msn, no facebook, no twitter, no skype, no spark, no ICQ e no google talk","id":41191038978752512,"from_user_id":94381536,"to_user":"TiiH13","geo":null,"iso_language_code":"en","to_user_id_str":"151926400","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"211858432","profile_image_url":"http://a3.twimg.com/profile_images/1231906180/JonasBrothers_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"OriginalJBfans","id_str":"41191038328651776","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I literally forgot about this twitter... so whats occuring followers?","id":41191038328651776,"from_user_id":211858432,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"90317132","profile_image_url":"http://a3.twimg.com/profile_images/1230085056/254101635_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"Just2smooth","id_str":"41191036936126464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wassup twitter","id":41191036936126464,"from_user_id":90317132,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"144771504","profile_image_url":"http://a1.twimg.com/profile_images/1243343836/image_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:23 +0000","from_user":"ima_b_b_badman","id_str":"41191036638339072","metadata":{"result_type":"recent"},"to_user_id":null,"text":"i been M.I.A. all day twitter my bad","id":41191036638339072,"from_user_id":144771504,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207922664","profile_image_url":"http://a2.twimg.com/profile_images/1237106108/258356167_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"itsthecarter_","id_str":"41191036013391873","metadata":{"result_type":"recent"},"to_user_id":null,"text":"twitter is a stupid addiction.","id":41191036013391873,"from_user_id":207922664,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://ubersocial.com" rel="nofollow">\u00dcberSocial</a>"},{"from_user_id_str":"150000649","profile_image_url":"http://a0.twimg.com/profile_images/1237789059/belllaa_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"angelicabrvo","id_str":"41191035707207680","metadata":{"result_type":"recent"},"to_user_id":null,"text":"que hubo twitter? huy que feoxd","id":41191035707207680,"from_user_id":150000649,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"185713003","profile_image_url":"http://a2.twimg.com/profile_images/1191421540/163229_177015295661467_154687431227587_492170_2147500_n_normal.jpg","created_at":"Fri, 25 Feb 2011 17:41:22 +0000","from_user":"downbytheshores","id_str":"41191033945595905","metadata":{"result_type":"recent"},"to_user_id":null,"text":"follow us on twitter\nwww.twitter.com/downbytheshores http://fb.me/DhDS915e","id":41191033945595905,"from_user_id":185713003,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"}],"max_id":41191052790603776,"since_id":38643906774044672,"refresh_url":"?since_id=41191052790603776&q=twitter","next_page":"?page=2&max_id=41191052790603776&rpp=20&lang=en&q=twitter","results_per_page":20,"page":1,"completed_in":0.128719,"warning":"adjusted since_id to 38643906774044672 (), requested since_id was older than allowed -- since_id removed for pagination.","since_id_str":"38643906774044672","max_id_str":"41191052790603776","query":"twitter"} diff --git a/benchmarks/json-data/twitter50.json b/benchmarks/json-data/twitter50.json new file mode 100644 --- /dev/null +++ b/benchmarks/json-data/twitter50.json @@ -0,0 +1,1 @@ +{"results":[{"from_user_id_str":"207858021","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 04:30:38 +0000","from_user":"pboudarga","id_str":"30120402839666689","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Rolla Sushi Grill (27737 Bouquet Canyon Road, #106, Btw Haskell Canyon and Rosedell Drive, Saugus) http://4sq.com/gqqdhs","id":30120402839666689,"from_user_id":207858021,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"69988683","profile_image_url":"http://a0.twimg.com/profile_images/1211955817/avatar_7888_normal.gif","created_at":"Wed, 26 Jan 2011 04:25:23 +0000","from_user":"YNK33","id_str":"30119083059978240","metadata":{"result_type":"recent"},"to_user_id":null,"text":"hsndfile 0.5.0: Free and open source Haskell bindings for libsndfile http://bit.ly/gHaBWG Mac Os","id":30119083059978240,"from_user_id":69988683,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"81492","profile_image_url":"http://a1.twimg.com/profile_images/423894208/Picture_7_normal.jpg","created_at":"Wed, 26 Jan 2011 04:24:28 +0000","from_user":"satzz","id_str":"30118851488251904","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Emacs\u306e\u30e2\u30fc\u30c9\u8868\u793a\u304c\u4eca(Ruby Controller Outputz RoR Flymake REl hs)\u3068\u306a\u3063\u3066\u3066\u3088\u304f\u308f\u304b\u3089\u306a\u3044\u3093\u3060\u3051\u3069\u6700\u5f8c\u306eREl\u3068\u304bhs\u3063\u3066\u4f55\u3060\u308d\u3046\u2026haskell\u3068\u304b2\u5e74\u4ee5\u4e0a\u66f8\u3044\u3066\u306a\u3044\u3051\u3069\u2026","id":30118851488251904,"from_user_id":81492,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://www.hootsuite.com" rel="nofollow">HootSuite</a>"},{"from_user_id_str":"9518356","profile_image_url":"http://a2.twimg.com/profile_images/119165723/ocaml-icon_normal.png","created_at":"Wed, 26 Jan 2011 04:19:19 +0000","from_user":"planet_ocaml","id_str":"30117557788741632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I so miss #haskell type classes in #ocaml - i want to do something like refinement. Also why does ocaml not have... http://bit.ly/geYRwt","id":30117557788741632,"from_user_id":9518356,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"218059","profile_image_url":"http://a1.twimg.com/profile_images/1053837723/twitter-icon9_normal.jpg","created_at":"Wed, 26 Jan 2011 04:16:32 +0000","from_user":"aprikip","id_str":"30116854940835840","metadata":{"result_type":"recent"},"to_user_id":null,"text":"yatex-mode\u3084haskell-mode\u306e\u3053\u3068\u3067\u3059\u306d\u3001\u308f\u304b\u308a\u307e\u3059\u3002","id":30116854940835840,"from_user_id":218059,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://sites.google.com/site/yorufukurou/" rel="nofollow">YoruFukurou</a>"},{"from_user_id_str":"216363","profile_image_url":"http://a1.twimg.com/profile_images/72454310/Tim-Avatar_normal.png","created_at":"Wed, 26 Jan 2011 04:15:30 +0000","from_user":"dysinger","id_str":"30116594684264448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell in Hawaii tonight for me... #fun","id":30116594684264448,"from_user_id":216363,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.nambu.com/" rel="nofollow">Nambu</a>"},{"from_user_id_str":"1774820","profile_image_url":"http://a2.twimg.com/profile_images/61169291/dan_desert_thumb_normal.jpg","created_at":"Wed, 26 Jan 2011 04:13:36 +0000","from_user":"DanMil","id_str":"30116117682851840","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire @tomheon Haskell isn't a language, it's a belief system. A seductive one...","id":30116117682851840,"from_user_id":1774820,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"659256","profile_image_url":"http://a0.twimg.com/profile_images/746976711/angular-final_normal.jpg","created_at":"Wed, 26 Jan 2011 04:11:06 +0000","from_user":"djspiewak","id_str":"30115488931520512","metadata":{"result_type":"recent"},"to_user_id":null,"text":"One of the very nice things about Haskell as opposed to SML is the reduced proliferation of identifiers (e.g. andb, orb, etc). #typeclasses","id":30115488931520512,"from_user_id":659256,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 04:06:12 +0000","from_user":"listwarenet","id_str":"30114255890026496","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-cafe/84752-re-haskell-cafe-gpl-license-of-h-matrix-and-prelude-numeric.html Re: Haskell-c","id":30114255890026496,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 04:01:29 +0000","from_user":"ojrac","id_str":"30113067333324800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @tomheon: @ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30113067333324800,"from_user_id":1594784,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"207589736","profile_image_url":"http://a3.twimg.com/profile_images/1225527428/headshot_1_normal.jpg","created_at":"Wed, 26 Jan 2011 04:00:13 +0000","from_user":"ashleevelazq101","id_str":"30112747555397632","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/dONnpn","id":30112747555397632,"from_user_id":207589736,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"Hackage","id_str":"30112192346984448","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112192346984448,"from_user_id":17671137,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"17489366","profile_image_url":"http://a3.twimg.com/sticky/default_profile_images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 03:58:00 +0000","from_user":"aapnoot","id_str":"30112191881420800","metadata":{"result_type":"recent"},"to_user_id":null,"text":"streams 0.4, added by EdwardKmett: Various Haskell 2010 stream comonads http://bit.ly/idBkPe","id":30112191881420800,"from_user_id":17489366,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"8530482","profile_image_url":"http://a2.twimg.com/profile_images/137867266/n608671563_7396_normal.jpg","created_at":"Wed, 26 Jan 2011 03:50:12 +0000","from_user":"jeffmclamb","id_str":"30110229207187456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Angel - daemon to run and monitor processes like daemontools or god, written in Haskell http://ff.im/-wNyLk","id":30110229207187456,"from_user_id":8530482,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://friendfeed.com" rel="nofollow">FriendFeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:46:01 +0000","from_user":"tomheon","id_str":"30109174645919744","metadata":{"result_type":"recent"},"to_user_id":1594784,"text":"@ojrac @chewedwire Don't worry, learning Haskell will not give you any clear idea what monad means.","id":30109174645919744,"from_user_id":177539201,"to_user":"ojrac","geo":null,"iso_language_code":"en","to_user_id_str":"1594784","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"1594784","profile_image_url":"http://a2.twimg.com/profile_images/378515773/square-profile_normal.jpg","created_at":"Wed, 26 Jan 2011 03:44:34 +0000","from_user":"ojrac","id_str":"30108808684503040","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire @tomheon Why are you making me curious about Haskell? I LIKE not knowing what monad means!!","id":30108808684503040,"from_user_id":1594784,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"23750094","profile_image_url":"http://a0.twimg.com/profile_images/951373780/Moeinthecar_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:54 +0000","from_user":"shokalshab","id_str":"30108140443795456","metadata":{"result_type":"recent"},"to_user_id":null,"text":"I'm at Magnitude Cheer @ Gymnastics Olympica USA (7735 Haskell Ave., btw Saticoy & Strathern, Van Nuys) http://4sq.com/gmXfaL","id":30108140443795456,"from_user_id":23750094,"geo":null,"iso_language_code":"en","place":{"id":"4e4a2a2f86cb2946","type":"poi","full_name":"Gymnastics Olympica USA, Van Nuys"},"to_user_id_str":null,"source":"<a href="http://foursquare.com" rel="nofollow">foursquare</a>"},{"from_user_id_str":"8135112","profile_image_url":"http://a0.twimg.com/profile_images/1165240350/LIMITED_normal.jpg","created_at":"Wed, 26 Jan 2011 03:41:35 +0000","from_user":"Claricei","id_str":"30108059208515584","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @kristenmchugh22: @KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30108059208515584,"from_user_id":8135112,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:40:02 +0000","from_user":"chewedwire","id_str":"30107670367182848","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon Cool, I'll take a look. I feel like I should mention this: http://bit.ly/hVstDM","id":30107670367182848,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"8679778","profile_image_url":"http://a3.twimg.com/profile_images/1195318056/me_nyc_12_18_10_icon_normal.jpg","created_at":"Wed, 26 Jan 2011 03:38:42 +0000","from_user":"kristenmchugh22","id_str":"30107332381777920","metadata":{"result_type":"recent"},"to_user_id":756269,"text":"@KeithOlbermann Ryan looks like Jughead w/o the hat. And sounds as mealy-mouthed as Eddie Haskell.","id":30107332381777920,"from_user_id":8679778,"to_user":"KeithOlbermann","geo":null,"iso_language_code":"en","to_user_id_str":"756269","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"103316559","profile_image_url":"http://a1.twimg.com/profile_images/1179458751/bc3beab4-d59d-4e78-b13b-50747986cfa2_normal.png","created_at":"Wed, 26 Jan 2011 03:36:15 +0000","from_user":"cityslikr","id_str":"30106719153557504","metadata":{"result_type":"recent"},"to_user_id":null,"text":""Social safety net into a hammock." So says Eddie Haskell with the GOP response. #SOTU","id":30106719153557504,"from_user_id":103316559,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://blackberry.com/twitter" rel="nofollow">Twitter for BlackBerry\u00ae</a>"},{"from_user_id_str":"169063143","profile_image_url":"http://a0.twimg.com/profile_images/1160506212/9697_1_normal.gif","created_at":"Wed, 26 Jan 2011 03:31:52 +0000","from_user":"wrkforce_safety","id_str":"30105614919143424","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Federal investigation finds safety violations at The Acadia Hospital: By Meg Haskell, BDN Staff The investigatio... http://bit.ly/gA60C1","id":30105614919143424,"from_user_id":169063143,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 03:29:40 +0000","from_user":"tomheon","id_str":"30105060960632832","metadata":{"result_type":"recent"},"to_user_id":128028225,"text":"@chewedwire Great book on Haskell: http://oreilly.com/catalog/9780596514983","id":30105060960632832,"from_user_id":177539201,"to_user":"chewedwire","geo":null,"iso_language_code":"en","to_user_id_str":"128028225","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"782692","profile_image_url":"http://a0.twimg.com/profile_images/1031304589/Profile.2007.1_normal.jpg","created_at":"Wed, 26 Jan 2011 03:29:19 +0000","from_user":"turnageb","id_str":"30104974591533057","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @ovillalon: Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104974591533057,"from_user_id":782692,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:28:04 +0000","from_user":"chewedwire","id_str":"30104657267265536","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon I always loved the pattern matching in SML and it looks like Haskell is MUCH better at it. I'm messing around now at tryhaskell.org","id":30104657267265536,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"12834082","profile_image_url":"http://a3.twimg.com/profile_images/1083036140/mugshot_normal.png","created_at":"Wed, 26 Jan 2011 03:28:01 +0000","from_user":"ovillalon","id_str":"30104647213518848","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Paul Ryan solves the mystery of whatever happened to Eddie Haskell. #sotu","id":30104647213518848,"from_user_id":12834082,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:26:02 +0000","from_user":"goodfox","id_str":"30104146455560192","metadata":{"result_type":"recent"},"to_user_id":10226179,"text":"@billykeene22 Bordeaux is one of my heroes. I was so excited when he accepted the invitation to campus. He's been a great friend to Haskell.","id":30104146455560192,"from_user_id":13540930,"to_user":"billykeene22","geo":null,"iso_language_code":"en","to_user_id_str":"10226179","source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 03:25:18 +0000","from_user":"josej30","id_str":"30103962313031681","metadata":{"result_type":"recent"},"to_user_id":14870909,"text":"@cris7ian Ahh bueno multiparadigma ya es respetable :) Empezar\u00e9 a explotar la parte funcional de los lenguajes ahora #Haskell","id":30103962313031681,"from_user_id":18616016,"to_user":"Cris7ian","geo":null,"iso_language_code":"es","to_user_id_str":"14870909","source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"14870909","profile_image_url":"http://a2.twimg.com/profile_images/1176930429/oso_yo_normal.png","created_at":"Wed, 26 Jan 2011 03:23:43 +0000","from_user":"Cris7ian","id_str":"30103562360983553","metadata":{"result_type":"recent"},"to_user_id":18616016,"text":"@josej30 hahaha no, es multiparadigma y es bastante lazy. Nothing like haskell, pero s\u00ed, el de Flash","id":30103562360983553,"from_user_id":14870909,"to_user":"josej30","geo":null,"iso_language_code":"es","to_user_id_str":"18616016","source":"<a href="http://www.echofon.com/" rel="nofollow">Echofon</a>"},{"from_user_id_str":"2421643","profile_image_url":"http://a0.twimg.com/profile_images/1190361665/ernestgrumbles-17_normal.jpg","created_at":"Wed, 26 Jan 2011 03:20:24 +0000","from_user":"ernestgrumbles","id_str":"30102730756333568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Wow... WolframAlpha did not know who Eddie Haskell is. Guess I'll never use that "knowledge engine" again.","id":30102730756333568,"from_user_id":2421643,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"128028225","profile_image_url":"http://a1.twimg.com/profile_images/1224994593/Coding_Drunk_normal.jpg","created_at":"Wed, 26 Jan 2011 03:14:21 +0000","from_user":"chewedwire","id_str":"30101204428132352","metadata":{"result_type":"recent"},"to_user_id":177539201,"text":"@tomheon How is Haskell better/different from CL or Scheme? I honestly don't know, although I'm becoming more curious.","id":30101204428132352,"from_user_id":128028225,"to_user":"tomheon","geo":null,"iso_language_code":"en","to_user_id_str":"177539201","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"13540930","profile_image_url":"http://a1.twimg.com/profile_images/1205312219/23467_350321383101_821143101_5114147_3010041_n_normal.jpg","created_at":"Wed, 26 Jan 2011 03:06:54 +0000","from_user":"goodfox","id_str":"30099329809129473","metadata":{"result_type":"recent"},"to_user_id":null,"text":"A day of vision & speeches. #SOTU now. And a wonderful Haskell Convocation address earlier today by Sinte Gleske President Lionel Bordeaux.","id":30099329809129473,"from_user_id":13540930,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.ubertwitter.com/bb/download.php" rel="nofollow">\u00dcberTwitter</a>"},{"from_user_id_str":"119185220","profile_image_url":"http://a0.twimg.com/profile_images/1089027228/dfg_normal.jpg","created_at":"Wed, 26 Jan 2011 03:03:38 +0000","from_user":"LaLiciouz_03","id_str":"30098510623805440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"The Game with the girl room 330 Haskell follow us...","id":30098510623805440,"from_user_id":119185220,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"18616016","profile_image_url":"http://a2.twimg.com/profile_images/1173522726/214397343_normal.jpg","created_at":"Wed, 26 Jan 2011 02:57:25 +0000","from_user":"josej30","id_str":"30096946144215040","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Voy a extra\u00f1ar Haskell cuando regrese al mundo imperativo. Hay alg\u00fan lenguaje imperativo que tenga este poder funcional? #ci3661","id":30096946144215040,"from_user_id":18616016,"geo":null,"iso_language_code":"es","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"17671137","profile_image_url":"http://a2.twimg.com/profile_images/290264834/Haskell-logo-outer-glow_normal.png","created_at":"Wed, 26 Jan 2011 02:55:32 +0000","from_user":"Hackage","id_str":"30096471814574080","metadata":{"result_type":"recent"},"to_user_id":null,"text":"comonad-transformers 0.9.0, added by EdwardKmett: Haskell 98 comonad transformers http://bit.ly/h6xIsf","id":30096471814574080,"from_user_id":17671137,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://twitterfeed.com" rel="nofollow">twitterfeed</a>"},{"from_user_id_str":"177539201","profile_image_url":"http://a0.twimg.com/profile_images/1178368800/img_normal.jpeg","created_at":"Wed, 26 Jan 2011 02:48:12 +0000","from_user":"tomheon","id_str":"30094626920603649","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Every time I look at Haskell I love it more.","id":30094626920603649,"from_user_id":177539201,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"60792568","profile_image_url":"http://a0.twimg.com/profile_images/1203647517/glenda-flash_normal.jpg","created_at":"Wed, 26 Jan 2011 02:40:42 +0000","from_user":"r_takaishi","id_str":"30092735935422464","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell\u3088\u308aD\u8a00\u8a9e\u304c\u4e0a\u3068\u306f\u601d\u308f\u306a\u304b\u3063\u305f\uff0e http://www.tiobe.com/index.php/content/paperinfo/tpci/index.html","id":30092735935422464,"from_user_id":60792568,"geo":null,"iso_language_code":"ja","to_user_id_str":null,"source":"<a href="http://twmode.sf.net/" rel="nofollow">twmode</a>"},{"from_user_id_str":"160145510","profile_image_url":"http://a0.twimg.com/profile_images/1218108166/going_galt_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:31 +0000","from_user":"wtp1787","id_str":"30092439653974018","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @KLSouth: Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092439653974018,"from_user_id":160145510,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"96616016","profile_image_url":"http://a1.twimg.com/profile_images/1196978169/Picture0002_normal.jpg","created_at":"Wed, 26 Jan 2011 02:39:20 +0000","from_user":"MelissaRNMBA","id_str":"30092392203816960","metadata":{"result_type":"recent"},"to_user_id":14862975,"text":"@KLSouth At least Eddie Haskell was entertaining.","id":30092392203816960,"from_user_id":96616016,"to_user":"KLSouth","geo":null,"iso_language_code":"en","to_user_id_str":"14862975","source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"14862975","profile_image_url":"http://a0.twimg.com/profile_images/421596393/kls_4_normal.JPG","created_at":"Wed, 26 Jan 2011 02:38:29 +0000","from_user":"KLSouth","id_str":"30092178327871489","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Eddie Haskell Goes to Washington... "You look really nice tonight, Ms Cleaver"","id":30092178327871489,"from_user_id":14862975,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.tweetdeck.com" rel="nofollow">TweetDeck</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 02:36:17 +0000","from_user":"listwarenet","id_str":"30091626869161984","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84641-haskell-beginners-wildcards-in-expressions.html Haskell-beginners - Wild","id":30091626869161984,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"24538048","profile_image_url":"http://a2.twimg.com/profile_images/1117267605/rope_normal.jpg","created_at":"Wed, 26 Jan 2011 02:23:14 +0000","from_user":"dbph","id_str":"30088341030440960","metadata":{"result_type":"recent"},"to_user_id":null,"text":"RT @dnene: Skilled Calisthenics. Haskell code that outputs python which spits ruby which emits the haskell source. http://j.mp/YlQUL via @mfeathers","id":30088341030440960,"from_user_id":24538048,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:58:31 +0000","from_user":"YubaVetTech","id_str":"30082124207886336","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigious Hayward Award for \u2018Excellence in Education\u2019. This award honors... http://fb.me/QgQCxd74","id":30082124207886336,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"158951567","profile_image_url":"http://a3.twimg.com/profile_images/962721419/Logo_3_normal.jpg","created_at":"Wed, 26 Jan 2011 01:56:04 +0000","from_user":"YubaVetTech","id_str":"30081505476743168","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Dr. Haskell has just been awarded the prestigous Haward Award for Excellence in Education. This award honors... http://fb.me/PC9mYmCR","id":30081505476743168,"from_user_id":158951567,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://www.facebook.com/twitter" rel="nofollow">Facebook</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:43:50 +0000","from_user":"Verus","id_str":"30078427155406848","metadata":{"result_type":"recent"},"to_user_id":79273052,"text":"@kami_joe \u3044\u3084\uff0c\u8ab2\u984c\u306f\u89e3\u6c7a\u5bfe\u8c61(\u30d1\u30ba\u30eb\u3068\u304b)\u3092\u4e0e\u3048\u3089\u308c\u3066\uff0c\u554f\u984c\u5b9a\u7fa9\u3068\u30d7\u30ed\u30b0\u30e9\u30df\u30f3\u30b0(\u6307\u5b9a\u8a00\u8a9e\u306fC++\u3082\u3057\u304f\u306fJava)\u3068\u3044\u3046\u3044\u308f\u3070\u666e\u901a\u306a\u8ab2\u984c\u3067\u306f\u3042\u308b\u3093\u3060\u3051\u3069\uff0e\u95a2\u6570\u578b\u8a00\u8a9e\u306fHaskell\u306e\u6388\u696d\u304c\u307e\u305f\u5225\u306b\u3042\u308b\u306e\uff0e","id":30078427155406848,"from_user_id":2331498,"to_user":"kami_joe","geo":null,"iso_language_code":"ja","to_user_id_str":"79273052","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"79151233","profile_image_url":"http://a2.twimg.com/a/1295051201/images/default_profile_2_normal.png","created_at":"Wed, 26 Jan 2011 01:40:37 +0000","from_user":"cz_newdrafts","id_str":"30077617361125376","metadata":{"result_type":"recent"},"to_user_id":null,"text":"Haskell programming language http://bit.ly/gpPAwB","id":30077617361125376,"from_user_id":79151233,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://tommorris.org/" rel="nofollow">tommorris' hacksample</a>"},{"from_user_id_str":"2331498","profile_image_url":"http://a3.twimg.com/profile_images/494632120/me_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:57 +0000","from_user":"Verus","id_str":"30068139416879104","metadata":{"result_type":"recent"},"to_user_id":9252720,"text":"@shukukei Java\u3068C\u306f\u3042\u308b\u7a0b\u5ea6\u66f8\u3051\u3066\u3042\u305f\u308a\u307e\u3048\u306a\u3068\u3053\u308d\u304c\u3042\u308b\u304b\u3089\u306a\u30fc\uff0ePython\u306f\u500b\u4eba\u7684\u306b\u611f\u899a\u304c\u5408\u308f\u306a\u3044\uff0e\u611f\u899a\u306a\u306e\u3067\uff0c\u3082\u3046\u3069\u3046\u3057\u3088\u3046\u3082\u306a\u3044\uff57 \u3044\u307e\u306fScala\u3068Haskell\u3092\u3082\u3063\u3068\u6975\u3081\u305f\u3044\u3068\u3053\u308d\uff0e","id":30068139416879104,"from_user_id":2331498,"to_user":"shukukei","geo":null,"iso_language_code":"ja","to_user_id_str":"9252720","source":"<a href="http://itunes.apple.com/us/app/twitter/id409789998?mt=12" rel="nofollow">Twitter for Mac</a>"},{"from_user_id_str":"2781460","profile_image_url":"http://a0.twimg.com/profile_images/82526625/.joeyicon_normal.jpg","created_at":"Wed, 26 Jan 2011 01:02:35 +0000","from_user":"joeyhess","id_str":"30068046538219520","metadata":{"result_type":"recent"},"to_user_id":null,"text":"just figured out that I can use parameterized types to remove a dependency loop in git-annex's type definitions. whee #haskell","id":30068046538219520,"from_user_id":2781460,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://identi.ca" rel="nofollow">identica</a>"},{"from_user_id_str":"144546280","profile_image_url":"http://a1.twimg.com/a/1295051201/images/default_profile_1_normal.png","created_at":"Wed, 26 Jan 2011 00:54:22 +0000","from_user":"listwarenet","id_str":"30065977920061440","metadata":{"result_type":"recent"},"to_user_id":null,"text":"http://www.listware.net/201101/haskell-beginners/84466-haskell-beginners-bytestring-question.html Haskell-beginners - Bytestrin","id":30065977920061440,"from_user_id":144546280,"geo":null,"iso_language_code":"no","to_user_id_str":null,"source":"<a href="http://1e10.org/cloud/" rel="nofollow">1e10</a>"},{"from_user_id_str":"1291845","profile_image_url":"http://a0.twimg.com/profile_images/1225743404/ThinOxygen-small-opaque-solidarity_normal.png","created_at":"Wed, 26 Jan 2011 00:52:07 +0000","from_user":"_aaron_","id_str":"30065412242669568","metadata":{"result_type":"recent"},"to_user_id":null,"text":"wanted: librly licensed high level native compiled lang with min runtime (otherwise cobra/mono would be perfect) for win. lua? haskell? ooc?","id":30065412242669568,"from_user_id":1291845,"geo":null,"iso_language_code":"en","to_user_id_str":null,"source":"<a href="http://twitter.com/">web</a>"}],"max_id":30120402839666689,"since_id":0,"refresh_url":"?since_id=30120402839666689&q=haskell","next_page":"?page=2&max_id=30120402839666689&rpp=50&q=haskell","results_per_page":50,"page":1,"completed_in":0.291696,"since_id_str":"0","max_id_str":"30120402839666689","query":"haskell"} diff --git a/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hs b/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hs new file mode 100644 --- /dev/null +++ b/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/ReadInt.hs @@ -0,0 +1,72 @@ +{-# LANGUAGE CPP #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MagicHash #-} +{-# LANGUAGE BangPatterns #-} + +-- Copyright : Erik de Castro Lopo +-- License : BSD3 + +module Network.Wai.Handler.Warp.ReadInt ( + readInt + , readInt64 + ) where + +-- This function lives in its own file because the MagicHash pragma interacts +-- poorly with the CPP pragma. + +import Data.ByteString (ByteString) +import qualified Data.ByteString as S +import Data.Int (Int64) +import GHC.Prim +import GHC.Types +import GHC.Word + +{-# INLINE readInt #-} +readInt :: Integral a => ByteString -> a +readInt bs = fromIntegral $ readInt64 bs + +-- This function is used to parse the Content-Length field of HTTP headers and +-- is a performance hot spot. It should only be replaced with something +-- significantly and provably faster. +-- +-- It needs to be able work correctly on 32 bit CPUs for file sizes > 2G so we +-- use Int64 here and then make a generic 'readInt' that allows conversion to +-- Int and Integer. + +{-# NOINLINE readInt64 #-} +readInt64 :: ByteString -> Int64 +readInt64 bs = S.foldl' (\ !i !c -> i * 10 + fromIntegral (mhDigitToInt c)) 0 + $ S.takeWhile isDigit bs + +data Table = Table !Addr# + +{-# NOINLINE mhDigitToInt #-} +mhDigitToInt :: Word8 -> Int +#if MIN_VERSION_base(4,16,0) +mhDigitToInt (W8# i) = I# (word2Int# (word8ToWord# (indexWord8OffAddr# addr (word2Int# (word8ToWord# i))))) +#else +mhDigitToInt (W8# i) = I# (word2Int# (indexWord8OffAddr# addr (word2Int# i))) +#endif + where + !(Table addr) = table + table :: Table + table = Table + "\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x01\x02\x03\x04\x05\x06\x07\x08\x09\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\ + \\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00"# + +isDigit :: Word8 -> Bool +isDigit w = w >= 48 && w <= 57 diff --git a/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hs b/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hs new file mode 100644 --- /dev/null +++ b/benchmarks/warp-3.0.1.1/Network/Wai/Handler/Warp/RequestHeader.hs @@ -0,0 +1,172 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE BangPatterns #-} + +module Network.Wai.Handler.Warp.RequestHeader ( + parseHeaderLines + , parseByteRanges + ) where + +import Control.Exception (Exception, throwIO) +import Control.Monad (when) +import Data.Typeable (Typeable) +import qualified Data.ByteString as S +import qualified Data.ByteString.Char8 as B (unpack, readInteger) +import Data.ByteString.Internal (ByteString(..), memchr) +import qualified Data.CaseInsensitive as CI +import Data.Word (Word8) +import Foreign.ForeignPtr (withForeignPtr) +import Foreign.Ptr (Ptr, plusPtr, minusPtr, nullPtr) +import Foreign.Storable (peek) +import qualified Network.HTTP.Types as H +-- import Network.Wai.Handler.Warp.Types +import qualified Network.HTTP.Types.Header as HH +-- $setup +-- >>> :set -XOverloadedStrings + +data InvalidRequest = NotEnoughLines [String] + | BadFirstLine String + | NonHttp + | IncompleteHeaders + | ConnectionClosedByPeer + | OverLargeHeader + deriving (Eq, Typeable, Show) + +instance Exception InvalidRequest + +---------------------------------------------------------------- + +parseHeaderLines :: [ByteString] + -> IO (H.Method + ,ByteString -- Path + ,ByteString -- Path, parsed + ,ByteString -- Query + ,H.HttpVersion + ,H.RequestHeaders + ) +parseHeaderLines [] = throwIO $ NotEnoughLines [] +parseHeaderLines (firstLine:otherLines) = do + (method, path', query, httpversion) <- parseRequestLine firstLine + let path = H.extractPath path' + hdr = map parseHeader otherLines + return (method, path', path, query, httpversion, hdr) + +---------------------------------------------------------------- + +-- | +-- +-- >>> parseRequestLine "GET / HTTP/1.1" +-- ("GET","/","",HTTP/1.1) +-- >>> parseRequestLine "POST /cgi/search.cgi?key=foo HTTP/1.0" +-- ("POST","/cgi/search.cgi","?key=foo",HTTP/1.0) +-- >>> parseRequestLine "GET " +-- *** Exception: Warp: Invalid first line of request: "GET " +-- >>> parseRequestLine "GET /NotHTTP UNKNOWN/1.1" +-- *** Exception: Warp: Request line specified a non-HTTP request +parseRequestLine :: ByteString + -> IO (H.Method + ,ByteString -- Path + ,ByteString -- Query + ,H.HttpVersion) +parseRequestLine requestLine@(PS fptr off len) = withForeignPtr fptr $ \ptr -> do + when (len < 14) $ throwIO baderr + let methodptr = ptr `plusPtr` off + limptr = methodptr `plusPtr` len + lim0 = fromIntegral len + + pathptr0 <- memchr methodptr 32 lim0 -- ' ' + when (pathptr0 == nullPtr || (limptr `minusPtr` pathptr0) < 11) $ + throwIO baderr + let pathptr = pathptr0 `plusPtr` 1 + lim1 = fromIntegral (limptr `minusPtr` pathptr0) + + httpptr0 <- memchr pathptr 32 lim1 -- ' ' + when (httpptr0 == nullPtr || (limptr `minusPtr` httpptr0) < 9) $ + throwIO baderr + let httpptr = httpptr0 `plusPtr` 1 + lim2 = fromIntegral (httpptr0 `minusPtr` pathptr) + + checkHTTP httpptr + !hv <- httpVersion httpptr + queryptr <- memchr pathptr 63 lim2 -- '?' + + let !method = bs ptr methodptr pathptr0 + !path + | queryptr == nullPtr = bs ptr pathptr httpptr0 + | otherwise = bs ptr pathptr queryptr + !query + | queryptr == nullPtr = S.empty + | otherwise = bs ptr queryptr httpptr0 + + return (method,path,query,hv) + where + baderr = BadFirstLine $ B.unpack requestLine + check :: Ptr Word8 -> Int -> Word8 -> IO () + check p n w = do + w0 <- peek $ p `plusPtr` n + when (w0 /= w) $ throwIO NonHttp + checkHTTP httpptr = do + check httpptr 0 72 -- 'H' + check httpptr 1 84 -- 'T' + check httpptr 2 84 -- 'T' + check httpptr 3 80 -- 'P' + check httpptr 4 47 -- '/' + check httpptr 6 46 -- '.' + httpVersion httpptr = do + major <- peek $ httpptr `plusPtr` 5 + minor <- peek $ httpptr `plusPtr` 7 + return $ if major == (49 :: Word8) && minor == (49 :: Word8) then + H.http11 + else + H.http10 + bs ptr p0 p1 = PS fptr o l + where + o = p0 `minusPtr` ptr + l = p1 `minusPtr` p0 + +---------------------------------------------------------------- + +-- | +-- +-- >>> parseHeader "Content-Length:47" +-- ("Content-Length","47") +-- >>> parseHeader "Accept-Ranges: bytes" +-- ("Accept-Ranges","bytes") +-- >>> parseHeader "Host: example.com:8080" +-- ("Host","example.com:8080") +-- >>> parseHeader "NoSemiColon" +-- ("NoSemiColon","") + +parseHeader :: ByteString -> H.Header +parseHeader s = + let (k, rest) = S.break (== 58) s -- ':' + rest' = S.dropWhile (\c -> c == 32 || c == 9) $ S.drop 1 rest + in (CI.mk k, rest') + +parseByteRanges :: S.ByteString -> Maybe HH.ByteRanges +parseByteRanges bs1 = do + bs2 <- stripPrefix "bytes=" bs1 + (r, bs3) <- range bs2 + ranges (r:) bs3 + where + range bs2 = + case stripPrefix "-" bs2 of + Just bs3 -> do + (i, bs4) <- B.readInteger bs3 + Just (HH.ByteRangeSuffix i, bs4) + Nothing -> do + (i, bs3) <- B.readInteger bs2 + bs4 <- stripPrefix "-" bs3 + case B.readInteger bs4 of + Nothing -> Just (HH.ByteRangeFrom i, bs4) + Just (j, bs5) -> Just (HH.ByteRangeFromTo i j, bs5) + ranges front bs3 = + case stripPrefix "," bs3 of + Nothing -> Just (front []) + Just bs4 -> do + (r, bs5) <- range bs4 + ranges (front . (r:)) bs5 + + stripPrefix x y + | x `S.isPrefixOf` y = Just (S.drop (S.length x) y) + | otherwise = Nothing diff --git a/changelog.md b/changelog.md new file mode 100644 --- /dev/null +++ b/changelog.md @@ -0,0 +1,136 @@ +# 0.14.4 + +* Fix a segmentation fault when built against `text-2.0` +* Restructure project to allow more convenient usage of benchmark suite +* Allow benchmarks to build with GHC 9.2 + +# 0.14.3 + +* Support for GHC 9.2.1 + +# 0.14.2 + +* Support for GHC 9.2.1 + +# 0.14.1 + +* Added `Data.Attoparsec.ByteString.getChunk`. + +# 0.14.0 + +* Added `Data.Attoparsec.ByteString.takeWhileIncluding`. +* Make `Data.Attoparsec.{Text,ByteString}.Lazy.parseOnly` accept lazy input. + +# 0.13.2.1 + +* Improved performance of `Data.Attoparsec.Text.asciiCI` + +# 0.13.2.0 + +* `pure` is now strict in `Position` + +# 0.13.1.0 + +* `runScanner` now correctly returns the final state + (https://github.com/bos/attoparsec/issues/105). +* `Parser`, `ZeptoT`, `Buffer`, and `More` now expose `Semigroup` instances. +* `Parser`, and `ZeptoT` now expose `MonadFail` instances. + +# 0.13.0.2 + +* Restore the fast specialised character set implementation for Text +* Move testsuite from test-framework to tasty +* Performance optimization of takeWhile and takeWhile1 + +# 0.13.0.1 + +* Fixed a bug in the implementations of inClass and notInClass for + Text (https://github.com/bos/attoparsec/issues/103) + +# 0.13.0.0 + +* Made the parser type in the Zepto module a monad transformer + (needed by aeson's string unescaping parser). + +# 0.12.1.6 + +* Fixed a case folding bug in the ByteString version of stringCI. + +# 0.12.1.5 + +* Fixed an indexing bug in the new Text implementation of string, + reported by Michel Boucey. + +# 0.12.1.4 + +* Fixed a case where the string parser would consume an unnecessary + amount of input before failing a match, when it could bail much + earlier (https://github.com/bos/attoparsec/issues/97) + +* Added more context to error messages + (https://github.com/bos/attoparsec/pull/79) + +# 0.12.1.3 + +* Fixed incorrect tracking of Text lengths + (https://github.com/bos/attoparsec/issues/80) + +# 0.12.1.2 + +* Fixed the incorrect tracking of capacity if the initial buffer was + empty (https://github.com/bos/attoparsec/issues/75) + +# 0.12.1.1 + +* Fixed a data corruption bug that occurred under some circumstances + if a buffer grew after prompting for more input + (https://github.com/bos/attoparsec/issues/74) + +# 0.12.1.0 + +* Now compatible with GHC 7.9 + +* Reintroduced the Chunk class, used by the parsers package + +# 0.12.0.0 + +* A new internal representation makes almost all real-world parsers + faster, sometimes by big margins. For example, parsing JSON data + with aeson is now up to 70% faster. These performance improvements + also come with reduced memory consumption and some new capabilities. + +* The new match combinator gives both the result of a parse and the + input that it matched. + +* The test suite has doubled in size. This made it possible to switch + to the new internal representation with a decent degree of + confidence that everything was more or less working. + +* The benchmark suite now contains a small family of benchmarks taken + from real-world uses of attoparsec. + +* A few types that ought to have been private now are. + +* A few obsolete modules and functions have been marked as deprecated. + They will be removed from the next major release. + +# 0.11.3.0 + +* New function scientific is compatible with rational, but parses + integers more efficiently (https://github.com/bos/aeson/issues/198) + +# 0.11.2.0 + +* The new Chunk typeclass allows for some code sharing with Ed + Kmett's parsers package: http://hackage.haskell.org/package/parsers + +* New function runScanner generalises scan to return the final state + of the scanner as well as the input consumed. + +# 0.11.1.0 + +* New dependency: the scientific package. This allows us to parse + numbers much more efficiently. + +* peekWord8', peekChar': new primitive parsers that allow + single-character lookahead. diff --git a/examples/Atto_RFC2616.hs b/examples/Atto_RFC2616.hs new file mode 100644 --- /dev/null +++ b/examples/Atto_RFC2616.hs @@ -0,0 +1,45 @@ +{-# LANGUAGE BangPatterns #-} + +module Main (main) where + +import Control.Applicative +import Control.Exception (bracket) +import Control.Monad (forM_) +import Data.Attoparsec.ByteString +import RFC2616 +import System.Environment +import System.IO +import qualified Data.ByteString.Char8 as B + +refill :: Handle -> IO B.ByteString +refill h = B.hGet h (80*1024) + +listy :: FilePath -> Handle -> IO () +listy file h = do + r <- parseWith (refill h) (many request) =<< refill h + case r of + Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg + Done _ reqs -> print (length reqs) + +incrementy :: FilePath -> Handle -> IO () +incrementy file h = go (0::Int) =<< refill h + where + go !n is = do + r <- parseWith (refill h) request is + case r of + Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg + Done bs _req + | B.null bs -> do + s <- refill h + if B.null s + then print (n+1) + else go (n+1) s + | otherwise -> go (n+1) bs + +main :: IO () +main = do + args <- getArgs + forM_ args $ \arg -> + bracket (openFile arg ReadMode) hClose $ + -- listy arg + incrementy arg diff --git a/examples/Makefile b/examples/Makefile --- a/examples/Makefile +++ b/examples/Makefile @@ -1,4 +1,4 @@ -CC := gcc +CC := cc CFLAGS := -O3 -Wall # To make the code about 6% faster: # CFLAGS += -fwhole-program --combine @@ -12,4 +12,8 @@ clean: rm -f *.hi *.o c-http -vpath %.c $(HOME)/hg/http-parser +http_parser.c: http_parser.h + curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.c + +http_parser.h: + curl -O https://raw.githubusercontent.com/joyent/http-parser/master/http_parser.h diff --git a/examples/Parsec_RFC2616.hs b/examples/Parsec_RFC2616.hs --- a/examples/Parsec_RFC2616.hs +++ b/examples/Parsec_RFC2616.hs @@ -23,15 +23,16 @@ token = satisfy $ \c -> S.notMember (fromEnum c) set where set = S.fromList . map fromEnum $ ['\0'..'\31'] ++ "()<>@,;:\\\"/[]?={} \t" ++ ['\128'..'\255'] +isHorizontalSpace :: Char -> Bool isHorizontalSpace c = c == ' ' || c == '\t' skipHSpaces :: Stream s m Char => ParsecT s u m () skipHSpaces = skipMany1 (satisfy isHorizontalSpace) data Request = Request { - requestMethod :: String - , requestUri :: String - , requestProtocol :: String + _requestMethod :: String + , _requestUri :: String + , _requestProtocol :: String } deriving (Eq, Ord, Show) requestLine :: Stream s m Char => ParsecT s u m Request @@ -47,8 +48,8 @@ endOfLine = (string "\r\n" *> pure ()) <|> (char '\n' *> pure ()) data Header = Header { - headerName :: String - , headerValue :: [String] + _headerName :: String + , _headerValue :: [String] } deriving (Eq, Ord, Show) messageHeader :: Stream s m Char => ParsecT s u m Header @@ -61,14 +62,16 @@ request :: Stream s m Char => ParsecT s u m (Request, [Header]) request = (,) <$> requestLine <*> many messageHeader <* endOfLine +listy :: FilePath -> IO () listy arg = do r <- parseFromFile (many request) arg case r of Left err -> putStrLn $ arg ++ ": " ++ show err Right rs -> print (length rs) +chunky :: FilePath -> IO () chunky arg = bracket (openFile arg ReadMode) hClose $ \h -> - loop 0 =<< B.hGetContents h + loop (0::Int) =<< B.hGetContents h where loop !n bs | B.null bs = print n diff --git a/examples/RFC2616.hs b/examples/RFC2616.hs --- a/examples/RFC2616.hs +++ b/examples/RFC2616.hs @@ -5,86 +5,61 @@ Header(..) , Request(..) , Response(..) - , isToken - , messageHeader , request - , requestLine , response - , responseLine - , lowerHeader - , lookupHeader ) where -import Control.Applicative hiding (many) -import Data.Attoparsec as P -import qualified Data.Attoparsec.Char8 as P8 -import Data.Attoparsec.Char8 (char8, endOfLine, isDigit_w8) +import Control.Applicative +import Data.Attoparsec.ByteString as P +import Data.Attoparsec.ByteString.Char8 (char8, endOfLine, isDigit_w8) +import Data.ByteString (ByteString) import Data.Word (Word8) -import qualified Data.ByteString.Char8 as B hiding (map) -import qualified Data.ByteString as B (map) +import Data.Attoparsec.ByteString.Char8 (isEndOfLine, isHorizontalSpace) isToken :: Word8 -> Bool isToken w = w <= 127 && notInClass "\0-\31()<>@,;:\\\"/[]?={} \t" w skipSpaces :: Parser () -skipSpaces = satisfy P8.isHorizontalSpace *> skipWhile P8.isHorizontalSpace +skipSpaces = satisfy isHorizontalSpace *> skipWhile isHorizontalSpace data Request = Request { - requestMethod :: !B.ByteString - , requestUri :: !B.ByteString - , requestVersion :: !B.ByteString + requestMethod :: ByteString + , requestUri :: ByteString + , requestVersion :: ByteString } deriving (Eq, Ord, Show) -httpVersion :: Parser B.ByteString -httpVersion = string "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46) +httpVersion :: Parser ByteString +httpVersion = "HTTP/" *> P.takeWhile (\c -> isDigit_w8 c || c == 46) requestLine :: Parser Request -requestLine = do - method <- P.takeWhile1 isToken <* char8 ' ' - uri <- P.takeWhile1 (/=32) <* char8 ' ' - version <- httpVersion <* endOfLine - return $! Request method uri version +requestLine = Request <$> (takeWhile1 isToken <* char8 ' ') + <*> (takeWhile1 (/=32) <* char8 ' ') + <*> (httpVersion <* endOfLine) data Header = Header { - headerName :: !B.ByteString - , headerValue :: [B.ByteString] + headerName :: ByteString + , headerValue :: [ByteString] } deriving (Eq, Ord, Show) messageHeader :: Parser Header -messageHeader = do - header <- P.takeWhile isToken <* char8 ':' <* skipWhile P8.isHorizontalSpace - body <- takeTill P8.isEndOfLine <* endOfLine - bodies <- many $ skipSpaces *> takeTill P8.isEndOfLine <* endOfLine - return $! Header header (body:bodies) +messageHeader = Header + <$> (P.takeWhile isToken <* char8 ':' <* skipWhile isHorizontalSpace) + <*> ((:) <$> (takeTill isEndOfLine <* endOfLine) + <*> (many $ skipSpaces *> takeTill isEndOfLine <* endOfLine)) request :: Parser (Request, [Header]) request = (,) <$> requestLine <*> many messageHeader <* endOfLine data Response = Response { - responseVersion :: !B.ByteString - , responseCode :: !B.ByteString - , responseMsg :: !B.ByteString + responseVersion :: ByteString + , responseCode :: ByteString + , responseMsg :: ByteString } deriving (Eq, Ord, Show) responseLine :: Parser Response -responseLine = do - version <- httpVersion <* char8 ' ' - code <- P.takeWhile isDigit_w8 <* char8 ' ' - msg <- P.takeTill P8.isEndOfLine <* endOfLine - return $! Response version code msg +responseLine = Response <$> (httpVersion <* char8 ' ') + <*> (P.takeWhile isDigit_w8 <* char8 ' ') + <*> (takeTill isEndOfLine <* endOfLine) response :: Parser (Response, [Header]) response = (,) <$> responseLine <*> many messageHeader <* endOfLine - -lowerHeader :: Header -> Header -lowerHeader (Header n v) = Header (B.map toLower n) (map (B.map toLower) v) - where toLower w | w >= 65 && w <= 90 = w + 32 - | otherwise = w - -lookupHeader :: B.ByteString -> [Header] -> [B.ByteString] -lookupHeader k = go - where - go (Header n v:hs) - | k == n = v - | otherwise = go hs - go _ = [] diff --git a/examples/TestRFC2616.hs b/examples/TestRFC2616.hs deleted file mode 100644 --- a/examples/TestRFC2616.hs +++ /dev/null @@ -1,37 +0,0 @@ -{-# LANGUAGE BangPatterns #-} -import RFC2616 -import Control.Monad (forM_) -import System.IO -import Control.Exception (bracket) -import System.Environment -import qualified Data.ByteString.Char8 as B -import Data.Attoparsec - -refill h = B.hGet h (4*1024) - -listy file h = do - r <- parseWith (refill h) (many request) =<< refill h - case r of - Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg - Done _ reqs -> print (length reqs) - -incrementy file h = go 0 =<< refill h - where - go !n is = do - r <- parseWith (refill h) request is - case r of - Fail _ _ msg -> hPutStrLn stderr $ file ++ ": " ++ msg - Done bs _req - | B.null bs -> do - s <- refill h - if B.null s - then print (n+1) - else go (n+1) s - | otherwise -> go (n+1) bs - -main = do - args <- getArgs - forM_ args $ \arg -> - bracket (openFile arg ReadMode) hClose $ - -- listy arg - incrementy arg diff --git a/examples/rfc2616.c b/examples/rfc2616.c --- a/examples/rfc2616.c +++ b/examples/rfc2616.c @@ -1,21 +1,22 @@ /* - * This is a simple driver for Ryan Dahl's hand-bummed C http-parser - * package. It is intended to read one HTTP request after another - * from a file, nothing more. + * This is a simple driver for the http-parser package. It is + * intended to read one HTTP request after another from a file, + * nothing more. * * For "feature parity" with the Haskell code in RFC2616.hs, we * allocate and populate a simple structure describing each request, * since that's the sort of thing that many real applications would * themselves do and the library doesn't do this for us. * - * For the http-parser source, see http://github.com/ry/http-parser/ + * For the http-parser source, see + * https://github.com/joyent/http-parser/blob/master/http_parser.c */ /* * Turn off this preprocessor symbol to have the callbacks do nothing * at all, which "improves performance" by about 50%. */ -#define LOOK_BUSY +/*#define LOOK_BUSY*/ #include #include @@ -27,18 +28,18 @@ #include #include "http_parser.h" - + struct http_string { size_t len; char value[0]; }; - + struct http_header { struct http_string *name; struct http_string *value; struct http_header *next; }; - + struct http_request { struct http_string *method; struct http_string *uri; @@ -49,7 +50,7 @@ size_t count; struct http_request req; }; - + static void *xmalloc(size_t size) { void *ptr; @@ -78,7 +79,7 @@ *dst = xstrdup(src, len, 0); return; } - + p = xstrdup((*dst)->value, (*dst)->len, len); memcpy(p->value + (*dst)->len, src, len); p->len += len; @@ -98,7 +99,7 @@ static int url(http_parser *p, const char *at, size_t len) { #ifdef LOOK_BUSY - struct data *data = p->data; + struct data *data = p->data; xstrcat(&data->req.uri, at, len); #endif @@ -119,7 +120,7 @@ hdr->name = xstrdup(at, len, 0); hdr->value = NULL; hdr->next = NULL; - + if (data->req.last != NULL) data->req.last->next = hdr; data->req.last = hdr; @@ -150,7 +151,7 @@ free(data->req.method); free(data->req.uri); - + for (hdr = data->req.headers; hdr != NULL; hdr = next) { next = hdr->next; free(hdr->name); @@ -164,7 +165,7 @@ data->req.headers = NULL; data->req.last = NULL; #endif - + /* Bludgeon http_parser into understanding that we really want to * keep parsing after a request that in principle ought to close * the "connection". */ @@ -180,16 +181,21 @@ static void parse(const char *path, int fd) { struct data data; + http_parser_settings s; http_parser p; ssize_t nread; - http_parser_init(&p, HTTP_REQUEST); - p.on_message_begin = begin; - p.on_url = url; - p.on_header_field = header_field; - p.on_header_value = header_value; - p.on_message_complete = complete; + memset(&s, 0, sizeof(s)); + s.on_message_begin = begin; + s.on_url = url; + s.on_header_field = header_field; + s.on_header_value = header_value; + s.on_message_complete = complete; + p.data = &data; + + http_parser_init(&p, HTTP_REQUEST); + data.count = 0; data.req.method = NULL; data.req.uri = NULL; @@ -202,7 +208,7 @@ nread = read(fd, buf, sizeof(buf)); - np = http_parser_execute(&p, buf, nread); + np = http_parser_execute(&p, &s, buf, nread); if (np != nread) { fprintf(stderr, "%s: parse failed\n", path); break; diff --git a/internal/Data/Attoparsec/ByteString/Buffer.hs b/internal/Data/Attoparsec/ByteString/Buffer.hs new file mode 100644 --- /dev/null +++ b/internal/Data/Attoparsec/ByteString/Buffer.hs @@ -0,0 +1,157 @@ +{-# LANGUAGE BangPatterns #-} +-- | +-- Module : Data.Attoparsec.ByteString.Buffer +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : GHC +-- +-- An "immutable" buffer that supports cheap appends. +-- +-- A Buffer is divided into an immutable read-only zone, followed by a +-- mutable area that we've preallocated, but not yet written to. +-- +-- We overallocate at the end of a Buffer so that we can cheaply +-- append. Since a user of an existing Buffer cannot see past the end +-- of its immutable zone into the data that will change during an +-- append, this is safe. +-- +-- Once we run out of space at the end of a Buffer, we do the usual +-- doubling of the buffer size. +-- +-- The fact of having a mutable buffer really helps with performance, +-- but it does have a consequence: if someone misuses the Partial API +-- that attoparsec uses by calling the same continuation repeatedly +-- (which never makes sense in practice), they could overwrite data. +-- +-- Since the API *looks* pure, it should *act* pure, too, so we use +-- two generation counters (one mutable, one immutable) to track the +-- number of appends to a mutable buffer. If the counters ever get out +-- of sync, someone is appending twice to a mutable buffer, so we +-- duplicate the entire buffer in order to preserve the immutability +-- of its older self. +-- +-- While we could go a step further and gain protection against API +-- abuse on a multicore system, by use of an atomic increment +-- instruction to bump the mutable generation counter, that would be +-- very expensive, and feels like it would also be in the realm of the +-- ridiculous. Clients should never call a continuation more than +-- once; we lack a linear type system that could enforce this; and +-- there's only so far we should go to accommodate broken uses. + +module Data.Attoparsec.ByteString.Buffer + ( + Buffer + , buffer + , unbuffer + , pappend + , length + , unsafeIndex + , substring + , unsafeDrop + ) where + +import Control.Exception (assert) +import Data.ByteString.Internal (ByteString(..), memcpy, nullForeignPtr) +import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO) +import Data.Attoparsec.Internal.Compat +import Data.List (foldl1') +import Data.Monoid as Mon (Monoid(..)) +import Data.Semigroup (Semigroup(..)) +import Data.Word (Word8) +import Foreign.ForeignPtr (ForeignPtr, withForeignPtr) +import Foreign.Ptr (castPtr, plusPtr) +import Foreign.Storable (peek, peekByteOff, poke, sizeOf) +import GHC.ForeignPtr (mallocPlainForeignPtrBytes) +import Prelude hiding (length) + +-- If _cap is zero, this buffer is empty. +data Buffer = Buf { + _fp :: {-# UNPACK #-} !(ForeignPtr Word8) + , _off :: {-# UNPACK #-} !Int + , _len :: {-# UNPACK #-} !Int + , _cap :: {-# UNPACK #-} !Int + , _gen :: {-# UNPACK #-} !Int + } + +instance Show Buffer where + showsPrec p = showsPrec p . unbuffer + +-- | The initial 'Buffer' has no mutable zone, so we can avoid all +-- copies in the (hopefully) common case of no further input being fed +-- to us. +buffer :: ByteString -> Buffer +buffer bs = withPS bs $ \fp off len -> Buf fp off len len 0 + +unbuffer :: Buffer -> ByteString +unbuffer (Buf fp off len _ _) = mkPS fp off len + +instance Semigroup Buffer where + (Buf _ _ _ 0 _) <> b = b + a <> (Buf _ _ _ 0 _) = a + buf <> (Buf fp off len _ _) = append buf fp off len + +instance Monoid Buffer where + mempty = Buf nullForeignPtr 0 0 0 0 + + mappend = (<>) + + mconcat [] = Mon.mempty + mconcat xs = foldl1' mappend xs + +pappend :: Buffer -> ByteString -> Buffer +pappend (Buf _ _ _ 0 _) bs = buffer bs +pappend buf bs = withPS bs $ \fp off len -> append buf fp off len + +append :: Buffer -> ForeignPtr a -> Int -> Int -> Buffer +append (Buf fp0 off0 len0 cap0 gen0) !fp1 !off1 !len1 = + inlinePerformIO . withForeignPtr fp0 $ \ptr0 -> + withForeignPtr fp1 $ \ptr1 -> do + let genSize = sizeOf (0::Int) + newlen = len0 + len1 + gen <- if gen0 == 0 + then return 0 + else peek (castPtr ptr0) + if gen == gen0 && newlen <= cap0 + then do + let newgen = gen + 1 + poke (castPtr ptr0) newgen + memcpy (ptr0 `plusPtr` (off0+len0)) + (ptr1 `plusPtr` off1) + (fromIntegral len1) + return (Buf fp0 off0 newlen cap0 newgen) + else do + let newcap = newlen * 2 + fp <- mallocPlainForeignPtrBytes (newcap + genSize) + withForeignPtr fp $ \ptr_ -> do + let ptr = ptr_ `plusPtr` genSize + newgen = 1 + poke (castPtr ptr_) newgen + memcpy ptr (ptr0 `plusPtr` off0) (fromIntegral len0) + memcpy (ptr `plusPtr` len0) (ptr1 `plusPtr` off1) + (fromIntegral len1) + return (Buf fp genSize newlen newcap newgen) + +length :: Buffer -> Int +length (Buf _ _ len _ _) = len +{-# INLINE length #-} + +unsafeIndex :: Buffer -> Int -> Word8 +unsafeIndex (Buf fp off len _ _) i = assert (i >= 0 && i < len) . + inlinePerformIO . withForeignPtr fp $ flip peekByteOff (off+i) +{-# INLINE unsafeIndex #-} + +substring :: Int -> Int -> Buffer -> ByteString +substring s l (Buf fp off len _ _) = + assert (s >= 0 && s <= len) . + assert (l >= 0 && l <= len-s) $ + mkPS fp (off+s) l +{-# INLINE substring #-} + +unsafeDrop :: Int -> Buffer -> ByteString +unsafeDrop s (Buf fp off len _ _) = + assert (s >= 0 && s <= len) $ + mkPS fp (off+s) (len-s) +{-# INLINE unsafeDrop #-} diff --git a/internal/Data/Attoparsec/ByteString/FastSet.hs b/internal/Data/Attoparsec/ByteString/FastSet.hs new file mode 100644 --- /dev/null +++ b/internal/Data/Attoparsec/ByteString/FastSet.hs @@ -0,0 +1,112 @@ +{-# LANGUAGE BangPatterns, MagicHash #-} + +----------------------------------------------------------------------------- +-- | +-- Module : Data.Attoparsec.ByteString.FastSet +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : unknown +-- +-- Fast set membership tests for 'Word8' and 8-bit 'Char' values. The +-- set representation is unboxed for efficiency. For small sets, we +-- test for membership using a binary search. For larger sets, we use +-- a lookup table. +-- +----------------------------------------------------------------------------- +module Data.Attoparsec.ByteString.FastSet + ( + -- * Data type + FastSet + -- * Construction + , fromList + , set + -- * Lookup + , memberChar + , memberWord8 + -- * Debugging + , fromSet + -- * Handy interface + , charClass + ) where + +import Data.Bits ((.&.), (.|.), unsafeShiftL) +import Foreign.Storable (peekByteOff, pokeByteOff) +import GHC.Exts (Int(I#), iShiftRA#) +import GHC.Word (Word8) +import qualified Data.ByteString as B +import qualified Data.ByteString.Char8 as B8 +import qualified Data.ByteString.Internal as I +import qualified Data.ByteString.Unsafe as U + +data FastSet = Sorted { fromSet :: !B.ByteString } + | Table { fromSet :: !B.ByteString } + deriving (Eq, Ord) + +instance Show FastSet where + show (Sorted s) = "FastSet Sorted " ++ show (B8.unpack s) + show (Table _) = "FastSet Table" + +-- | The lower bound on the size of a lookup table. We choose this to +-- balance table density against performance. +tableCutoff :: Int +tableCutoff = 8 + +-- | Create a set. +set :: B.ByteString -> FastSet +set s | B.length s < tableCutoff = Sorted . B.sort $ s + | otherwise = Table . mkTable $ s + +fromList :: [Word8] -> FastSet +fromList = set . B.pack + +data I = I {-# UNPACK #-} !Int {-# UNPACK #-} !Word8 + +shiftR :: Int -> Int -> Int +shiftR (I# x#) (I# i#) = I# (x# `iShiftRA#` i#) + +index :: Int -> I +index i = I (i `shiftR` 3) (1 `unsafeShiftL` (i .&. 7)) +{-# INLINE index #-} + +-- | Check the set for membership. +memberWord8 :: Word8 -> FastSet -> Bool +memberWord8 w (Table t) = + let I byte bit = index (fromIntegral w) + in U.unsafeIndex t byte .&. bit /= 0 +memberWord8 w (Sorted s) = search 0 (B.length s - 1) + where search lo hi + | hi < lo = False + | otherwise = + let mid = (lo + hi) `quot` 2 + in case compare w (U.unsafeIndex s mid) of + GT -> search (mid + 1) hi + LT -> search lo (mid - 1) + _ -> True + +-- | Check the set for membership. Only works with 8-bit characters: +-- characters above code point 255 will give wrong answers. +memberChar :: Char -> FastSet -> Bool +memberChar c = memberWord8 (I.c2w c) +{-# INLINE memberChar #-} + +mkTable :: B.ByteString -> B.ByteString +mkTable s = I.unsafeCreate 32 $ \t -> do + _ <- I.memset t 0 32 + U.unsafeUseAsCStringLen s $ \(p, l) -> + let loop n | n == l = return () + | otherwise = do + c <- peekByteOff p n :: IO Word8 + let I byte bit = index (fromIntegral c) + prev <- peekByteOff t byte :: IO Word8 + pokeByteOff t byte (prev .|. bit) + loop (n + 1) + in loop 0 + +charClass :: String -> FastSet +charClass = set . B8.pack . go + where go (a:'-':b:xs) = [a..b] ++ go xs + go (x:xs) = x : go xs + go _ = "" diff --git a/internal/Data/Attoparsec/Internal/Compat.hs b/internal/Data/Attoparsec/Internal/Compat.hs new file mode 100644 --- /dev/null +++ b/internal/Data/Attoparsec/Internal/Compat.hs @@ -0,0 +1,27 @@ +{-# LANGUAGE CPP #-} +{-# LANGUAGE MagicHash #-} +module Data.Attoparsec.Internal.Compat where + +import Data.ByteString.Internal (ByteString(..)) +import Data.Word (Word8) +import Foreign.ForeignPtr (ForeignPtr) + +#if MIN_VERSION_bytestring(0,11,0) +import Data.ByteString.Internal (plusForeignPtr) +#endif + +withPS :: ByteString -> (ForeignPtr Word8 -> Int -> Int -> r) -> r +#if MIN_VERSION_bytestring(0,11,0) +withPS (BS fp len) kont = kont fp 0 len +#else +withPS (PS fp off len) kont = kont fp off len +#endif +{-# INLINE withPS #-} + +mkPS :: ForeignPtr Word8 -> Int -> Int -> ByteString +#if MIN_VERSION_bytestring(0,11,0) +mkPS fp off len = BS (plusForeignPtr fp off) len +#else +mkPS fp off len = PS fp off len +#endif +{-# INLINE mkPS #-} diff --git a/internal/Data/Attoparsec/Internal/Fhthagn.hs b/internal/Data/Attoparsec/Internal/Fhthagn.hs new file mode 100644 --- /dev/null +++ b/internal/Data/Attoparsec/Internal/Fhthagn.hs @@ -0,0 +1,18 @@ +{-# LANGUAGE BangPatterns, Rank2Types, OverloadedStrings, + RecordWildCards, MagicHash, UnboxedTuples #-} + +module Data.Attoparsec.Internal.Fhthagn + ( + inlinePerformIO + ) where + +import GHC.Exts (realWorld#) +import GHC.IO (IO(IO)) + +-- | Just like unsafePerformIO, but we inline it. Big performance gains as +-- it exposes lots of things to further inlining. /Very unsafe/. In +-- particular, you should do no memory allocation inside an +-- 'inlinePerformIO' block. On Hugs this is just @unsafePerformIO@. +inlinePerformIO :: IO a -> a +inlinePerformIO (IO m) = case m realWorld# of (# _, r #) -> r +{-# INLINE inlinePerformIO #-} diff --git a/internal/Data/Attoparsec/Text/Buffer.hs b/internal/Data/Attoparsec/Text/Buffer.hs new file mode 100644 --- /dev/null +++ b/internal/Data/Attoparsec/Text/Buffer.hs @@ -0,0 +1,235 @@ +{-# LANGUAGE BangPatterns, CPP, MagicHash, RankNTypes, RecordWildCards, + UnboxedTuples #-} + +-- | +-- Module : Data.Attoparsec.Text.Buffer +-- Copyright : Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : bos@serpentine.com +-- Stability : experimental +-- Portability : GHC +-- +-- An immutable buffer that supports cheap appends. + +-- A Buffer is divided into an immutable read-only zone, followed by a +-- mutable area that we've preallocated, but not yet written to. +-- +-- We overallocate at the end of a Buffer so that we can cheaply +-- append. Since a user of an existing Buffer cannot see past the end +-- of its immutable zone into the data that will change during an +-- append, this is safe. +-- +-- Once we run out of space at the end of a Buffer, we do the usual +-- doubling of the buffer size. + +module Data.Attoparsec.Text.Buffer + ( + Buffer + , buffer + , unbuffer + , unbufferAt + , length + , pappend + , iter + , iter_ + , substring + , lengthCodeUnits + , dropCodeUnits + ) where + +import Control.Exception (assert) +import Data.List (foldl1') +import Data.Monoid as Mon (Monoid(..)) +import Data.Semigroup (Semigroup(..)) +import Data.Text () +import Data.Text.Internal (Text(..)) +#if MIN_VERSION_text(2,0,0) +import Data.Text.Internal.Encoding.Utf8 (utf8LengthByLeader) +import Data.Text.Unsafe (iterArray, lengthWord8) +#else +import Data.Bits (shiftR) +import Data.Text.Internal.Encoding.Utf16 (chr2) +import Data.Text.Internal.Unsafe.Char (unsafeChr) +import Data.Text.Unsafe (lengthWord16) +#endif +import Data.Text.Unsafe (Iter(..)) +import Foreign.Storable (sizeOf) +import GHC.Exts (Int(..), indexIntArray#, unsafeCoerce#, writeIntArray#) +import GHC.ST (ST(..), runST) +import Prelude hiding (length) +import qualified Data.Text.Array as A + +-- If _cap is zero, this buffer is empty. +data Buffer = Buf { + _arr :: {-# UNPACK #-} !A.Array + , _off :: {-# UNPACK #-} !Int + , _len :: {-# UNPACK #-} !Int + , _cap :: {-# UNPACK #-} !Int + , _gen :: {-# UNPACK #-} !Int + } + +instance Show Buffer where + showsPrec p = showsPrec p . unbuffer + +-- | The initial 'Buffer' has no mutable zone, so we can avoid all +-- copies in the (hopefully) common case of no further input being fed +-- to us. +buffer :: Text -> Buffer +buffer (Text arr off len) = Buf arr off len len 0 + +unbuffer :: Buffer -> Text +unbuffer (Buf arr off len _ _) = Text arr off len + +unbufferAt :: Int -> Buffer -> Text +unbufferAt s (Buf arr off len _ _) = + assert (s >= 0 && s <= len) $ + Text arr (off+s) (len-s) + +instance Semigroup Buffer where + (Buf _ _ _ 0 _) <> b = b + a <> (Buf _ _ _ 0 _) = a + buf <> (Buf arr off len _ _) = append buf arr off len + {-# INLINE (<>) #-} + +instance Monoid Buffer where + mempty = Buf A.empty 0 0 0 0 + {-# INLINE mempty #-} + + mappend = (<>) + + mconcat [] = Mon.mempty + mconcat xs = foldl1' (<>) xs + +pappend :: Buffer -> Text -> Buffer +pappend (Buf _ _ _ 0 _) t = buffer t +pappend buf (Text arr off len) = append buf arr off len + +append :: Buffer -> A.Array -> Int -> Int -> Buffer +append (Buf arr0 off0 len0 cap0 gen0) !arr1 !off1 !len1 = runST $ do +#if MIN_VERSION_text(2,0,0) + let woff = sizeOf (0::Int) +#else + let woff = sizeOf (0::Int) `shiftR` 1 +#endif + newlen = len0 + len1 + !gen = if gen0 == 0 then 0 else readGen arr0 + if gen == gen0 && newlen <= cap0 + then do + let newgen = gen + 1 + marr <- unsafeThaw arr0 + writeGen marr newgen +#if MIN_VERSION_text(2,0,0) + A.copyI len1 marr (off0+len0) arr1 off1 +#else + A.copyI marr (off0+len0) arr1 off1 (off0+newlen) +#endif + arr2 <- A.unsafeFreeze marr + return (Buf arr2 off0 newlen cap0 newgen) + else do + let newcap = newlen * 2 + newgen = 1 + marr <- A.new (newcap + woff) + writeGen marr newgen +#if MIN_VERSION_text(2,0,0) + A.copyI len0 marr woff arr0 off0 + A.copyI len1 marr (woff+len0) arr1 off1 +#else + A.copyI marr woff arr0 off0 (woff+len0) + A.copyI marr (woff+len0) arr1 off1 (woff+newlen) +#endif + arr2 <- A.unsafeFreeze marr + return (Buf arr2 woff newlen newcap newgen) + +length :: Buffer -> Int +length (Buf _ _ len _ _) = len +{-# INLINE length #-} + +substring :: Int -> Int -> Buffer -> Text +substring s l (Buf arr off len _ _) = + assert (s >= 0 && s <= len) . + assert (l >= 0 && l <= len-s) $ + Text arr (off+s) l +{-# INLINE substring #-} + +#if MIN_VERSION_text(2,0,0) + +lengthCodeUnits :: Text -> Int +lengthCodeUnits = lengthWord8 + +dropCodeUnits :: Int -> Buffer -> Text +dropCodeUnits s (Buf arr off len _ _) = + assert (s >= 0 && s <= len) $ + Text arr (off+s) (len-s) +{-# INLINE dropCodeUnits #-} + +-- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-8 +-- array, returning the current character and the delta to add to give +-- the next offset to iterate at. +iter :: Buffer -> Int -> Iter +iter (Buf arr off _ _ _) i = iterArray arr (off + i) +{-# INLINE iter #-} + +-- | /O(1)/ Iterate one step through a UTF-8 array, returning the +-- delta to add to give the next offset to iterate at. +iter_ :: Buffer -> Int -> Int +iter_ (Buf arr off _ _ _) i = utf8LengthByLeader $ A.unsafeIndex arr (off+i) +{-# INLINE iter_ #-} + +unsafeThaw :: A.Array -> ST s (A.MArray s) +unsafeThaw (A.ByteArray a) = ST $ \s# -> + (# s#, A.MutableByteArray (unsafeCoerce# a) #) + +readGen :: A.Array -> Int +readGen (A.ByteArray a) = case indexIntArray# a 0# of r# -> I# r# + +writeGen :: A.MArray s -> Int -> ST s () +writeGen (A.MutableByteArray a) (I# gen#) = ST $ \s0# -> + case writeIntArray# a 0# gen# s0# of + s1# -> (# s1#, () #) + +#else + +lengthCodeUnits :: Text -> Int +lengthCodeUnits = lengthWord16 + +dropCodeUnits :: Int -> Buffer -> Text +dropCodeUnits s (Buf arr off len _ _) = + assert (s >= 0 && s <= len) $ + Text arr (off+s) (len-s) +{-# INLINE dropCodeUnits #-} + +-- | /O(1)/ Iterate (unsafely) one step forwards through a UTF-16 +-- array, returning the current character and the delta to add to give +-- the next offset to iterate at. +iter :: Buffer -> Int -> Iter +iter (Buf arr off _ _ _) i + | m < 0xD800 || m > 0xDBFF = Iter (unsafeChr m) 1 + | otherwise = Iter (chr2 m n) 2 + where m = A.unsafeIndex arr j + n = A.unsafeIndex arr k + j = off + i + k = j + 1 +{-# INLINE iter #-} + +-- | /O(1)/ Iterate one step through a UTF-16 array, returning the +-- delta to add to give the next offset to iterate at. +iter_ :: Buffer -> Int -> Int +iter_ (Buf arr off _ _ _) i | m < 0xD800 || m > 0xDBFF = 1 + | otherwise = 2 + where m = A.unsafeIndex arr (off+i) +{-# INLINE iter_ #-} + +unsafeThaw :: A.Array -> ST s (A.MArray s) +unsafeThaw A.Array{..} = ST $ \s# -> + (# s#, A.MArray (unsafeCoerce# aBA) #) + +readGen :: A.Array -> Int +readGen a = case indexIntArray# (A.aBA a) 0# of r# -> I# r# + +writeGen :: A.MArray s -> Int -> ST s () +writeGen a (I# gen#) = ST $ \s0# -> + case writeIntArray# (A.maBA a) 0# gen# s0# of + s1# -> (# s1#, () #) + +#endif diff --git a/internal/Data/Attoparsec/Text/FastSet.hs b/internal/Data/Attoparsec/Text/FastSet.hs new file mode 100644 --- /dev/null +++ b/internal/Data/Attoparsec/Text/FastSet.hs @@ -0,0 +1,121 @@ +{-# LANGUAGE BangPatterns #-} + +------------------------------------------------------------------------------ +-- | +-- Module : Data.Attoparsec.FastSet +-- Copyright : Felipe Lessa 2010, Bryan O'Sullivan 2007-2015 +-- License : BSD3 +-- +-- Maintainer : felipe.lessa@gmail.com +-- Stability : experimental +-- Portability : unknown +-- +-- Fast set membership tests for 'Char' values. We test for +-- membership using a hashtable implemented with Robin Hood +-- collision resolution. The set representation is unboxed, +-- and the characters and hashes interleaved, for efficiency. +-- +-- +----------------------------------------------------------------------------- +module Data.Attoparsec.Text.FastSet + ( + -- * Data type + FastSet + -- * Construction + , fromList + , set + -- * Lookup + , member + -- * Handy interface + , charClass + ) where + +import Data.Bits ((.|.), (.&.), shiftR) +import Data.Function (on) +import Data.List (sort, sortBy) +import qualified Data.Array.Base as AB +import qualified Data.Array.Unboxed as A +import qualified Data.Text as T + +data FastSet = FastSet { + table :: {-# UNPACK #-} !(A.UArray Int Int) + , mask :: {-# UNPACK #-} !Int + } + +data Entry = Entry { + key :: {-# UNPACK #-} !Char + , initialIndex :: {-# UNPACK #-} !Int + , index :: {-# UNPACK #-} !Int + } + +offset :: Entry -> Int +offset e = index e - initialIndex e + +resolveCollisions :: [Entry] -> [Entry] +resolveCollisions [] = [] +resolveCollisions [e] = [e] +resolveCollisions (a:b:entries) = a' : resolveCollisions (b' : entries) + where (a', b') + | index a < index b = (a, b) + | offset a < offset b = (b { index=index a }, a { index=index a + 1 }) + | otherwise = (a, b { index=index a + 1 }) + +pad :: Int -> [Entry] -> [Entry] +pad = go 0 + where -- ensure that we pad enough so that lookups beyond the + -- last hash in the table fall within the array + go !_ !m [] = replicate (max 1 m + 1) empty + go k m (e:entries) = map (const empty) [k..i - 1] ++ e : + go (i + 1) (m + i - k - 1) entries + where i = index e + empty = Entry '\0' maxBound 0 + +nextPowerOf2 :: Int -> Int +nextPowerOf2 0 = 1 +nextPowerOf2 x = go (x - 1) 1 + where go y 32 = y + 1 + go y k = go (y .|. (y `shiftR` k)) $ k * 2 + +fastHash :: Char -> Int +fastHash = fromEnum + +fromList :: String -> FastSet +fromList s = FastSet (AB.listArray (0, length interleaved - 1) interleaved) + mask' + where s' = ordNub (sort s) + l = length s' + mask' = nextPowerOf2 ((5 * l) `div` 4) - 1 + entries = pad mask' . + resolveCollisions . + sortBy (compare `on` initialIndex) . + zipWith (\c i -> Entry c i i) s' . + map ((.&. mask') . fastHash) $ s' + interleaved = concatMap (\e -> [fromEnum $ key e, initialIndex e]) + entries + +ordNub :: Eq a => [a] -> [a] +ordNub [] = [] +ordNub (y:ys) = go y ys + where go x (z:zs) + | x == z = go x zs + | otherwise = x : go z zs + go x [] = [x] + +set :: T.Text -> FastSet +set = fromList . T.unpack + +-- | Check the set for membership. +member :: Char -> FastSet -> Bool +member c a = go (2 * i) + where i = fastHash c .&. mask a + lookupAt j b = (i' <= i) && (c == c' || b) + where c' = toEnum $ AB.unsafeAt (table a) j + i' = AB.unsafeAt (table a) $ j + 1 + go j = lookupAt j . lookupAt (j + 2) . lookupAt (j + 4) . + lookupAt (j + 6) . go $ j + 8 + +charClass :: String -> FastSet +charClass = fromList . go + where go (a:'-':b:xs) = [a..b] ++ go xs + go (x:xs) = x : go xs + go _ = "" diff --git a/tests/Makefile b/tests/Makefile deleted file mode 100644 --- a/tests/Makefile +++ /dev/null @@ -1,14 +0,0 @@ -all: TestFastSet.out qc.out - -%.out: %.exe - ./$< | tee $<.tmp - mv $<.tmp $@ - -qc.exe: QC.hs - ghc -O -fno-warn-orphans --make -o $@ $< - -%.exe: %.hs - ghc -O -fno-warn-orphans --make -o $@ $< - -clean: - -rm -f *.hi *.o *.exe *.out diff --git a/tests/QC.hs b/tests/QC.hs --- a/tests/QC.hs +++ b/tests/QC.hs @@ -1,116 +1,19 @@ -{-# LANGUAGE OverloadedStrings #-} +{-# OPTIONS_GHC -fno-warn-missing-signatures #-} module Main (main) where -import Control.Monad (forM_) -import Data.Maybe (isJust) -import Data.Word (Word8) -import Prelude hiding (takeWhile) -import QCSupport -import Test.Framework (defaultMain, testGroup) -import Test.Framework.Providers.QuickCheck2 (testProperty) -import Test.QuickCheck hiding (NonEmpty) -import qualified Data.Attoparsec as P -import qualified Data.ByteString as B -import qualified Data.ByteString.Char8 as C - --- Make sure that structures whose types claim they are non-empty --- really are. - -nonEmptyList l = length (nonEmpty l) > 0 - where types = l :: NonEmpty [Int] -nonEmptyBS l = B.length (nonEmpty l) > 0 - --- Naming. - -{- -label (NonEmpty s) = case parse (anyWord8 s) B.empty of - (_, Left err) -> s `isInfixOf` err - _ -> False --} - --- Basic byte-level combinators. - -maybeP p s = case P.parse p s `P.feed` B.empty of - P.Done _ i -> Just i - _ -> Nothing - -defP p s = P.parse p s `P.feed` B.empty - -satisfy w s = maybeP (P.satisfy (<=w)) (B.cons w s) == Just w - -word8 w s = maybeP (P.word8 w) (B.cons w s) == Just w - -anyWord8 s = maybeP P.anyWord8 s == if B.null s - then Nothing - else Just (B.head s) - -notWord8 w (NonEmpty s) = maybeP (P.notWord8 w) s == if v == w - then Nothing - else Just v - where v = B.head s - -string s = maybeP (P.string s) s == Just s - -skipWhile w s = - let t = B.dropWhile (<=w) s - in case defP (P.skipWhile (<=w)) s of - P.Done t' () -> t == t' - _ -> False - -takeCount (Positive k) s = - case maybeP (P.take k) s of - Nothing -> k > B.length s - Just s' -> k <= B.length s - -takeWhile w s = - let (h,t) = B.span (==w) s - in case defP (P.takeWhile (==w)) s of - P.Done t' h' -> t == t' && h == h' - _ -> False - -takeWhile1 w s = - let s' = B.cons w s - (h,t) = B.span (<=w) s' - in case defP (P.takeWhile1 (<=w)) s' of - P.Done t' h' -> t == t' && h == h' - _ -> False - -takeTill w s = - let (h,t) = B.break (==w) s - in case defP (P.takeTill (==w)) s of - P.Done t' h' -> t == t' && h == h' - _ -> False - -ensure n s = case defP (P.ensure m) s of - P.Done _ () -> B.length s >= m - _ -> B.length s < m - where m = (n `mod` 220) - 20 - -takeWhile1_empty = maybeP (P.takeWhile1 undefined) B.empty == Nothing - -endOfInput s = maybeP P.endOfInput s == if B.null s - then Just () - else Nothing +import qualified QC.Buffer as Buffer +import qualified QC.ByteString as ByteString +import qualified QC.Combinator as Combinator +import qualified QC.Simple as Simple +import qualified QC.Text as Text +import Test.Tasty (defaultMain, testGroup) main = defaultMain tests -tests = [ - testGroup "fnord" [ - testProperty "nonEmptyList" nonEmptyList, - testProperty "nonEmptyBS" nonEmptyBS, - testProperty "satisfy" satisfy, - testProperty "word8" word8, - testProperty "notWord8" notWord8, - testProperty "anyWord8" anyWord8, - testProperty "string" string, - testProperty "skipWhile" skipWhile, - testProperty "takeCount" takeCount, - testProperty "takeWhile" takeWhile, - testProperty "takeWhile1" takeWhile1, - testProperty "takeWhile1_empty" takeWhile1_empty, - testProperty "takeTill" takeTill, - testProperty "endOfInput" endOfInput, - testProperty "ensure" ensure - ] - +tests = testGroup "tests" [ + testGroup "bs" ByteString.tests + , testGroup "buf" Buffer.tests + , testGroup "combinator" Combinator.tests + , testGroup "simple" Simple.tests + , testGroup "text" Text.tests ] diff --git a/tests/QC/Buffer.hs b/tests/QC/Buffer.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Buffer.hs @@ -0,0 +1,111 @@ +{-# LANGUAGE BangPatterns, CPP, FlexibleInstances, OverloadedStrings, + TypeSynonymInstances #-} + +module QC.Buffer (tests) where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((<$>)) +import Data.Monoid (Monoid(mconcat)) +#endif +import QC.Common () +import Test.Tasty (TestTree) +import Test.Tasty.QuickCheck (testProperty) +import Test.QuickCheck +import qualified Data.Attoparsec.ByteString.Buffer as BB +import qualified Data.Attoparsec.Text.Buffer as BT +import qualified Data.ByteString as B +import qualified Data.ByteString.Unsafe as B +import qualified Data.Text as T +import qualified Data.Text.Unsafe as T + +data BP t b = BP [t] !t !b + deriving (Eq, Show) + +type BPB = BP B.ByteString BB.Buffer +type BPT = BP T.Text BT.Buffer + +instance Arbitrary BPB where + arbitrary = do + bss <- arbitrary + return $! toBP BB.buffer bss + + shrink (BP bss _ _) = toBP BB.buffer <$> shrink bss + +instance Arbitrary BPT where + arbitrary = do + bss <- arbitrary + return $! toBP BT.buffer bss + + shrink (BP bss _ _) = toBP BT.buffer <$> shrink bss + +toBP :: (Monoid a, Monoid b) => (a -> b) -> [a] -> BP a b +toBP buf bss = BP bss (mconcat bss) (mconcat (map buf bss)) + +b_unbuffer :: BPB -> Property +b_unbuffer (BP _ts t buf) = t === BB.unbuffer buf + +t_unbuffer :: BPT -> Property +t_unbuffer (BP _ts t buf) = t === BT.unbuffer buf + +-- This test triggers both branches in Data.Attoparsec.Text.Buffer.append +-- and checks that Data.Text.Array.copyI manipulations are correct. +t_unbuffer_three :: Property +t_unbuffer_three = t_unbuffer $ toBP BT.buffer [t, t, t] + where + -- Make it long enough to increase chances of a segmentation fault + t = T.replicate 1000 "\0" + +b_length :: BPB -> Property +b_length (BP _ts t buf) = B.length t === BB.length buf + +t_length :: BPT -> Property +t_length (BP _ts t buf) = BT.lengthCodeUnits t === BT.length buf + +b_unsafeIndex :: BPB -> Gen Property +b_unsafeIndex (BP _ts t buf) = do + let l = B.length t + i <- choose (0,l-1) + return $ l === 0 .||. B.unsafeIndex t i === BB.unsafeIndex buf i + +t_iter :: BPT -> Gen Property +t_iter (BP _ts t buf) = do + let l = BT.lengthCodeUnits t + i <- choose (0,l-1) + let it (T.Iter c q) = (c,q) + return $ l === 0 .||. it (T.iter t i) === it (BT.iter buf i) + +t_iter_ :: BPT -> Gen Property +t_iter_ (BP _ts t buf) = do + let l = BT.lengthCodeUnits t + i <- choose (0,l-1) + return $ l === 0 .||. T.iter_ t i === BT.iter_ buf i + +b_unsafeDrop :: BPB -> Gen Property +b_unsafeDrop (BP _ts t buf) = do + i <- choose (0, B.length t) + return $ B.unsafeDrop i t === BB.unsafeDrop i buf + +t_dropCodeUnits :: BPT -> Gen Property +t_dropCodeUnits (BP _ts t buf) = do + i <- choose (0, BT.lengthCodeUnits t) + return $ dropCodeUnits i t === BT.dropCodeUnits i buf + where +#if MIN_VERSION_text(2,0,0) + dropCodeUnits = T.dropWord8 +#else + dropCodeUnits = T.dropWord16 +#endif + +tests :: [TestTree] +tests = [ + testProperty "b_unbuffer" b_unbuffer + , testProperty "t_unbuffer" t_unbuffer + , testProperty "t_unbuffer_three" t_unbuffer_three + , testProperty "b_length" b_length + , testProperty "t_length" t_length + , testProperty "b_unsafeIndex" b_unsafeIndex + , testProperty "t_iter" t_iter + , testProperty "t_iter_" t_iter_ + , testProperty "b_unsafeDrop" b_unsafeDrop + , testProperty "t_dropCodeUnits" t_dropCodeUnits + ] diff --git a/tests/QC/ByteString.hs b/tests/QC/ByteString.hs new file mode 100644 --- /dev/null +++ b/tests/QC/ByteString.hs @@ -0,0 +1,214 @@ +{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} +module QC.ByteString (tests) where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((<*>), (<$>)) +#endif +import Data.Char (chr, ord, toUpper) +import Data.Int (Int64) +import Data.Word (Word8) +import Prelude hiding (take, takeWhile) +import QC.Common (ASCII(..), liftOp, parseBS, toStrictBS) +import Test.Tasty (TestTree) +import Test.Tasty.QuickCheck (testProperty) +import Test.QuickCheck +import qualified Data.Attoparsec.ByteString as P +import qualified Data.Attoparsec.ByteString.Char8 as P8 +import qualified Data.Attoparsec.ByteString.FastSet as S +import qualified Data.Attoparsec.ByteString.Lazy as PL +import qualified Data.ByteString as B +import qualified Data.ByteString.Char8 as B8 +import qualified Data.ByteString.Lazy as L +import qualified Data.ByteString.Lazy.Char8 as L8 + +-- Basic byte-level combinators. + +satisfy :: Word8 -> L.ByteString -> Property +satisfy w s = parseBS (P.satisfy (<=w)) (L.cons w s) === Just w + +satisfyWith :: Word8 -> L.ByteString -> Property +satisfyWith w s = parseBS (P.satisfyWith (chr . fromIntegral) (<=c)) + (L.cons (fromIntegral (ord c)) s) === Just c + where + c = chr (fromIntegral w) + +word8 :: Word8 -> L.ByteString -> Property +word8 w s = parseBS (P.word8 w) (L.cons w s) === Just w + +skip :: Word8 -> L.ByteString -> Property +skip w s = + case (parseBS (P.skip ( maybe (property True) (expectFailure . it) mcs + (Just _, mcs) -> maybe (property False) it mcs + where it cs = liftOp "<" (<) (fst cs) w + +anyWord8 :: L.ByteString -> Property +anyWord8 s + | L.null s = p === Nothing + | otherwise = p === Just (L.head s) + where p = parseBS P.anyWord8 s + +notWord8 :: Word8 -> NonEmptyList Word8 -> Property +notWord8 w (NonEmpty s) = parseBS (P.notWord8 w) bs === if v == w + then Nothing + else Just v + where v = L.head bs + bs = L.pack s + +peekWord8 :: L.ByteString -> Property +peekWord8 s + | L.null s = p === Just (Nothing, s) + | otherwise = p === Just (Just (L.head s), s) + where p = parseBS ((,) <$> P.peekWord8 <*> P.takeLazyByteString) s + +peekWord8' :: L.ByteString -> Property +peekWord8' s = parseBS P.peekWord8' s === (fst <$> L.uncons s) + +string :: L.ByteString -> L.ByteString -> Property +string s t = parseBS (P.string s') (s `L.append` t) === Just s' + where s' = toStrictBS s + +stringCI :: ASCII L.ByteString -> ASCII L.ByteString -> Property +stringCI (ASCII s) (ASCII t) = + parseBS (P8.stringCI up) (s `L.append` t) === Just s' + where s' = toStrictBS s + up = B8.map toUpper s' + +strings :: L.ByteString -> L.ByteString -> L.ByteString -> Property +strings s t u = + parseBS (P.string (toStrictBS s) >> P.string t') (L.concat [s,t,u]) + === Just t' + where t' = toStrictBS t + +skipWhile :: Word8 -> L.ByteString -> Property +skipWhile w s = + let t = L.dropWhile (<=w) s + in case PL.parse (P.skipWhile (<=w)) s of + PL.Done t' () -> t === t' + _ -> property False + +takeCount :: Positive Int -> L.ByteString -> Property +takeCount (Positive k) s = + case parseBS (P.take k) s of + Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s) + Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s) + +takeWhile :: Word8 -> L.ByteString -> Property +takeWhile w s = + let (h,t) = L.span (==w) s + in case PL.parse (P.takeWhile (==w)) s of + PL.Done t' h' -> t === t' .&&. toStrictBS h === h' + _ -> property False + +take :: Int -> L.ByteString -> Property +take n s = maybe (property $ L.length s < fromIntegral n) + (=== B.take n (toStrictBS s)) $ + parseBS (P.take n) s + +takeByteString :: L.ByteString -> Property +takeByteString s = maybe (property False) (=== toStrictBS s) . + parseBS P.takeByteString $ s + +takeLazyByteString :: L.ByteString -> Property +takeLazyByteString s = maybe (property False) (=== s) . + parseBS P.takeLazyByteString $ s + +takeWhile1 :: Word8 -> L.ByteString -> Property +takeWhile1 w s = + let s' = L.cons w s + (h,t) = L.span (<=w) s' + in case PL.parse (P.takeWhile1 (<=w)) s' of + PL.Done t' h' -> t === t' .&&. toStrictBS h === h' + _ -> property False + +takeWhileIncluding :: Word8 -> L.ByteString -> Property +takeWhileIncluding w s = + let s' = L.cons w $ L.snoc s (w+1) + (h_,t_) = L.span (<=w) s' + (h,t) = + case L.uncons t_ of + Nothing -> (h_, t_) + Just (n, nt) -> (h_ `L.snoc` n, nt) + in w < 255 ==> case PL.parse (P.takeWhileIncluding (<=w)) s' of + PL.Done t' h' -> t === t' .&&. toStrictBS h === h' + _ -> property False + +takeTill :: Word8 -> L.ByteString -> Property +takeTill w s = + let (h,t) = L.break (==w) s + in case PL.parse (P.takeTill (==w)) s of + PL.Done t' h' -> t === t' .&&. toStrictBS h === h' + _ -> property False + +takeWhile1_empty :: Property +takeWhile1_empty = parseBS (P.takeWhile1 undefined) L.empty === Nothing + +getChunk :: L.ByteString -> Property +getChunk s = + maybe (property False) (=== L.toChunks s) $ + parseBS getChunks s + where getChunks = go [] + go res = do + mchunk <- P.getChunk + case mchunk of + Nothing -> return (reverse res) + Just chunk -> do + _ <- P.take (B.length chunk) + go (chunk:res) + +endOfInput :: L.ByteString -> Property +endOfInput s = parseBS P.endOfInput s === if L.null s + then Just () + else Nothing + +endOfLine :: L.ByteString -> Property +endOfLine s = + case (parseBS P8.endOfLine s, L8.uncons s) of + (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs + (Just _, mcs) -> maybe (property False) eol mcs + where eol (c,s') = c === '\n' .||. + (c, fst <$> L8.uncons s') === ('\r', Just '\n') + +scan :: L.ByteString -> Positive Int64 -> Property +scan s (Positive k) = parseBS p s === Just (toStrictBS $ L.take k s) + where p = P.scan k $ \ n _ -> + if n > 0 then let !n' = n - 1 in Just n' else Nothing + +members :: [Word8] -> Property +members s = property $ all (`S.memberWord8` set) s + where set = S.fromList s + +nonmembers :: [Word8] -> [Word8] -> Property +nonmembers s s' = property . not . any (`S.memberWord8` set) $ filter (not . (`elem` s)) s' + where set = S.fromList s + +tests :: [TestTree] +tests = [ + testProperty "anyWord8" anyWord8 + , testProperty "endOfInput" endOfInput + , testProperty "endOfLine" endOfLine + , testProperty "notWord8" notWord8 + , testProperty "peekWord8" peekWord8 + , testProperty "peekWord8'" peekWord8' + , testProperty "satisfy" satisfy + , testProperty "satisfyWith" satisfyWith + , testProperty "scan" scan + , testProperty "skip" skip + , testProperty "skipWhile" skipWhile + , testProperty "string" string + , testProperty "stringCI" stringCI + , testProperty "strings" strings + , testProperty "take" take + , testProperty "takeByteString" takeByteString + , testProperty "takeCount" takeCount + , testProperty "takeLazyByteString" takeLazyByteString + , testProperty "takeTill" takeTill + , testProperty "takeWhile" takeWhile + , testProperty "takeWhile1" takeWhile1 + , testProperty "takeWhile1_empty" takeWhile1_empty + , testProperty "takeWhileIncluding" takeWhileIncluding + , testProperty "getChunk" getChunk + , testProperty "word8" word8 + , testProperty "members" members + , testProperty "nonmembers" nonmembers + ] diff --git a/tests/QC/Combinator.hs b/tests/QC/Combinator.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Combinator.hs @@ -0,0 +1,52 @@ +{-# LANGUAGE CPP, OverloadedStrings #-} + +module QC.Combinator where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((<*>), (<$>), (<*), (*>)) +#endif +import Data.Maybe (fromJust, isJust) +import Data.Word (Word8) +import QC.Common (Repack, parseBS, repackBS, toLazyBS) +import Test.Tasty (TestTree) +import Test.Tasty.QuickCheck (testProperty) +import Test.QuickCheck +import qualified Data.Attoparsec.ByteString.Char8 as P +import qualified Data.Attoparsec.Combinator as C +import qualified Data.ByteString as B +import qualified Data.ByteString.Char8 as B8 + +choice :: NonEmptyList (NonEmptyList Word8) -> Gen Property +choice (NonEmpty xs) = do + let ys = map (B.pack . getNonEmpty) xs + return . forAll (repackBS <$> arbitrary <*> elements ys) $ + maybe False (`elem` ys) . parseBS (C.choice (map P.string ys)) + +count :: Positive (Small Int) -> Repack -> B.ByteString -> Bool +count (Positive (Small n)) rs s = + (length <$> parseBS (C.count n (P.string s)) input) == Just n + where input = repackBS rs (B.concat (replicate (n+1) s)) + +lookAhead :: NonEmptyList Word8 -> Bool +lookAhead (NonEmpty xs) = + let ys = B.pack xs + withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys + mr = parseBS withLookAheadThenConsume $ toLazyBS ys + in isJust mr && fst (fromJust mr) == snd (fromJust mr) + +match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool +match n (NonNegative x) (NonNegative y) rs = + parseBS (P.match parser) (repackBS rs input) == Just (input, n) + where parser = P.skipWhile (=='x') *> P.signed P.decimal <* + P.skipWhile (=='y') + input = B.concat [ + B8.replicate x 'x', B8.pack (show n), B8.replicate y 'y' + ] + +tests :: [TestTree] +tests = [ + testProperty "choice" choice + , testProperty "count" count + , testProperty "lookAhead" lookAhead + , testProperty "match" match + ] diff --git a/tests/QC/Common.hs b/tests/QC/Common.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Common.hs @@ -0,0 +1,113 @@ +{-# LANGUAGE CPP, FlexibleInstances #-} +{-# OPTIONS_GHC -fno-warn-orphans #-} +module QC.Common + ( + ASCII(..) + , parseBS + , parseT + , toLazyBS + , toStrictBS + , Repack + , repackBS + , repackBS_ + , repackT + , repackT_ + , liftOp + ) where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((<*>), (<$>)) +#endif +import Data.Char (isAlpha) +import Test.QuickCheck +import Test.QuickCheck.Unicode (shrinkChar, string) +import qualified Data.ByteString as B +import qualified Data.ByteString.Lazy as BL +import qualified Data.Text as T +import qualified Data.Text.Lazy as TL +import qualified Data.Attoparsec.ByteString.Lazy as BL +import qualified Data.Attoparsec.Text.Lazy as TL + +#if !MIN_VERSION_base(4,4,0) +-- This should really be a dependency on the random package :-( +instance Random Word8 where + randomR = integralRandomR + random = randomR (minBound,maxBound) + +instance Arbitrary Word8 where + arbitrary = choose (minBound, maxBound) +#endif + +parseBS :: BL.Parser r -> BL.ByteString -> Maybe r +parseBS p = BL.maybeResult . BL.parse p + +parseT :: TL.Parser r -> TL.Text -> Maybe r +parseT p = TL.maybeResult . TL.parse p + +toStrictBS :: BL.ByteString -> B.ByteString +toStrictBS = B.concat . BL.toChunks + +toLazyBS :: B.ByteString -> BL.ByteString +toLazyBS = BL.fromChunks . (:[]) + +instance Arbitrary B.ByteString where + arbitrary = B.pack <$> arbitrary + shrink = map B.pack . shrink . B.unpack + +instance Arbitrary BL.ByteString where + arbitrary = repackBS <$> arbitrary <*> arbitrary + shrink = map BL.pack . shrink . BL.unpack + +newtype ASCII a = ASCII { fromASCII :: a } + deriving (Eq, Ord, Show) + +instance Arbitrary (ASCII B.ByteString) where + arbitrary = (ASCII . B.pack) <$> listOf (choose (0,127)) + shrink = map (ASCII . B.pack) . shrink . B.unpack . fromASCII + +instance Arbitrary (ASCII BL.ByteString) where + arbitrary = ASCII <$> (repackBS <$> arbitrary <*> (fromASCII <$> arbitrary)) + shrink = map (ASCII . BL.pack) . shrink . BL.unpack . fromASCII + +type Repack = NonEmptyList (Positive (Small Int)) + +repackBS :: Repack -> B.ByteString -> BL.ByteString +repackBS (NonEmpty bs) = + BL.fromChunks . repackBS_ (map (getSmall . getPositive) bs) + +repackBS_ :: [Int] -> B.ByteString -> [B.ByteString] +repackBS_ = go . cycle + where go (b:bs) s + | B.null s = [] + | otherwise = let (h,t) = B.splitAt b s + in h : go bs t + go _ _ = error "unpossible" + +instance Arbitrary T.Text where + arbitrary = T.pack <$> string + shrink = map T.pack . shrinkList shrinkChar . T.unpack + +instance Arbitrary TL.Text where + arbitrary = TL.pack <$> string + shrink = map TL.pack . shrinkList shrinkChar . TL.unpack + +repackT :: Repack -> T.Text -> TL.Text +repackT (NonEmpty bs) = + TL.fromChunks . repackT_ (map (getSmall . getPositive) bs) + +repackT_ :: [Int] -> T.Text -> [T.Text] +repackT_ = go . cycle + where go (b:bs) s + | T.null s = [] + | otherwise = let (h,t) = T.splitAt b s + in h : go bs t + go _ _ = error "unpossible" + +liftOp :: (Show a, Testable prop) => + String -> (a -> a -> prop) -> a -> a -> Property +liftOp name f x y = counterexample desc (f x y) + where op = case name of + (c:_) | isAlpha c -> " `" ++ name ++ "` " + | otherwise -> " " ++ name ++ " " + _ -> " ??? " + desc = "not (" ++ show x ++ op ++ show y ++ ")" diff --git a/tests/QC/IPv6/Internal.hs b/tests/QC/IPv6/Internal.hs new file mode 100644 --- /dev/null +++ b/tests/QC/IPv6/Internal.hs @@ -0,0 +1,316 @@ +-- ----------------------------------------------------------------------------- + +-- | +-- Module : Text.IPv6Addr +-- Copyright : Copyright © Michel Boucey 2011-2015 +-- License : BSD-Style +-- Maintainer : michel.boucey@gmail.com +-- +-- Dealing with IPv6 address text representations, canonization and manipulations. +-- + +-- ----------------------------------------------------------------------------- + +{-# LANGUAGE OverloadedStrings #-} + +module QC.IPv6.Internal where {- + ( expandTokens + , macAddr + , maybeIPv6AddrTokens + , ipv4AddrToIPv6AddrTokens + , ipv6TokensToText + , ipv6TokensToIPv6Addr + , isIPv6Addr + , maybeTokIPv6Addr + , maybeTokPureIPv6Addr + , fromDoubleColon + , fromIPv6Addr + , toDoubleColon + ) where -} + +import Debug.Trace +import Control.Monad (replicateM) +import Data.Attoparsec.Text +import Data.Char (isDigit,isHexDigit,toLower) +import Data.Monoid ((<>)) +import Control.Applicative ((<|>),(<*)) +import Data.List (group,isSuffixOf,elemIndex,elemIndices,intersperse) +import Data.Word (Word32) +import Numeric (showHex) +import qualified Data.Text as T +import qualified Data.Text.Read as R (decimal) +import Data.Maybe (fromJust) + +import QC.IPv6.Types + +tok0 = "0" + +-- | Returns the 'T.Text' of an IPv6 address. +fromIPv6Addr :: IPv6Addr -> T.Text +fromIPv6Addr (IPv6Addr t) = t + +-- | Given an arbitrary list of 'IPv6AddrToken', returns the corresponding 'T.Text'. +ipv6TokensToText :: [IPv6AddrToken] -> T.Text +ipv6TokensToText l = T.concat $ map ipv6TokenToText l + +-- | Returns the corresponding 'T.Text' of an IPv6 address token. +ipv6TokenToText :: IPv6AddrToken -> T.Text +ipv6TokenToText (SixteenBit s) = s +ipv6TokenToText Colon = ":" +ipv6TokenToText DoubleColon = "::" +ipv6TokenToText AllZeros = tok0 -- "A single 16-bit 0000 field MUST be represented as 0" (RFC 5952, 4.1) +ipv6TokenToText (IPv4Addr a) = a + +-- | Returns 'True' if a list of 'IPv6AddrToken' constitutes a valid IPv6 Address. +isIPv6Addr :: [IPv6AddrToken] -> Bool +isIPv6Addr [] = False +isIPv6Addr [DoubleColon] = True +isIPv6Addr [DoubleColon,SixteenBit tok1] = True +isIPv6Addr tks = + diffNext tks && (do + let cdctks = countDoubleColon tks + let lentks = length tks + let lasttk = last tks + let lenconst = (lentks == 15 && cdctks == 0) || (lentks < 15 && cdctks == 1) + firstValidToken tks && + (case countIPv4Addr tks of + 0 -> case lasttk of + SixteenBit _ -> lenconst + DoubleColon -> lenconst + AllZeros -> lenconst + _ -> False + 1 -> case lasttk of + IPv4Addr _ -> (lentks == 13 && cdctks == 0) || (lentks < 12 && cdctks == 1) + _ -> False + otherwise -> False)) + where diffNext [] = False + diffNext [_] = True + diffNext (t:ts) = do + let h = head ts + case t of + SixteenBit _ -> case h of + SixteenBit _ -> False + AllZeros -> False + _ -> diffNext ts + AllZeros -> case h of + SixteenBit _ -> False + AllZeros -> False + _ -> diffNext ts + _ -> diffNext ts + firstValidToken l = + case head l of + SixteenBit _ -> True + DoubleColon -> True + AllZeros -> True + _ -> False + countDoubleColon l = length $ elemIndices DoubleColon l + tok1 = "1" + +countIPv4Addr = foldr oneMoreIPv4Addr 0 + where + oneMoreIPv4Addr t c = case t of + IPv4Addr _ -> c + 1 + otherwise -> c + +-- | This is the main function which returns 'Just' the list of a tokenized IPv6 +-- address text representation validated against RFC 4291 and canonized +-- in conformation with RFC 5952, or 'Nothing'. +maybeTokIPv6Addr :: T.Text -> Maybe [IPv6AddrToken] +maybeTokIPv6Addr t = + case maybeIPv6AddrTokens t of + Just ltks -> if isIPv6Addr ltks + then Just $ (ipv4AddrReplacement . toDoubleColon . fromDoubleColon) ltks + else Nothing + Nothing -> Nothing + where + ipv4AddrReplacement ltks = + if ipv4AddrRewrite ltks + then init ltks ++ ipv4AddrToIPv6AddrTokens (last ltks) + else ltks + +-- | Returns 'Just' the list of tokenized pure IPv6 address, always rewriting an +-- embedded IPv4 address if present. +maybeTokPureIPv6Addr :: T.Text -> Maybe [IPv6AddrToken] +maybeTokPureIPv6Addr t = do + ltks <- maybeIPv6AddrTokens t + if isIPv6Addr ltks + then Just $ (toDoubleColon . ipv4AddrReplacement . fromDoubleColon) ltks + else Nothing + where + ipv4AddrReplacement ltks' = init ltks' ++ ipv4AddrToIPv6AddrTokens (last ltks') + +-- | Tokenize a 'T.Text' into 'Just' a list of 'IPv6AddrToken', or 'Nothing'. +maybeIPv6AddrTokens :: T.Text -> Maybe [IPv6AddrToken] +maybeIPv6AddrTokens s = + case readText s of + Done r l -> traceShow (r,l) $ if r==T.empty then Just l else Nothing + Fail {} -> Nothing + where + readText s = feed (parse (many1 $ ipv4Addr <|> sixteenBit <|> doubleColon <|> colon) s) T.empty + +-- | An embedded IPv4 address have to be rewritten to output a pure IPv6 Address +-- text representation in hexadecimal digits. But some well-known prefixed IPv6 +-- addresses have to keep visible in their text representation the fact that +-- they deals with IPv4 to IPv6 transition process (RFC 5952 Section 5): +-- +-- IPv4-compatible IPv6 address like "::1.2.3.4" +-- +-- IPv4-mapped IPv6 address like "::ffff:1.2.3.4" +-- +-- IPv4-translated address like "::ffff:0:1.2.3.4" +-- +-- IPv4-translatable address like "64:ff9b::1.2.3.4" +-- +-- ISATAP address like "fe80::5efe:1.2.3.4" +-- +ipv4AddrRewrite :: [IPv6AddrToken] -> Bool +ipv4AddrRewrite tks = + case last tks of + IPv4Addr _ -> do + let itks = init tks + not (itks == [DoubleColon] + || itks == [DoubleColon,SixteenBit tokffff,Colon] + || itks == [DoubleColon,SixteenBit tokffff,Colon,AllZeros,Colon] + || itks == [SixteenBit "64",Colon,SixteenBit "ff9b",DoubleColon] + || [SixteenBit "200",Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks + || [AllZeros,Colon,SixteenBit tok5efe,Colon] `isSuffixOf` itks + || [DoubleColon,SixteenBit tok5efe,Colon] `isSuffixOf` itks) + _ -> False + where + tokffff = "ffff" + tok5efe = "5efe" + +-- | Rewrites an embedded 'IPv4Addr' into the corresponding list of pure 'IPv6Addr' tokens. +-- +-- > ipv4AddrToIPv6AddrTokens (IPv4Addr "127.0.0.1") == [SixteenBits "7f0",Colon,SixteenBits "1"] +-- +ipv4AddrToIPv6AddrTokens :: IPv6AddrToken -> [IPv6AddrToken] +ipv4AddrToIPv6AddrTokens t = + case t of + IPv4Addr a -> do + let m = toHex a + [ SixteenBit ((!!) m 0 <> addZero ((!!) m 1)) + , Colon + , SixteenBit ((!!) m 2 <> addZero ((!!) m 3)) ] + _ -> [t] + where + toHex a = map (\x -> T.pack $ showHex (read (T.unpack x)::Int) "") $ T.split (=='.') a + addZero d = if T.length d == 1 then tok0 <> d else d + +expandTokens :: [IPv6AddrToken] -> [IPv6AddrToken] +expandTokens = map expandToken + where expandToken (SixteenBit s) = SixteenBit $ T.justifyRight 4 '0' s + expandToken AllZeros = SixteenBit "0000" + expandToken t = t + +fromDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken] +fromDoubleColon tks = + if DoubleColon `notElem` tks + then tks + else do let s = splitAt (fromJust $ elemIndex DoubleColon tks) tks + let fsts = fst s + let snds = if not (null (snd s)) then tail(snd s) else [] + let fste = if null fsts then [] else fsts ++ [Colon] + let snde = if null snds then [] else Colon : snds + fste ++ allZerosTokensReplacement(quantityOfAllZerosTokenToReplace tks) ++ snde + where + allZerosTokensReplacement x = intersperse Colon (replicate x AllZeros) + quantityOfAllZerosTokenToReplace x = + ntks tks - foldl (\c x -> if (x /= DoubleColon) && (x /= Colon) then c+1 else c) 0 x + where + ntks tks = if countIPv4Addr tks == 1 then 7 else 8 + +toDoubleColon :: [IPv6AddrToken] -> [IPv6AddrToken] +toDoubleColon tks = + zerosToDoubleColon tks (zerosRunToReplace $ zerosRunsList tks) + where + zerosToDoubleColon :: [IPv6AddrToken] -> (Int,Int) -> [IPv6AddrToken] + -- No all zeros token, so no double colon replacement... + zerosToDoubleColon ls (_,0) = ls + -- "The symbol '::' MUST NOT be used to shorten just one 16-bit 0 field" (RFC 5952 4.2.2) + zerosToDoubleColon ls (_,1) = ls + zerosToDoubleColon ls (i,l) = + let ls' = filter (/= Colon) ls + in intersperse Colon (Prelude.take i ls') ++ [DoubleColon] ++ intersperse Colon (drop (i+l) ls') + zerosRunToReplace t = + let l = longestLengthZerosRun t + in (firstLongestZerosRunIndex t l,l) + where + firstLongestZerosRunIndex x y = sum . snd . unzip $ Prelude.takeWhile (/=(True,y)) x + longestLengthZerosRun x = + maximum $ map longest x + where longest t = case t of + (True,i) -> i + _ -> 0 + zerosRunsList x = map helper $ groupZerosRuns x + where + helper h = (head h == AllZeros, lh) where lh = length h + groupZerosRuns = group . filter (/= Colon) + +ipv6TokensToIPv6Addr :: [IPv6AddrToken] -> Maybe IPv6Addr +ipv6TokensToIPv6Addr l = Just $ IPv6Addr $ ipv6TokensToText l + +fullSixteenBit :: T.Text -> Maybe IPv6AddrToken +fullSixteenBit t = + case parse ipv6AddrFullChunk t of + Done a b -> if a==T.empty then Just $ SixteenBit $ T.pack b else Nothing + _ -> Nothing + +macAddr :: Parser (Maybe [IPv6AddrToken]) +macAddr = do + n1 <- count 2 hexaChar <* ":" + n2 <- count 2 hexaChar <* ":" + n3 <- count 2 hexaChar <* ":" + n4 <- count 2 hexaChar <* ":" + n5 <- count 2 hexaChar <* ":" + n6 <- count 2 hexaChar + return $ maybeIPv6AddrTokens $ T.pack $ concat [n1,n2,n3,n4,n5,n6] + +sixteenBit :: Parser IPv6AddrToken +sixteenBit = do + r <- ipv6AddrFullChunk <|> count 3 hexaChar <|> count 2 hexaChar <|> count 1 hexaChar + -- "Leading zeros MUST be suppressed" (RFC 5952, 4.1) + let r' = T.dropWhile (=='0') $ T.pack r + return $ if T.null r' + then AllZeros + -- Hexadecimal digits MUST be in lowercase (RFC 5952 4.3) + else SixteenBit $ T.toLower r' + +ipv4Addr :: Parser IPv6AddrToken +ipv4Addr = do + n1 <- manyDigits <* "." + if n1 /= T.empty + then do n2 <- manyDigits <* "." + if n2 /= T.empty + then do n3 <- manyDigits <* "." + if n3 /= T.empty + then do n4 <- manyDigits + if n4 /= T.empty + then return $ IPv4Addr $ T.intercalate "." [n1,n2,n3,n4] + else parserFailure + else parserFailure + else parserFailure + else parserFailure + where + parserFailure = fail "ipv4Addr parsing failure" + manyDigits = do + ds <- takeWhile1 isDigit + case R.decimal ds of + Right (n,_) -> return (if n < 256 then T.pack $ show n else T.empty) + Left _ -> return T.empty + +doubleColon :: Parser IPv6AddrToken +doubleColon = do + string "::" + return DoubleColon + +colon :: Parser IPv6AddrToken +colon = do + string ":" + return Colon + +ipv6AddrFullChunk :: Parser String +ipv6AddrFullChunk = count 4 hexaChar + +hexaChar :: Parser Char +hexaChar = satisfy (inClass "0-9a-fA-F") diff --git a/tests/QC/IPv6/Types.hs b/tests/QC/IPv6/Types.hs new file mode 100644 --- /dev/null +++ b/tests/QC/IPv6/Types.hs @@ -0,0 +1,29 @@ +-- ----------------------------------------------------------------------------- + +-- | +-- Module : Text.IPv6Addr +-- Copyright : Copyright © Michel Boucey 2011-2015 +-- License : BSD-Style +-- Maintainer : michel.boucey@gmail.com +-- +-- Dealing with IPv6 address text representations, canonization and manipulations. +-- + +-- ----------------------------------------------------------------------------- + +module QC.IPv6.Types where + +import qualified Data.Text as T + +data IPv6Addr = IPv6Addr T.Text + +instance Show IPv6Addr where + show (IPv6Addr addr) = T.unpack addr + +data IPv6AddrToken + = SixteenBit T.Text -- ^ A four hexadecimal digits group representing a 16-Bit chunk + | AllZeros -- ^ An all zeros 16-Bit chunk + | Colon -- ^ A separator between 16-Bit chunks + | DoubleColon -- ^ A double-colon stands for a unique compression of many consecutive 16-Bit chunks + | IPv4Addr T.Text -- ^ An embedded IPv4 address as representation of the last 32-Bit + deriving (Eq,Show) diff --git a/tests/QC/Rechunked.hs b/tests/QC/Rechunked.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Rechunked.hs @@ -0,0 +1,56 @@ +{-# LANGUAGE BangPatterns #-} + +module QC.Rechunked ( + rechunkBS + , rechunkT + ) where + +import Control.Monad (forM, forM_) +import Control.Monad.ST (ST, runST) +import Data.List (unfoldr) +import Test.QuickCheck (Gen, choose) +import qualified Data.ByteString as B +import qualified Data.Text as T +import qualified Data.Vector as V +import qualified Data.Vector.Generic as G +import qualified Data.Vector.Generic.Mutable as M + +rechunkBS :: B.ByteString -> Gen [B.ByteString] +rechunkBS = fmap (map B.copy) . rechunk_ B.splitAt B.length + +rechunkT :: T.Text -> Gen [T.Text] +rechunkT = fmap (map T.copy) . rechunk_ T.splitAt T.length + +rechunk_ :: (Int -> a -> (a,a)) -> (a -> Int) -> a -> Gen [a] +rechunk_ split len xs = (unfoldr go . (,) xs) `fmap` rechunkSizes (len xs) + where go (b,r:rs) = Just (h, (t,rs)) + where (h,t) = split r b + go (_,_) = Nothing + +rechunkSizes :: Int -> Gen [Int] +rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0 + where loop _ [] _ = error "it's 2015, where's my Stream type?" + loop acc (lb:lbs) n + | n <= 0 = shuffle (reverse acc) + | otherwise = do + !i <- choose (lb,n) + loop (i:acc) lbs (n-i) + +shuffle :: [Int] -> Gen [Int] +shuffle (0:xs) = (0:) `fmap` shuffle xs +shuffle xs = fisherYates xs + +fisherYates :: [a] -> Gen [a] +fisherYates xs = (V.toList . V.backpermute v) `fmap` swapIndices (G.length v) + where + v = V.fromList xs + swapIndices n0 = do + swaps <- forM [0..n] $ \i -> ((,) i) `fmap` choose (i,n) + return (runST (swapAll swaps)) + where + n = n0 - 1 + swapAll :: [(Int,Int)] -> ST s (V.Vector Int) + swapAll ijs = do + mv <- G.unsafeThaw (G.enumFromTo 0 n :: V.Vector Int) + forM_ ijs $ uncurry (M.swap mv) + G.unsafeFreeze mv diff --git a/tests/QC/Simple.hs b/tests/QC/Simple.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Simple.hs @@ -0,0 +1,37 @@ +{-# LANGUAGE OverloadedStrings #-} +{-# OPTIONS_GHC -fno-warn-missing-signatures #-} + +module QC.Simple ( + tests + ) where + +import Control.Applicative ((<|>)) +import Data.ByteString (ByteString) +import Data.List (foldl') +import Data.Maybe (fromMaybe) +import QC.Rechunked (rechunkBS) +import Test.Tasty (TestTree) +import Test.Tasty.QuickCheck (testProperty) +import Test.QuickCheck (Property, counterexample, forAll) +import qualified Data.Attoparsec.ByteString.Char8 as A + +t_issue75 = expect issue75 "ab" (A.Done "" "b") + +issue75 :: A.Parser ByteString +issue75 = "a" >> ("b" <|> "") + +expect :: (Show r, Eq r) => A.Parser r -> ByteString -> A.Result r -> Property +expect p input wanted = + forAll (rechunkBS input) $ \in' -> + let result = parse p in' + in counterexample (show result ++ " /= " ++ show wanted) $ + fromMaybe False (A.compareResults result wanted) + +parse :: A.Parser r -> [ByteString] -> A.Result r +parse p (x:xs) = foldl' A.feed (A.parse p x) xs +parse p [] = A.parse p "" + +tests :: [TestTree] +tests = [ + testProperty "issue75" t_issue75 + ] diff --git a/tests/QC/Text.hs b/tests/QC/Text.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Text.hs @@ -0,0 +1,203 @@ +{-# LANGUAGE BangPatterns, CPP, OverloadedStrings #-} +{-# OPTIONS_GHC -fno-warn-warnings-deprecations #-} +module QC.Text (tests) where + +#if !MIN_VERSION_base(4,8,0) +import Control.Applicative ((<*>), (<$>)) +#endif +import Data.Int (Int64) +import Data.Word (Word8) +import Prelude hiding (take, takeWhile) +import QC.Common (liftOp, parseT) +import qualified QC.Text.FastSet as FastSet +import qualified QC.Text.Regressions as Regressions +import Test.Tasty (TestTree, testGroup) +import Test.Tasty.QuickCheck (testProperty) +import Test.QuickCheck +import qualified Data.Attoparsec.Text as P +import qualified Data.Attoparsec.Text.Lazy as PL +import qualified Data.Attoparsec.Text.FastSet as S +import qualified Data.ByteString as BS +import qualified Data.Char as Char +import qualified Data.Text as T +import qualified Data.Text.Encoding as TE +import qualified Data.Text.Lazy as L + +-- Basic byte-level combinators. + +satisfy :: Char -> L.Text -> Property +satisfy w s = parseT (P.satisfy (<=w)) (L.cons w s) === Just w + +satisfyWith :: Char -> L.Text -> Property +satisfyWith c s = parseT (P.satisfyWith id (<=c)) (L.cons c s) === Just c + +char :: Char -> L.Text -> Property +char w s = parseT (P.char w) (L.cons w s) === Just w + +skip :: Char -> L.Text -> Property +skip w s = + case (parseT (P.skip ( maybe (property True) (expectFailure . it) mcs + (Just _, mcs) -> maybe (property False) it mcs + where it cs = liftOp "<" (<) (fst cs) w + +anyChar :: L.Text -> Property +anyChar s + | L.null s = p === Nothing + | otherwise = p === Just (L.head s) + where p = parseT P.anyChar s + +notChar :: Char -> NonEmptyList Char -> Property +notChar w (NonEmpty s) = parseT (P.notChar w) bs === if v == w + then Nothing + else Just v + where v = L.head bs + bs = L.pack s + +peekChar :: L.Text -> Property +peekChar s + | L.null s = p === Just (Nothing, s) + | otherwise = p === Just (Just (L.head s), s) + where p = parseT ((,) <$> P.peekChar <*> P.takeLazyText) s + +peekChar' :: L.Text -> Property +peekChar' s = parseT P.peekChar' s === (fst <$> L.uncons s) + +string :: L.Text -> L.Text -> Property +string s t = parseT (P.string s') (s `L.append` t) === Just s' + where s' = toStrict s + +strings :: L.Text -> L.Text -> L.Text -> Property +strings s t u = + parseT (P.string (toStrict s) >> P.string t') (L.concat [s,t,u]) + === Just t' + where t' = toStrict t + +-- | Note: "simple, and efficient" works for well formed input... +-- i.e. e.g. Latin1 texts +stringCI :: [Word8] -> Property +stringCI ws = P.parseOnly (P.stringCI fs) s === Right s + where fs = T.toCaseFold s + s = TE.decodeLatin1 (BS.pack ws) + +asciiCI :: T.Text -> Gen Bool +asciiCI x = + (\s i -> P.parseOnly (P.asciiCI s) i == Right i) + <$> maybeModifyCase x + <*> maybeModifyCase x + where + maybeModifyCase s = elements [s, toLower s, toUpper s] + toLower = T.map (\c -> if c < Char.chr 127 then Char.toLower c else c) + toUpper = T.map (\c -> if c < Char.chr 127 then Char.toUpper c else c) + +toStrict :: L.Text -> T.Text +toStrict = T.concat . L.toChunks + +skipWhile :: Char -> L.Text -> Property +skipWhile w s = + let t = L.dropWhile (<=w) s + in case PL.parse (P.skipWhile (<=w)) s of + PL.Done t' () -> t === t' + _ -> property False + +take :: Int -> L.Text -> Property +take n s = maybe (liftOp "<" (<) (L.length s) (fromIntegral n)) + (=== T.take n (toStrict s)) $ + parseT (P.take n) s + +takeText :: L.Text -> Property +takeText s = maybe (property False) (=== toStrict s) . parseT P.takeText $ s + +takeLazyText :: L.Text -> Property +takeLazyText s = maybe (property False) (=== s) . parseT P.takeLazyText $ s + +takeCount :: Positive Int -> L.Text -> Property +takeCount (Positive k) s = + case parseT (P.take k) s of + Nothing -> liftOp ">" (>) (fromIntegral k) (L.length s) + Just _s -> liftOp "<=" (<=) (fromIntegral k) (L.length s) + +takeWhile :: Char -> L.Text -> Property +takeWhile w s = + let (h,t) = L.span (==w) s + in case PL.parse (P.takeWhile (==w)) s of + PL.Done t' h' -> t === t' .&&. toStrict h === h' + _ -> property False + +takeWhile1 :: Char -> L.Text -> Property +takeWhile1 w s = + let s' = L.cons w s + (h,t) = L.span (<=w) s' + in case PL.parse (P.takeWhile1 (<=w)) s' of + PL.Done t' h' -> t === t' .&&. toStrict h === h' + _ -> property False + +takeTill :: Char -> L.Text -> Property +takeTill w s = + let (h,t) = L.break (==w) s + in case PL.parse (P.takeTill (==w)) s of + PL.Done t' h' -> t === t' .&&. toStrict h === h' + _ -> property False + +takeWhile1_empty :: Property +takeWhile1_empty = parseT (P.takeWhile1 undefined) L.empty === Nothing + +endOfInput :: L.Text -> Property +endOfInput s = parseT P.endOfInput s === if L.null s + then Just () + else Nothing + +endOfLine :: L.Text -> Property +endOfLine s = + case (parseT P.endOfLine s, L.uncons s) of + (Nothing, mcs) -> maybe (property True) (expectFailure . eol) mcs + (Just _, mcs) -> maybe (property False) eol mcs + where eol (c,s') = c === '\n' .||. + (c, fst <$> L.uncons s') === ('\r', Just '\n') + +scan :: L.Text -> Positive Int64 -> Property +-- for some reason, if counterexample is removed, this test fails? +scan s (Positive k) = counterexample (show s) + $ parseT p s === Just (toStrict $ L.take k s) + where p = P.scan k $ \ n _ -> + if n > 0 then let !n' = n - 1 in Just n' else Nothing + +members :: String -> Property +members s = property $ all (`S.member` set) s + where set = S.fromList s + +nonmembers :: String -> String -> Property +nonmembers s s' = property . not . any (`S.member` set) $ filter (not . (`elem` s)) s' + where set = S.fromList s + +tests :: [TestTree] +tests = [ + testProperty "anyChar" anyChar + , testProperty "asciiCI" asciiCI + , testProperty "char" char + , testProperty "endOfInput" endOfInput + , testProperty "endOfLine" endOfLine + , testProperty "notChar" notChar + , testProperty "peekChar" peekChar + , testProperty "peekChar'" peekChar' + , testProperty "satisfy" satisfy + , testProperty "satisfyWith" satisfyWith + , testProperty "scan" scan + , testProperty "skip" skip + , testProperty "skipWhile" skipWhile + , testProperty "string" string + , testProperty "strings" strings + , testProperty "stringCI" stringCI + , testProperty "take" take + , testProperty "takeText" takeText + , testProperty "takeCount" takeCount + , testProperty "takeLazyText" takeLazyText + , testProperty "takeTill" takeTill + , testProperty "takeWhile" takeWhile + , testProperty "takeWhile1" takeWhile1 + , testProperty "takeWhile1_empty" takeWhile1_empty + , testProperty "members" members + , testProperty "nonmembers" nonmembers + , testGroup "FastSet" FastSet.tests + , testGroup "Regressions" Regressions.tests + ] diff --git a/tests/QC/Text/FastSet.hs b/tests/QC/Text/FastSet.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Text/FastSet.hs @@ -0,0 +1,15 @@ +module QC.Text.FastSet where + +import Test.Tasty (TestTree) +import Test.Tasty.QuickCheck (testProperty) +import Test.QuickCheck +import qualified Data.Attoparsec.Text.FastSet as FastSet + +membershipCorrect :: String -> String -> Property +membershipCorrect members others = + let fs = FastSet.fromList members + correct c = (c `FastSet.member` fs) == (c `elem` members) + in property $ all correct (members ++ others) + +tests :: [TestTree] +tests = [ testProperty "membership is correct" membershipCorrect ] diff --git a/tests/QC/Text/Regressions.hs b/tests/QC/Text/Regressions.hs new file mode 100644 --- /dev/null +++ b/tests/QC/Text/Regressions.hs @@ -0,0 +1,54 @@ +{-# LANGUAGE OverloadedStrings #-} + +module QC.Text.Regressions ( + tests + ) where + +import Data.Text (Text) +import qualified Data.Text as T +import Data.List (foldl') +import Data.Maybe (fromMaybe) +import Data.Char (isLower) +import Data.Monoid ((<>)) +import QC.Rechunked (rechunkT) +import Test.Tasty (TestTree) +import Test.Tasty.QuickCheck (testProperty) +import Test.QuickCheck (Property, counterexample, forAll) +import qualified Data.Attoparsec.Text as A + + +-------------------------------------------------------------------------------- +-- 105 was about runScanner not always returning the final state. The result +-- did depend on how the data was fed to the parser. + +t_issue105 :: Property +t_issue105 = expect issue105 "lowER" (A.Done "ER" "low") + +issue105 :: A.Parser Text +issue105 = do + (_, firstFourLowercaseLetters) <- A.runScanner "" f + return $ firstFourLowercaseLetters + + where + f :: Text -> Char -> Maybe Text + f acc c = if T.length acc < 4 && isLower c + then Just $ acc <> T.singleton c + else Nothing + + +expect :: (Show r, Eq r) => A.Parser r -> Text -> A.Result r -> Property +expect p input wanted = + forAll (rechunkT input) $ \in' -> + let result = parse p in' + in counterexample (show result ++ " /= " ++ show wanted) $ + fromMaybe False (A.compareResults result wanted) + +parse :: A.Parser r -> [Text] -> A.Result r +parse p (x:xs) = foldl' A.feed (A.parse p x) xs +parse p [] = A.parse p "" + + +tests :: [TestTree] +tests = [ + testProperty "issue105" t_issue105 + ] diff --git a/tests/QCSupport.hs b/tests/QCSupport.hs deleted file mode 100644 --- a/tests/QCSupport.hs +++ /dev/null @@ -1,52 +0,0 @@ -{-# LANGUAGE FlexibleContexts, FlexibleInstances #-} -module QCSupport - ( - NonEmpty(..) - ) where - -import Control.Applicative -import Data.Attoparsec -import Data.Word (Word8) -import System.Random (RandomGen, Random(..)) -import Test.QuickCheck hiding (NonEmpty) -import qualified Data.ByteString as S -import qualified Data.ByteString.Lazy as L - -integralRandomR :: (Integral a, RandomGen g) => (a,a) -> g -> (a,g) -integralRandomR (a,b) g = case randomR (fromIntegral a :: Integer, - fromIntegral b :: Integer) g of - (x,g') -> (fromIntegral x, g') - -newtype NonEmpty a = NonEmpty { nonEmpty :: a } - deriving (Eq, Ord, Read, Show) - -instance Functor NonEmpty where - fmap f (NonEmpty a) = NonEmpty (f a) - -instance Applicative NonEmpty where - NonEmpty f <*> NonEmpty a = NonEmpty (f a) - pure a = NonEmpty a - -instance Arbitrary a => Arbitrary (NonEmpty [a]) where - arbitrary = NonEmpty <$> sized (\n -> choose (1,n+1) >>= vector) - -instance Arbitrary S.ByteString where - arbitrary = S.pack <$> arbitrary - -instance Arbitrary (NonEmpty S.ByteString) where - arbitrary = fmap S.pack <$> arbitrary - -instance Arbitrary L.ByteString where - arbitrary = sized $ \n -> resize (round (sqrt (toEnum n :: Double))) - ((L.fromChunks . map nonEmpty) <$> arbitrary) - -instance Arbitrary (NonEmpty L.ByteString) where - arbitrary = sized $ \n -> resize (round (sqrt (toEnum n :: Double))) - (fmap (L.fromChunks . map nonEmpty) <$> arbitrary) - -instance Random Word8 where - randomR = integralRandomR - random = randomR (minBound,maxBound) - -instance Arbitrary Word8 where - arbitrary = choose (minBound, maxBound) diff --git a/tests/TestFastSet.hs b/tests/TestFastSet.hs deleted file mode 100644 --- a/tests/TestFastSet.hs +++ /dev/null @@ -1,25 +0,0 @@ -module Main (main) where - -import Data.Word (Word8) -import qualified Data.Attoparsec.FastSet as F -import System.Random (Random(..), RandomGen) -import Test.QuickCheck - -integralRandomR :: (Integral a, RandomGen g) => (a, a) -> g -> (a, g) -integralRandomR (a,b) g = case randomR (fromIntegral a :: Int, - fromIntegral b :: Int) g - of (x,g') -> (fromIntegral x, g') - -instance Random Word8 where - randomR = integralRandomR - random = randomR (minBound,maxBound) - -instance Arbitrary Word8 where - arbitrary = choose (minBound, maxBound) - -prop_AllMembers s = - let set = F.fromList s - in all (`F.memberWord8` set) s - -main = do - quickCheck prop_AllMembers