MC-Fold-DP (empty) → 0.1.0.0

raw patch · 5 files changed

+1220/−0 lines, 5 filesdep +Biobasedep +PrimitiveArraydep +basesetup-changed

Dependencies added: Biobase, PrimitiveArray, base, cmdargs, tuple, vector

Files

• BioInf/MCFoldDP.hs +387/−0
• LICENSE +675/−0
• MC-Fold-DP.cabal +81/−0
• MCFoldDP.hs +75/−0
• Setup.hs +2/−0

@@ -0,0 +1,387 @@+{-# LANGUAGE RecordWildCards #-}++-- |++module BioInf.MCFoldDP where++import Control.Arrow (first,second)+import Control.Monad+import Control.Monad.ST+import Data.List (find,sort)+import Data.Tuple.Select -- (sel5)+import qualified Data.Vector.Unboxed as VU++import Biobase.DataSource.MCFold+import Biobase.Constants+import Biobase.RNA+import Biobase.RNA.Hashes+import Biobase.RNA.NucBounds+import Biobase.Structure+import Data.PrimitiveArray+import Data.PrimitiveArray.Ix++++-- | Folding wrapper++fold :: MotifDB -> Primary -> Tables+fold db inp = runST $ foldST db inp++-- | Folding in the ST monad. the number of dncm tables is the same as the+-- number of known double NCMs.++foldST :: MotifDB -> Primary -> ST s Tables+foldST db inp = do+  let n = VU.length inp -1+  (sncm,sncmM)     <- mkTable2 n+  (dncms,dncmMs)   <- liftM unzip . mapM (const $ mkTable2 n) $ VU.toList knownDoubleNCM+  (tmp,tmpM)       <- mkTable2 n+  (mbr,mbrM)       <- mkTable2 n+  (mbr1,mbr1M)     <- mkTable2 n+  (extern,externM) <- mkTable2With 0 n+  forM_ [n,n-1 .. 0] $ \i -> forM_ [i,i+1 .. n] $ \j -> do++    -- single NCM calculation, together with multibranched loops / large+    -- interior loops+    --+    -- TODO check if large interior loops are ok?! Do we even want those, or+    -- should they come solely from NCMs? Have an option for that+    let sncmIJ = fncmSingle db inp i j+    -- let multiIJ = if j-i-1>0 then (VU.minimum . VU.map (\k -> mbr!(i+1,k)+mbr1!(k+1,j-1)) $ VU.enumFromN (i+1) (j-i-1)) else eInf+    let multiIJ = vuminimum $ fMulti db inp i j mbr mbr1 -- if j-i-1>0 then VU.minimum . VU.map snd $ fMulti db inp i j mbr mbr1 else eInf+    let interiorIJ = vuminimum $ fInterior db inp i j tmp -- VU.minimum . VU.map snd $ fInterior db inp i j tmp+    writeM sncmM (i,j) $ minimum [sncmIJ, multiIJ, interiorIJ]+    -- double NCM calculation+    forM (zip3 dncms dncmMs $ VU.toList knownDoubleNCM) $ \(dncm, dncmM, ((di,dj),_)) -> do+      let k = i+di-1+      let l = j-dj+1+      -- (1) Begin a stem (dNCM follows sNCM)+      let dsIJ = fncmDS db inp i j k l sncm+      -- (2) continue a stem (dNCM follows dNCM)+      let ddIJ = VU.minimum . VU.map snd $ fncmDD db inp i j k l dncms+      writeM dncmM (i,j) $ dsIJ `min` ddIJ++    -- fill helper table which makes mbr calculations ~2x faster+    writeM tmpM (i,j) $ minimum $ map (!(i,j)) dncms++    -- fill mbr table+    let upIJ = if (i+1<j) then mbr!(i,j-1) else eInf+    let stemIJ = vuminimum $ fMStem i j tmp -- if (i<j) then VU.minimum . VU.map snd $ fMStem i j tmp else eInf+    -- let mbrstemIJ = if (i+2<j) then VU.minimum $ VU.map (\k -> mbr!(i,k) + tmp!(k+1,j)) $ VU.enumFromN (i+1) (j-i-1) else eInf+    let mbrstemIJ = if (i+2<j) then VU.minimum . VU.map snd $ fMMbrStem i j mbr tmp else eInf+    writeM mbrM (i,j) $ minimum [upIJ,stemIJ,mbrstemIJ]++    -- fill mbr1 table+    let stem1IJ = tmp!(i,j) -- just a mnemonic+    let up1IJ = if (i+1<j) then mbr1!(i,j-1) else eInf+    writeM mbr1M (i,j) $ stem1IJ `min` up1IJ++  -- fill extern table+  let j=n+  forM_ [n-1,n-2..0] $ \i -> do+    let unpairedExt = extern!(i+1,j)+    let stemExtExt = if (i+2<j) then (VU.minimum . VU.map sel3 $ fStemExtExt dncms extern i j) else eInf+    let stemExt = if (i+2<j) then (VU.minimum . VU.map sel3 $ fStemExt dncms i j) else eInf+    writeM externM (i,j) $ minimum [unpairedExt, stemExtExt, stemExt] --, sncm!(i,j)]++  return (sncm,dncms,mbr,mbr1,extern)++-- | Backtracking suboptimal results++-- backtrack :: MotifDB -> Double -> Primary -> Tables -> [(Double,Secondary)]+backtrack db delta inp (sncm,dncms,mbr,mbr1,extern) = outp where+  outp+    | bE >= -0.0001 = [(0,Secondary (n+1) [])]+    | otherwise = map (first (bE+delta-) . second (Secondary (n+1) . sort)) $ externbt delta 0 n+  externbt d i j =+    -- unpaired nucleotide to the left+    [ (e,x)+    | i<j-1+    , let bestE = extern ! (i+1,j)+    , let d' = extern ! (i,j) - bestE + d+    , d'>=0+    , (e,x) <- externbt d' (i+1) j+    ] +++    -- stem+    [ (e,x)+    | i<j+    , (idx,k,bestE) <- VU.toList $ fStemExt dncms i j+    , let d' = extern!(i,j) - bestE + d+    , d'>=0+    , (e,x) <- dncmbt d' idx i k+    ] +++    -- two or more stems+    [ (ey,x++y)+    | i<j+    , (idx,k,bestE) <- VU.toList $ fStemExtExt dncms extern i j+    , let d' = extern!(i,j) - bestE + d+    , d'>=0+    , (ex,x) <- dncmbt d' idx i k+    , ex>=0+    , (ey,y) <- externbt ex (k+1) j+    , ey>=0+    ]+  dncmbt d idx i j =+    -- D-D+    [ (e,(i,j):x)+    | let (di,dj) = fst $ knownDoubleNCM VU.! idx+    , let dncm = dncms!!idx+    , let k = i+di-1, let l = j-dj+1+    , (nidx,bestE) <- VU.toList $ fncmDD db inp i j k l dncms+    , let d' = dncm!(i,j) - bestE + d+    , d'>=0+    , (e,x) <- dncmbt d' nidx k l+    ] +++    -- D-S+    [ (e,(i,j):x)+    | let (di,dj) = fst $ knownDoubleNCM VU.! idx+    , let dncm = dncms!!idx+    , let k = i+di-1, let l = j-dj+1+    , let bestE = fncmDS db inp i j k l sncm+    , let d' = dncm!(i,j) - bestE + d+    , d'>=0+    , (e,x) <- sncmbt d' k l+    ]+  sncmbt d i j =+    [ (d',[(i,j)])+    | j-i>=3+    , let bestE = fncmSingle db inp i j+    , let d' = sncm!(i,j) - bestE + d+    , d'>=0+    ] +++    -- sNCM enclosing a multibranched loop+    [ (ey,(i,j):x++y)+    | j-i>3+    , (k,bestE) <- VU.toList $ fMulti db inp i j mbr mbr1+    , let d' = sncm!(i,j) - bestE + d+    , d'>=0+    , (ex,x) <- mbrbt d' (i+1) k+    , ex>=0+    , (ey,y) <- mbr1bt ex (k+1) (j-1)+    ] +++    -- sNCM inclosing an interior loop+    [ (e,(i,j):x)+    | idx <- [0 .. VU.length knownDoubleNCM -1]+    , let dncm = dncms!!idx+    , ((k,l),bestE) <- VU.toList $ fInterior db inp i j dncm+    , let d' = sncm!(i,j) - bestE + d+    , d'>=0+    , (e,x) <- dncmbt d' idx k l+    ]+    -- TODO enclosing an interior loop+  mbrbt d i j =+    -- unpaired to the right+    [ (x,z)+    | i+1<j+    , let bestE = mbr!(i,j-1)+    , let d' = mbr!(i,j) - bestE + d+    , d'>=0+    , (x,z) <- mbrbt d' i (j-1)+    ] +++    -- a stem at k,j+    [ (x,z)+    | i+1<j+    , idx <- [0..VU.length knownDoubleNCM -1]+    , let dncm = dncms!!idx+    , (k,bestE) <- VU.toList $ fMStem i j dncm+    , let d' = mbr!(i,j) - bestE + d+    , d'>=0+    , (x,z) <- dncmbt d' idx k j+    ] +++    -- two or more stems+    [ (ey,x++y)+    | i+2<j+    , idx <- [0..VU.length knownDoubleNCM -1]+    , let dncm = dncms!!idx+    , (k,bestE) <- VU.toList $ fMMbrStem i j mbr dncm+    , let d' = mbr!(i,j) - bestE + d+    , d'>=0+    , (ex,x) <- mbrbt d' i k+    , ex>=0+    , (ey,y) <- dncmbt ex idx (k+1) j+    ]+  mbr1bt d i j =+    -- add a stem at i j+    [ (x,z)+    | i+1<j+    , idx <- [0..VU.length knownDoubleNCM -1]+    , let dncm = dncms!!idx+    , let bestE = dncm!(i,j)+    , let d' = mbr1!(i,j) - bestE + d+    , d'>=0+    , (x,z) <- dncmbt d' idx i j+    ] +++    -- unpaired to the right+    [ (x,z)+    | i+1<j+    , let bestE = mbr1!(i,j-1)+    , let d' = mbr1!(i,j) - bestE + d+    , d'>=0+    , (x,z) <- mbr1bt d' i (j-1)+    ]+  n = VU.length inp -1+  bE = extern ! (0,n)++++-- * Combining NCMs++-- | singleNCM insertion++fncmSingle :: MotifDB -> Primary -> Int -> Int -> Double+fncmSingle MotifDB{..} inp i j+  | l<4 = eInf+  | otherwise = maybe 0 ((!ci) . snd) $ find ((l==).fst) $ sCycles where+  ci = mkHashedPrimary (minExtended,maxExtended) $ VU.slice i l inp+  l = j-i+1+{-# INLINE fncmSingle #-}++-- | double NCM extend single NCM. We do not care that this is comparatively+-- slow as it is called only a few times, anyway.+--+-- TODO make faster (better lookup system)+-- TODO otherwise case+-- TODO eats another ~10% performance++fncmDS :: MotifDB -> Primary -> Int -> Int -> Int -> Int -> Table2 -> Double+fncmDS MotifDB{..} inp i j k l sncm+  | k>=l = eInf+  -- in case we have one of the three known single NCMs+  | Just hinge <- ((di,dj),len) `lookup` dsConnect+  , Just ncm   <- (di,dj) `lookup` dCycles+  = sncm!(k,l) + hinge!(inp `VU.unsafeIndex` k, inp `VU.unsafeIndex` l) + ncm!ci+--  | i==1 && j==7 && di==2 && dj==2 = error $ show (di,dj,len)+  -- the single NCM is larger+  | otherwise = sncm!(k,l)+  where+    di  = k-i+1+    dj  = j-l+1+    len = l-k+1+    ci  = mkHashedPrimary (minExtended,maxExtended) $ VU.slice i di inp VU.++ VU.slice l dj inp+{-# INLINE fncmDS #-}++-- | double NCM extending another double NCM.+--+-- TODO this one could profit from performance improvements. But check first vs. multibranch timings+-- TODO remove otherwise case+-- TODO improve performance, eats ~66% of total time+-- TODO improve: return empty vector on error, write special minimum function that has eInf on empty++fncmDD :: MotifDB -> Primary -> Int -> Int -> Int -> Int -> [Table2] -> VU.Vector (Int,Double)+fncmDD MotifDB{..} inp i j k l dncms = VU.fromList $ zipWith3 f (map fst $ VU.toList knownDoubleNCM) [0..] dncms where+  f (dk,dl) idx dncm+    | k+2>=l = (-1,eInf)+    | Just hinge <- ((di,dj),(dk,dl)) `lookup` ddConnect+    , Just ncm   <- (di,dj) `lookup` dCycles+    = (idx,dncm!(k,l) + hinge!(inp `VU.unsafeIndex` k, inp `VU.unsafeIndex` l) + ncm!ci)+    | otherwise = (-1,eInf)+    where+      di = k-i+1+      dj = j-l+1+      ci = mkHashedPrimary (minExtended,maxExtended) $ VU.slice i di inp VU.++ VU.slice l dj inp+{-# INLINE fncmDD #-}++-- | Add one stem for "external" calculations+--+-- TODO make efficient++fStemExt :: [Table2] -> Int -> Int -> VU.Vector (Int,Int,Double) -- (dncms!!,k,value)+fStemExt dncms i j = VU.fromList xs where+  xs = [ (d,k,dncm!(i,k))+       | (d,dncm) <- zip [0..] dncms+       , k <- [i+1..j]+       ]+{-# INLINE fStemExt #-}++-- | Combine stems for "external" calculations++fStemExtExt :: [Table2] -> Table2 -> Int -> Int -> VU.Vector (Int,Int,Double)+fStemExtExt dncms extern i j = VU.fromList xs where+  xs = [ (d,k,dncm!(i,k) + extern!(k+1,j))+       | (d,dncm) <- zip [0..] dncms+       , k <- [i+1..j-1]+       ]+{-# INLINE fStemExtExt #-}++-- | Close a multibranched loop with a singleNCM+--+-- TODO close with singleNCM++fMulti :: MotifDB -> Primary -> Int -> Int -> Table2 -> Table2 -> VU.Vector (Int,Double)+fMulti db inp i j mbr mbr1 = xs where+  xs = VU.map (\k -> (k, mbr!(i+1,k) + mbr1!(k+1,j-1))) $ (VU.enumFromN (i+1) (j-i-1))+{-# INLINE fMulti #-}++-- | Connect a partial multibranched structure with a hairpin. Note that the+-- "dncm" hairpin part wants one table, not the list of all tables.++fMMbrStem :: Int -> Int -> Table2 -> Table2 -> VU.Vector (Int,Double)+fMMbrStem i j mbr dncm = VU.map (\k -> (k,mbr!(i,k) + dncm!(k+1,j))) $ VU.enumFromN (i+1) (j-i-1)+{-# INLINE fMMbrStem #-}++-- | Add the first stem++fMStem :: Int -> Int -> Table2 -> VU.Vector (Int,Double)+fMStem i j dncm = VU.map (\k -> (k,dncm!(k,j))) $ VU.enumFromN i (j-i)+{-# INLINE fMStem #-}++-- | Interior loops of some size+--+-- TODO this could profit from a log-based scoring function++fInterior :: MotifDB -> Primary -> Int -> Int -> Table2 -> VU.Vector ((Int,Int),Double)+{-+fInterior MotifDB{..} inp i j dncm = VU.fromList $ ((-1,-1),eInf) : xs where+  xs =  [ ((k,l),dncm!(k,l))+        | k<-[i+1 .. i+10]+        , l<-[j-1,j-2 .. j-10]+        , k<l+        , i+1/=k || j-1/=l+        ] -}+fInterior MotifDB{..} inp i j dncm = res where+  res = VU.map (\(k,l) -> ((k,l),dncm!(k,l))) . VU.filter (\(k,l) -> k<l && (i+1/=k || j-1/=l)) $ VU.unfoldr f (i+1,j-1)+  f (k,l)+    | i+10< k   = Nothing+    | j-10==l   = Just ((k,l),(k+1,j-1)) -- next element, new seed+    | otherwise = Just ((k,l),(k  ,l-1))+  {-# INLINE f #-}+{-# INLINE fInterior #-}++-- * Helper functions++-- | Extract final score++getScore :: Tables -> Double+getScore ts = score where+  t = sel5 ts+  (_,(n,_)) = bounds t+  score = t!(0,n)++-- | The default two-dim table++mkTable2 n = mkTable2With eInf n++-- | Create a 2-dim table++mkTable2With v n = do+  tM <- fromAssocsM (0,0) (n,n) v []+  t <- unsafeFreezeM tM+  return (t,tM)++-- | minimum for unboxed vectors, capturing possible 0-length. Vectors in this+-- algorithm \always\ carry positional information.+--+-- TODO the next version of the vector library should handle "VU.map snd"+-- better++vuminimum xs = VU.foldl' (\a (_,x) -> min a x) eInf xs+{-# INLINE vuminimum #-}+-- vuminimum = VU.foldl' min eInf . VU.map snd++++-- * types and newtypes++type Table2 = PrimArray (Int,Int) Double+type Table4 = PrimArray (Int,Int,Int,Int) Double+type Tables = (Table2,[Table2],Table2,Table2,Table2)

@@ -0,0 +1,675 @@+              GNU GENERAL PUBLIC LICENSE+                Version 3, 29 June 2007++ Copyright (C) 2007 Free Software Foundation, Inc. <http://fsf.org/>+ Everyone is permitted to copy and distribute verbatim copies+ of this license document, but changing it is not allowed.++                     Preamble++  The GNU General Public License is a free, copyleft license for+software and other kinds of works.++  The licenses for most software and other practical works are designed+to take away your freedom to share and change the works.  By contrast,+the GNU General Public License is intended to guarantee your freedom to+share and change all versions of a program--to make sure it remains free+software for all its users.  We, the Free Software Foundation, use the+GNU General Public License for most of our software; it applies also to+any other work released this way by its authors.  You can apply it to+your programs, too.++  When we speak of free software, we are referring to freedom, not+price.  Our General Public Licenses are designed to make sure that you+have the freedom to distribute copies of free software (and charge for+them if you wish), that you receive source code or can get it if you+want it, that you can change the software or use pieces of it in new+free programs, and that you know you can do these things.++  To protect your rights, we need to prevent others from denying you+these rights or asking you to surrender the rights.  Therefore, you have+certain responsibilities if you distribute copies of the software, or if+you modify it: responsibilities to respect the freedom of others.++  For example, if you distribute copies of such a program, whether+gratis or for a fee, you must pass on to the recipients the same+freedoms that you received.  You must make sure that they, too, receive+or can get the source code.  And you must show them these terms so they+know their rights.++  Developers that use the GNU GPL protect your rights with two steps:+(1) assert copyright on the software, and (2) offer you this License+giving you legal permission to copy, distribute and/or modify it.++  For the developers' and authors' protection, the GPL clearly explains+that there is no warranty for this free software.  For both users' and+authors' sake, the GPL requires that modified versions be marked as+changed, so that their problems will not be attributed erroneously to+authors of previous versions.++  Some devices are designed to deny users access to install or run+modified versions of the software inside them, although the manufacturer+can do so.  This is fundamentally incompatible with the aim of+protecting users' freedom to change the software.  The systematic+pattern of such abuse occurs in the area of products for individuals to+use, which is precisely where it is most unacceptable.  Therefore, we+have designed this version of the GPL to prohibit the practice for those+products.  If such problems arise substantially in other domains, we+stand ready to extend this provision to those domains in future versions+of the GPL, as needed to protect the freedom of users.++  Finally, every program is threatened constantly by software patents.+States should not allow patents to restrict development and use of+software on general-purpose computers, but in those that do, we wish to+avoid the special danger that patents applied to a free program could+make it effectively proprietary.  To prevent this, the GPL assures that+patents cannot be used to render the program non-free.++  The precise terms and conditions for copying, distribution and+modification follow.++                TERMS AND CONDITIONS++  0. Definitions.++  "This License" refers to version 3 of the GNU General Public License.++  "Copyright" also means copyright-like laws that apply to other kinds of+works, such as semiconductor masks.+ +  "The Program" refers to any copyrightable work licensed under this+License.  Each licensee is addressed as "you".  "Licensees" and+"recipients" may be individuals or organizations.++  To "modify" a work means to copy from or adapt all or part of the work+in a fashion requiring copyright permission, other than the making of an+exact copy.  The resulting work is called a "modified version" of the+earlier work or a work "based on" the earlier work.++  A "covered work" means either the unmodified Program or a work based+on the Program.++  To "propagate" a work means to do anything with it that, without+permission, would make you directly or secondarily liable for+infringement under applicable copyright law, except executing it on a+computer or modifying a private copy.  Propagation includes copying,+distribution (with or without modification), making available to the+public, and in some countries other activities as well.++  To "convey" a work means any kind of propagation that enables other+parties to make or receive copies.  Mere interaction with a user through+a computer network, with no transfer of a copy, is not conveying.++  An interactive user interface displays "Appropriate Legal Notices"+to the extent that it includes a convenient and prominently visible+feature that (1) displays an appropriate copyright notice, and (2)+tells the user that there is no warranty for the work (except to the+extent that warranties are provided), that licensees may convey the+work under this License, and how to view a copy of this License.  If+the interface presents a list of user commands or options, such as a+menu, a prominent item in the list meets this criterion.++  1. Source Code.++  The "source code" for a work means the preferred form of the work+for making modifications to it.  "Object code" means any non-source+form of a work.++  A "Standard Interface" means an interface that either is an official+standard defined by a recognized standards body, or, in the case of+interfaces specified for a particular programming language, one that+is widely used among developers working in that language.++  The "System Libraries" of an executable work include anything, other+than the work as a whole, that (a) is included in the normal form of+packaging a Major Component, but which is not part of that Major+Component, and (b) serves only to enable use of the work with that+Major Component, or to implement a Standard Interface for which an+implementation is available to the public in source code form.  A+"Major Component", in this context, means a major essential component+(kernel, window system, and so on) of the specific operating system+(if any) on which the executable work runs, or a compiler used to+produce the work, or an object code interpreter used to run it.++  The "Corresponding Source" for a work in object code form means all+the source code needed to generate, install, and (for an executable+work) run the object code and to modify the work, including scripts to+control those activities.  However, it does not include the work's+System Libraries, or general-purpose tools or generally available free+programs which are used unmodified in performing those activities but+which are not part of the work.  For example, Corresponding Source+includes interface definition files associated with source files for+the work, and the source code for shared libraries and dynamically+linked subprograms that the work is specifically designed to require,+such as by intimate data communication or control flow between those+subprograms and other parts of the work.++  The Corresponding Source need not include anything that users+can regenerate automatically from other parts of the Corresponding+Source.++  The Corresponding Source for a work in source code form is that+same work.++  2. Basic Permissions.++  All rights granted under this License are granted for the term of+copyright on the Program, and are irrevocable provided the stated+conditions are met.  This License explicitly affirms your unlimited+permission to run the unmodified Program.  The output from running a+covered work is covered by this License only if the output, given its+content, constitutes a covered work.  This License acknowledges your+rights of fair use or other equivalent, as provided by copyright law.++  You may make, run and propagate covered works that you do not+convey, without conditions so long as your license otherwise remains+in force.  You may convey covered works to others for the sole purpose+of having them make modifications exclusively for you, or provide you+with facilities for running those works, provided that you comply with+the terms of this License in conveying all material for which you do+not control copyright.  Those thus making or running the covered works+for you must do so exclusively on your behalf, under your direction+and control, on terms that prohibit them from making any copies of+your copyrighted material outside their relationship with you.++  Conveying under any other circumstances is permitted solely under+the conditions stated below.  Sublicensing is not allowed; section 10+makes it unnecessary.++  3. Protecting Users' Legal Rights From Anti-Circumvention Law.++  No covered work shall be deemed part of an effective technological+measure under any applicable law fulfilling obligations under article+11 of the WIPO copyright treaty adopted on 20 December 1996, or+similar laws prohibiting or restricting circumvention of such+measures.++  When you convey a covered work, you waive any legal power to forbid+circumvention of technological measures to the extent such circumvention+is effected by exercising rights under this License with respect to+the covered work, and you disclaim any intention to limit operation or+modification of the work as a means of enforcing, against the work's+users, your or third parties' legal rights to forbid circumvention of+technological measures.++  4. Conveying Verbatim Copies.++  You may convey verbatim copies of the Program's source code as you+receive it, in any medium, provided that you conspicuously and+appropriately publish on each copy an appropriate copyright notice;+keep intact all notices stating that this License and any+non-permissive terms added in accord with section 7 apply to the code;+keep intact all notices of the absence of any warranty; and give all+recipients a copy of this License along with the Program.++  You may charge any price or no price for each copy that you convey,+and you may offer support or warranty protection for a fee.++  5. Conveying Modified Source Versions.++  You may convey a work based on the Program, or the modifications to+produce it from the Program, in the form of source code under the+terms of section 4, provided that you also meet all of these conditions:++    a) The work must carry prominent notices stating that you modified+    it, and giving a relevant date.++    b) The work must carry prominent notices stating that it is+    released under this License and any conditions added under section+    7.  This requirement modifies the requirement in section 4 to+    "keep intact all notices".++    c) You must license the entire work, as a whole, under this+    License to anyone who comes into possession of a copy.  This+    License will therefore apply, along with any applicable section 7+    additional terms, to the whole of the work, and all its parts,+    regardless of how they are packaged.  This License gives no+    permission to license the work in any other way, but it does not+    invalidate such permission if you have separately received it.++    d) If the work has interactive user interfaces, each must display+    Appropriate Legal Notices; however, if the Program has interactive+    interfaces that do not display Appropriate Legal Notices, your+    work need not make them do so.++  A compilation of a covered work with other separate and independent+works, which are not by their nature extensions of the covered work,+and which are not combined with it such as to form a larger program,+in or on a volume of a storage or distribution medium, is called an+"aggregate" if the compilation and its resulting copyright are not+used to limit the access or legal rights of the compilation's users+beyond what the individual works permit.  Inclusion of a covered work+in an aggregate does not cause this License to apply to the other+parts of the aggregate.++  6. Conveying Non-Source Forms.++  You may convey a covered work in object code form under the terms+of sections 4 and 5, provided that you also convey the+machine-readable Corresponding Source under the terms of this License,+in one of these ways:++    a) Convey the object code in, or embodied in, a physical product+    (including a physical distribution medium), accompanied by the+    Corresponding Source fixed on a durable physical medium+    customarily used for software interchange.++    b) Convey the object code in, or embodied in, a physical product+    (including a physical distribution medium), accompanied by a+    written offer, valid for at least three years and valid for as+    long as you offer spare parts or customer support for that product+    model, to give anyone who possesses the object code either (1) a+    copy of the Corresponding Source for all the software in the+    product that is covered by this License, on a durable physical+    medium customarily used for software interchange, for a price no+    more than your reasonable cost of physically performing this+    conveying of source, or (2) access to copy the+    Corresponding Source from a network server at no charge.++    c) Convey individual copies of the object code with a copy of the+    written offer to provide the Corresponding Source.  This+    alternative is allowed only occasionally and noncommercially, and+    only if you received the object code with such an offer, in accord+    with subsection 6b.++    d) Convey the object code by offering access from a designated+    place (gratis or for a charge), and offer equivalent access to the+    Corresponding Source in the same way through the same place at no+    further charge.  You need not require recipients to copy the+    Corresponding Source along with the object code.  If the place to+    copy the object code is a network server, the Corresponding Source+    may be on a different server (operated by you or a third party)+    that supports equivalent copying facilities, provided you maintain+    clear directions next to the object code saying where to find the+    Corresponding Source.  Regardless of what server hosts the+    Corresponding Source, you remain obligated to ensure that it is+    available for as long as needed to satisfy these requirements.++    e) Convey the object code using peer-to-peer transmission, provided+    you inform other peers where the object code and Corresponding+    Source of the work are being offered to the general public at no+    charge under subsection 6d.++  A separable portion of the object code, whose source code is excluded+from the Corresponding Source as a System Library, need not be+included in conveying the object code work.++  A "User Product" is either (1) a "consumer product", which means any+tangible personal property which is normally used for personal, family,+or household purposes, or (2) anything designed or sold for incorporation+into a dwelling.  In determining whether a product is a consumer product,+doubtful cases shall be resolved in favor of coverage.  For a particular+product received by a particular user, "normally used" refers to a+typical or common use of that class of product, regardless of the status+of the particular user or of the way in which the particular user+actually uses, or expects or is expected to use, the product.  A product+is a consumer product regardless of whether the product has substantial+commercial, industrial or non-consumer uses, unless such uses represent+the only significant mode of use of the product.++  "Installation Information" for a User Product means any methods,+procedures, authorization keys, or other information required to install+and execute modified versions of a covered work in that User Product from+a modified version of its Corresponding Source.  The information must+suffice to ensure that the continued functioning of the modified object+code is in no case prevented or interfered with solely because+modification has been made.++  If you convey an object code work under this section in, or with, or+specifically for use in, a User Product, and the conveying occurs as+part of a transaction in which the right of possession and use of the+User Product is transferred to the recipient in perpetuity or for a+fixed term (regardless of how the transaction is characterized), the+Corresponding Source conveyed under this section must be accompanied+by the Installation Information.  But this requirement does not apply+if neither you nor any third party retains the ability to install+modified object code on the User Product (for example, the work has+been installed in ROM).++  The requirement to provide Installation Information does not include a+requirement to continue to provide support service, warranty, or updates+for a work that has been modified or installed by the recipient, or for+the User Product in which it has been modified or installed.  Access to a+network may be denied when the modification itself materially and+adversely affects the operation of the network or violates the rules and+protocols for communication across the network.++  Corresponding Source conveyed, and Installation Information provided,+in accord with this section must be in a format that is publicly+documented (and with an implementation available to the public in+source code form), and must require no special password or key for+unpacking, reading or copying.++  7. Additional Terms.++  "Additional permissions" are terms that supplement the terms of this+License by making exceptions from one or more of its conditions.+Additional permissions that are applicable to the entire Program shall+be treated as though they were included in this License, to the extent+that they are valid under applicable law.  If additional permissions+apply only to part of the Program, that part may be used separately+under those permissions, but the entire Program remains governed by+this License without regard to the additional permissions.++  When you convey a copy of a covered work, you may at your option+remove any additional permissions from that copy, or from any part of+it.  (Additional permissions may be written to require their own+removal in certain cases when you modify the work.)  You may place+additional permissions on material, added by you to a covered work,+for which you have or can give appropriate copyright permission.++  Notwithstanding any other provision of this License, for material you+add to a covered work, you may (if authorized by the copyright holders of+that material) supplement the terms of this License with terms:++    a) Disclaiming warranty or limiting liability differently from the+    terms of sections 15 and 16 of this License; or++    b) Requiring preservation of specified reasonable legal notices or+    author attributions in that material or in the Appropriate Legal+    Notices displayed by works containing it; or++    c) Prohibiting misrepresentation of the origin of that material, or+    requiring that modified versions of such material be marked in+    reasonable ways as different from the original version; or++    d) Limiting the use for publicity purposes of names of licensors or+    authors of the material; or++    e) Declining to grant rights under trademark law for use of some+    trade names, trademarks, or service marks; or++    f) Requiring indemnification of licensors and authors of that+    material by anyone who conveys the material (or modified versions of+    it) with contractual assumptions of liability to the recipient, for+    any liability that these contractual assumptions directly impose on+    those licensors and authors.++  All other non-permissive additional terms are considered "further+restrictions" within the meaning of section 10.  If the Program as you+received it, or any part of it, contains a notice stating that it is+governed by this License along with a term that is a further+restriction, you may remove that term.  If a license document contains+a further restriction but permits relicensing or conveying under this+License, you may add to a covered work material governed by the terms+of that license document, provided that the further restriction does+not survive such relicensing or conveying.++  If you add terms to a covered work in accord with this section, you+must place, in the relevant source files, a statement of the+additional terms that apply to those files, or a notice indicating+where to find the applicable terms.++  Additional terms, permissive or non-permissive, may be stated in the+form of a separately written license, or stated as exceptions;+the above requirements apply either way.++  8. Termination.++  You may not propagate or modify a covered work except as expressly+provided under this License.  Any attempt otherwise to propagate or+modify it is void, and will automatically terminate your rights under+this License (including any patent licenses granted under the third+paragraph of section 11).++  However, if you cease all violation of this License, then your+license from a particular copyright holder is reinstated (a)+provisionally, unless and until the copyright holder explicitly and+finally terminates your license, and (b) permanently, if the copyright+holder fails to notify you of the violation by some reasonable means+prior to 60 days after the cessation.++  Moreover, your license from a particular copyright holder is+reinstated permanently if the copyright holder notifies you of the+violation by some reasonable means, this is the first time you have+received notice of violation of this License (for any work) from that+copyright holder, and you cure the violation prior to 30 days after+your receipt of the notice.++  Termination of your rights under this section does not terminate the+licenses of parties who have received copies or rights from you under+this License.  If your rights have been terminated and not permanently+reinstated, you do not qualify to receive new licenses for the same+material under section 10.++  9. Acceptance Not Required for Having Copies.++  You are not required to accept this License in order to receive or+run a copy of the Program.  Ancillary propagation of a covered work+occurring solely as a consequence of using peer-to-peer transmission+to receive a copy likewise does not require acceptance.  However,+nothing other than this License grants you permission to propagate or+modify any covered work.  These actions infringe copyright if you do+not accept this License.  Therefore, by modifying or propagating a+covered work, you indicate your acceptance of this License to do so.++  10. Automatic Licensing of Downstream Recipients.++  Each time you convey a covered work, the recipient automatically+receives a license from the original licensors, to run, modify and+propagate that work, subject to this License.  You are not responsible+for enforcing compliance by third parties with this License.++  An "entity transaction" is a transaction transferring control of an+organization, or substantially all assets of one, or subdividing an+organization, or merging organizations.  If propagation of a covered+work results from an entity transaction, each party to that+transaction who receives a copy of the work also receives whatever+licenses to the work the party's predecessor in interest had or could+give under the previous paragraph, plus a right to possession of the+Corresponding Source of the work from the predecessor in interest, if+the predecessor has it or can get it with reasonable efforts.++  You may not impose any further restrictions on the exercise of the+rights granted or affirmed under this License.  For example, you may+not impose a license fee, royalty, or other charge for exercise of+rights granted under this License, and you may not initiate litigation+(including a cross-claim or counterclaim in a lawsuit) alleging that+any patent claim is infringed by making, using, selling, offering for+sale, or importing the Program or any portion of it.++  11. Patents.++  A "contributor" is a copyright holder who authorizes use under this+License of the Program or a work on which the Program is based.  The+work thus licensed is called the contributor's "contributor version".++  A contributor's "essential patent claims" are all patent claims+owned or controlled by the contributor, whether already acquired or+hereafter acquired, that would be infringed by some manner, permitted+by this License, of making, using, or selling its contributor version,+but do not include claims that would be infringed only as a+consequence of further modification of the contributor version.  For+purposes of this definition, "control" includes the right to grant+patent sublicenses in a manner consistent with the requirements of+this License.++  Each contributor grants you a non-exclusive, worldwide, royalty-free+patent license under the contributor's essential patent claims, to+make, use, sell, offer for sale, import and otherwise run, modify and+propagate the contents of its contributor version.++  In the following three paragraphs, a "patent license" is any express+agreement or commitment, however denominated, not to enforce a patent+(such as an express permission to practice a patent or covenant not to+sue for patent infringement).  To "grant" such a patent license to a+party means to make such an agreement or commitment not to enforce a+patent against the party.++  If you convey a covered work, knowingly relying on a patent license,+and the Corresponding Source of the work is not available for anyone+to copy, free of charge and under the terms of this License, through a+publicly available network server or other readily accessible means,+then you must either (1) cause the Corresponding Source to be so+available, or (2) arrange to deprive yourself of the benefit of the+patent license for this particular work, or (3) arrange, in a manner+consistent with the requirements of this License, to extend the patent+license to downstream recipients.  "Knowingly relying" means you have+actual knowledge that, but for the patent license, your conveying the+covered work in a country, or your recipient's use of the covered work+in a country, would infringe one or more identifiable patents in that+country that you have reason to believe are valid.+  +  If, pursuant to or in connection with a single transaction or+arrangement, you convey, or propagate by procuring conveyance of, a+covered work, and grant a patent license to some of the parties+receiving the covered work authorizing them to use, propagate, modify+or convey a specific copy of the covered work, then the patent license+you grant is automatically extended to all recipients of the covered+work and works based on it.++  A patent license is "discriminatory" if it does not include within+the scope of its coverage, prohibits the exercise of, or is+conditioned on the non-exercise of one or more of the rights that are+specifically granted under this License.  You may not convey a covered+work if you are a party to an arrangement with a third party that is+in the business of distributing software, under which you make payment+to the third party based on the extent of your activity of conveying+the work, and under which the third party grants, to any of the+parties who would receive the covered work from you, a discriminatory+patent license (a) in connection with copies of the covered work+conveyed by you (or copies made from those copies), or (b) primarily+for and in connection with specific products or compilations that+contain the covered work, unless you entered into that arrangement,+or that patent license was granted, prior to 28 March 2007.++  Nothing in this License shall be construed as excluding or limiting+any implied license or other defenses to infringement that may+otherwise be available to you under applicable patent law.++  12. No Surrender of Others' Freedom.++  If conditions are imposed on you (whether by court order, agreement or+otherwise) that contradict the conditions of this License, they do not+excuse you from the conditions of this License.  If you cannot convey a+covered work so as to satisfy simultaneously your obligations under this+License and any other pertinent obligations, then as a consequence you may+not convey it at all.  For example, if you agree to terms that obligate you+to collect a royalty for further conveying from those to whom you convey+the Program, the only way you could satisfy both those terms and this+License would be to refrain entirely from conveying the Program.++  13. Use with the GNU Affero General Public License.++  Notwithstanding any other provision of this License, you have+permission to link or combine any covered work with a work licensed+under version 3 of the GNU Affero General Public License into a single+combined work, and to convey the resulting work.  The terms of this+License will continue to apply to the part which is the covered work,+but the special requirements of the GNU Affero General Public License,+section 13, concerning interaction through a network will apply to the+combination as such.++  14. Revised Versions of this License.++  The Free Software Foundation may publish revised and/or new versions of+the GNU General Public License from time to time.  Such new versions will+be similar in spirit to the present version, but may differ in detail to+address new problems or concerns.++  Each version is given a distinguishing version number.  If the+Program specifies that a certain numbered version of the GNU General+Public License "or any later version" applies to it, you have the+option of following the terms and conditions either of that numbered+version or of any later version published by the Free Software+Foundation.  If the Program does not specify a version number of the+GNU General Public License, you may choose any version ever published+by the Free Software Foundation.++  If the Program specifies that a proxy can decide which future+versions of the GNU General Public License can be used, that proxy's+public statement of acceptance of a version permanently authorizes you+to choose that version for the Program.++  Later license versions may give you additional or different+permissions.  However, no additional obligations are imposed on any+author or copyright holder as a result of your choosing to follow a+later version.++  15. Disclaimer of Warranty.++  THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY+APPLICABLE LAW.  EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT+HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY+OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,+THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR+PURPOSE.  THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM+IS WITH YOU.  SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF+ALL NECESSARY SERVICING, REPAIR OR CORRECTION.++  16. Limitation of Liability.++  IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING+WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS+THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY+GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE+USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF+DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD+PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),+EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF+SUCH DAMAGES.++  17. Interpretation of Sections 15 and 16.++  If the disclaimer of warranty and limitation of liability provided+above cannot be given local legal effect according to their terms,+reviewing courts shall apply local law that most closely approximates+an absolute waiver of all civil liability in connection with the+Program, unless a warranty or assumption of liability accompanies a+copy of the Program in return for a fee.++              END OF TERMS AND CONDITIONS++     How to Apply These Terms to Your New Programs++  If you develop a new program, and you want it to be of the greatest+possible use to the public, the best way to achieve this is to make it+free software which everyone can redistribute and change under these terms.++  To do so, attach the following notices to the program.  It is safest+to attach them to the start of each source file to most effectively+state the exclusion of warranty; and each file should have at least+the "copyright" line and a pointer to where the full notice is found.++    <one line to give the program's name and a brief idea of what it does.>+    Copyright (C) <year>  <name of author>++    This program is free software: you can redistribute it and/or modify+    it under the terms of the GNU General Public License as published by+    the Free Software Foundation, either version 3 of the License, or+    (at your option) any later version.++    This program is distributed in the hope that it will be useful,+    but WITHOUT ANY WARRANTY; without even the implied warranty of+    MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the+    GNU General Public License for more details.++    You should have received a copy of the GNU General Public License+    along with this program.  If not, see <http://www.gnu.org/licenses/>.++Also add information on how to contact you by electronic and paper mail.++  If the program does terminal interaction, make it output a short+notice like this when it starts in an interactive mode:++    <program>  Copyright (C) <year>  <name of author>+    This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'.+    This is free software, and you are welcome to redistribute it+    under certain conditions; type `show c' for details.++The hypothetical commands `show w' and `show c' should show the appropriate+parts of the General Public License.  Of course, your program's commands+might be different; for a GUI interface, you would use an "about box".++  You should also get your employer (if you work as a programmer) or school,+if any, to sign a "copyright disclaimer" for the program, if necessary.+For more information on this, and how to apply and follow the GNU GPL, see+<http://www.gnu.org/licenses/>.++  The GNU General Public License does not permit incorporating your program+into proprietary programs.  If your program is a subroutine library, you+may consider it more useful to permit linking proprietary applications with+the library.  If this is what you want to do, use the GNU Lesser General+Public License instead of this License.  But first, please read+<http://www.gnu.org/philosophy/why-not-lgpl.html>.+

@@ -0,0 +1,81 @@+name:           MC-Fold-DP+version:        0.1.0.0+author:         Christian Hoener zu Siederdissen, Stephan H Bernhart, Peter F Stadler, Ivo L Hofacker+copyright:      Christian Hoener zu Siederdissen, 2010-2011+homepage:       http://www.tbi.univie.ac.at/software/mcfolddp/+maintainer:     choener@tbi.univie.ac.at+category:       Bioinformatics+license:        GPL-3+license-file:   LICENSE+build-type:     Simple+stability:      experimental+cabal-version:  >= 1.4.0+synopsis:+                Folding algorithm based on nucleotide cyclic motifs.+description:+                This is a RNA secondary structure prediction tool based on the+                idea of combining small motifs, called nucleotide cyclic motifs+                (NCMs). The algorithm implemented here and described in+                .+                Hoener zu Siederdissen C, Bernhart SH, Stadler PF, Hofacker IL,+                "A Folding Algorithm for Extended RNA Secondary Structures",+                2011, submitted+                .+                has polynomial runtime in O(n^3) and uses a (pseudo-energy)+                scoring scheme based on+                .+                Parisien M, Major F. "The MC-Fold and MC-Sym pipeline infers+                RNA structure from sequence data",  Nature 2008,+                452(7183):51-55. <http://www.major.iric.ca/MC-Fold/>+                .+                This program uses the same database as MC-Fold (which has+                exponential run-time) and aims to be able to produce the same+                results.+                .+                The underlying grammar of our implementation is unambiguous and+                allows the complete evaluation of all structures within an+                energy band above the ground state, presenting each unique+                structure just once. Alternatively, the grammar allows+                partition function calculations.+                .+                Current status:+                .+                * comparable prediction accuracy on sequences+                .+                * possibility to use sparse data correction+                .+                * handles non-ACGU nucleotides gracefully+                .+                * suboptimals: return all structures within an energy band above the ground state+                .+                Todo:+                .+                * Boltzmann likelihood calculations+                .+                * pseudoknot calculations (currently aiming for a pknotsRG-like algorithm)++library+  build-depends:+    base >= 4 && < 5,+    vector,+    tuple,+    PrimitiveArray,+    Biobase == 0.3.1.0+  exposed-modules:+    BioInf.MCFoldDP+  ghc-options:+    -Odph+  if impl(ghc > 6.13)+    ghc-options:+      -fllvm++executable MCFoldDP+  build-depends:+    cmdargs == 0.6.8+  main-is:+    MCFoldDP.hs+  ghc-options:+    -Odph+  if impl(ghc > 6.13)+    ghc-options:+      -fllvm

@@ -0,0 +1,75 @@+{-# LANGUAGE RecordWildCards #-}+{-# LANGUAGE DeriveDataTypeable #-}++module Main where++import System.Console.CmdArgs+import Control.Monad (liftM)+import Text.Printf+import Data.List (sortBy)+import Data.Ord (comparing)++import Biobase.DataSource.MCFold+import Biobase.DataSource.MCFold.Import+import Biobase.RNA+import Biobase.Structure+import Biobase.Structure.DotBracket++import BioInf.MCFoldDP++++data Options = Options+  { database :: FilePath+  , strictInput :: Bool+  , noSparseDataCorrection :: Bool+  , orderSuboptimals :: Bool+  , band :: Double+  , oneResult :: Bool+  } deriving (Data,Typeable,Show)++options = Options+  { database = "./MCFOLD-DB" &= typDir &= help "path to MCFOLD-DB (default: ./MCFOLD-DB)"+  , strictInput = False &= help "filter out other characters than ACGU (default: convert other characters to E and handle gracefully)"+  , noSparseDataCorrection = False &= help "disable sparse data correction (default: enabled)"+  , orderSuboptimals = False &= help "sort suboptimal results by score (better scores first) (default: false)"+  , band = 0.1 &= help "score band above the ground state for which suboptimal results are allowed (default: 0.1)"+  , oneResult = False &= help "Return only one of several co-optimal structures in the backtracking phase (default: false)"+  } &= summary "MCFold-DP, (c) Christian Hoener zu Siederdissen et al, 2010-2011"+    &= details  [ "This program performs calculations similar to those done by MC-Fold."+                , "Important differences are: polynomial runtime, no pseudoknot handling,"+                , "sparse data correction, and the possibility to gracefully handle all"+                , "input sequences."+                ]++main = do+  o@Options{..} <- cmdArgs options+  db <- parseDir database+  -- TODO enable sparsity correction!+  cnts <- liftM ((strictFilter strictInput) . lines) $ getContents+  mapM_ (doFold o db) cnts++strictFilter :: Bool -> [String] -> [String]+strictFilter False xs = xs+strictFilter True  xs = filter (all (`elem` "ACGUacgu")) xs++-- | Executes folding a single sequence. Allows++doFold :: Options -> MotifDB -> String -> IO ()+doFold Options{..} db inp = do+  putStrLn inp+  let pri = mkPrimary inp+  let ts = fold db pri+  let res = (if oneResult then take 1 else id) $ backtrack db band pri ts+  mapM_ (\(e,s) -> printf "%s   (%7.2f)\n" (dotbracket s) e) . (if orderSuboptimals then sortBy (comparing fst) else id) $ res+  if null res then error $ "XXX  " ++ inp else return ()++++runtest = do+  db <- parseDir "/home/choener/tmp/mcfold/MCFOLD-DB"+  {-+  doFold db True 8.0 "cccaaaggg"+  doFold db True 10.0 "ccccccaaagggcccaaagggggg"+  -}+  doFold (Options undefined False False True 2.0 False) db "UGAGUUUAUCAGCUGAUUUU"

@@ -0,0 +1,2 @@+import Distribution.Simple+main = defaultMain