diff --git a/BioInf/MCFoldDP.hs b/BioInf/MCFoldDP.hs new file mode 100644 --- /dev/null +++ b/BioInf/MCFoldDP.hs @@ -0,0 +1,387 @@ +{-# LANGUAGE RecordWildCards #-} + +-- | + +module BioInf.MCFoldDP where + +import Control.Arrow (first,second) +import Control.Monad +import Control.Monad.ST +import Data.List (find,sort) +import Data.Tuple.Select -- (sel5) +import qualified Data.Vector.Unboxed as VU + +import Biobase.DataSource.MCFold +import Biobase.Constants +import Biobase.RNA +import Biobase.RNA.Hashes +import Biobase.RNA.NucBounds +import Biobase.Structure +import Data.PrimitiveArray +import Data.PrimitiveArray.Ix + + + +-- | Folding wrapper + +fold :: MotifDB -> Primary -> Tables +fold db inp = runST $ foldST db inp + +-- | Folding in the ST monad. the number of dncm tables is the same as the +-- number of known double NCMs. + +foldST :: MotifDB -> Primary -> ST s Tables +foldST db inp = do + let n = VU.length inp -1 + (sncm,sncmM) <- mkTable2 n + (dncms,dncmMs) <- liftM unzip . mapM (const $ mkTable2 n) $ VU.toList knownDoubleNCM + (tmp,tmpM) <- mkTable2 n + (mbr,mbrM) <- mkTable2 n + (mbr1,mbr1M) <- mkTable2 n + (extern,externM) <- mkTable2With 0 n + forM_ [n,n-1 .. 0] $ \i -> forM_ [i,i+1 .. n] $ \j -> do + + -- single NCM calculation, together with multibranched loops / large + -- interior loops + -- + -- TODO check if large interior loops are ok?! Do we even want those, or + -- should they come solely from NCMs? Have an option for that + let sncmIJ = fncmSingle db inp i j + -- let multiIJ = if j-i-1>0 then (VU.minimum . VU.map (\k -> mbr!(i+1,k)+mbr1!(k+1,j-1)) $ VU.enumFromN (i+1) (j-i-1)) else eInf + let multiIJ = vuminimum $ fMulti db inp i j mbr mbr1 -- if j-i-1>0 then VU.minimum . VU.map snd $ fMulti db inp i j mbr mbr1 else eInf + let interiorIJ = vuminimum $ fInterior db inp i j tmp -- VU.minimum . VU.map snd $ fInterior db inp i j tmp + writeM sncmM (i,j) $ minimum [sncmIJ, multiIJ, interiorIJ] + -- double NCM calculation + forM (zip3 dncms dncmMs $ VU.toList knownDoubleNCM) $ \(dncm, dncmM, ((di,dj),_)) -> do + let k = i+di-1 + let l = j-dj+1 + -- (1) Begin a stem (dNCM follows sNCM) + let dsIJ = fncmDS db inp i j k l sncm + -- (2) continue a stem (dNCM follows dNCM) + let ddIJ = VU.minimum . VU.map snd $ fncmDD db inp i j k l dncms + writeM dncmM (i,j) $ dsIJ `min` ddIJ + + -- fill helper table which makes mbr calculations ~2x faster + writeM tmpM (i,j) $ minimum $ map (!(i,j)) dncms + + -- fill mbr table + let upIJ = if (i+1 mbr!(i,k) + tmp!(k+1,j)) $ VU.enumFromN (i+1) (j-i-1) else eInf + let mbrstemIJ = if (i+2 do + let unpairedExt = extern!(i+1,j) + let stemExtExt = if (i+2 Double -> Primary -> Tables -> [(Double,Secondary)] +backtrack db delta inp (sncm,dncms,mbr,mbr1,extern) = outp where + outp + | bE >= -0.0001 = [(0,Secondary (n+1) [])] + | otherwise = map (first (bE+delta-) . second (Secondary (n+1) . sort)) $ externbt delta 0 n + externbt d i j = + -- unpaired nucleotide to the left + [ (e,x) + | i=0 + , (e,x) <- externbt d' (i+1) j + ] ++ + -- stem + [ (e,x) + | i=0 + , (e,x) <- dncmbt d' idx i k + ] ++ + -- two or more stems + [ (ey,x++y) + | i=0 + , (ex,x) <- dncmbt d' idx i k + , ex>=0 + , (ey,y) <- externbt ex (k+1) j + , ey>=0 + ] + dncmbt d idx i j = + -- D-D + [ (e,(i,j):x) + | let (di,dj) = fst $ knownDoubleNCM VU.! idx + , let dncm = dncms!!idx + , let k = i+di-1, let l = j-dj+1 + , (nidx,bestE) <- VU.toList $ fncmDD db inp i j k l dncms + , let d' = dncm!(i,j) - bestE + d + , d'>=0 + , (e,x) <- dncmbt d' nidx k l + ] ++ + -- D-S + [ (e,(i,j):x) + | let (di,dj) = fst $ knownDoubleNCM VU.! idx + , let dncm = dncms!!idx + , let k = i+di-1, let l = j-dj+1 + , let bestE = fncmDS db inp i j k l sncm + , let d' = dncm!(i,j) - bestE + d + , d'>=0 + , (e,x) <- sncmbt d' k l + ] + sncmbt d i j = + [ (d',[(i,j)]) + | j-i>=3 + , let bestE = fncmSingle db inp i j + , let d' = sncm!(i,j) - bestE + d + , d'>=0 + ] ++ + -- sNCM enclosing a multibranched loop + [ (ey,(i,j):x++y) + | j-i>3 + , (k,bestE) <- VU.toList $ fMulti db inp i j mbr mbr1 + , let d' = sncm!(i,j) - bestE + d + , d'>=0 + , (ex,x) <- mbrbt d' (i+1) k + , ex>=0 + , (ey,y) <- mbr1bt ex (k+1) (j-1) + ] ++ + -- sNCM inclosing an interior loop + [ (e,(i,j):x) + | idx <- [0 .. VU.length knownDoubleNCM -1] + , let dncm = dncms!!idx + , ((k,l),bestE) <- VU.toList $ fInterior db inp i j dncm + , let d' = sncm!(i,j) - bestE + d + , d'>=0 + , (e,x) <- dncmbt d' idx k l + ] + -- TODO enclosing an interior loop + mbrbt d i j = + -- unpaired to the right + [ (x,z) + | i+1=0 + , (x,z) <- mbrbt d' i (j-1) + ] ++ + -- a stem at k,j + [ (x,z) + | i+1=0 + , (x,z) <- dncmbt d' idx k j + ] ++ + -- two or more stems + [ (ey,x++y) + | i+2=0 + , (ex,x) <- mbrbt d' i k + , ex>=0 + , (ey,y) <- dncmbt ex idx (k+1) j + ] + mbr1bt d i j = + -- add a stem at i j + [ (x,z) + | i+1=0 + , (x,z) <- dncmbt d' idx i j + ] ++ + -- unpaired to the right + [ (x,z) + | i+1=0 + , (x,z) <- mbr1bt d' i (j-1) + ] + n = VU.length inp -1 + bE = extern ! (0,n) + + + +-- * Combining NCMs + +-- | singleNCM insertion + +fncmSingle :: MotifDB -> Primary -> Int -> Int -> Double +fncmSingle MotifDB{..} inp i j + | l<4 = eInf + | otherwise = maybe 0 ((!ci) . snd) $ find ((l==).fst) $ sCycles where + ci = mkHashedPrimary (minExtended,maxExtended) $ VU.slice i l inp + l = j-i+1 +{-# INLINE fncmSingle #-} + +-- | double NCM extend single NCM. We do not care that this is comparatively +-- slow as it is called only a few times, anyway. +-- +-- TODO make faster (better lookup system) +-- TODO otherwise case +-- TODO eats another ~10% performance + +fncmDS :: MotifDB -> Primary -> Int -> Int -> Int -> Int -> Table2 -> Double +fncmDS MotifDB{..} inp i j k l sncm + | k>=l = eInf + -- in case we have one of the three known single NCMs + | Just hinge <- ((di,dj),len) `lookup` dsConnect + , Just ncm <- (di,dj) `lookup` dCycles + = sncm!(k,l) + hinge!(inp `VU.unsafeIndex` k, inp `VU.unsafeIndex` l) + ncm!ci +-- | i==1 && j==7 && di==2 && dj==2 = error $ show (di,dj,len) + -- the single NCM is larger + | otherwise = sncm!(k,l) + where + di = k-i+1 + dj = j-l+1 + len = l-k+1 + ci = mkHashedPrimary (minExtended,maxExtended) $ VU.slice i di inp VU.++ VU.slice l dj inp +{-# INLINE fncmDS #-} + +-- | double NCM extending another double NCM. +-- +-- TODO this one could profit from performance improvements. But check first vs. multibranch timings +-- TODO remove otherwise case +-- TODO improve performance, eats ~66% of total time +-- TODO improve: return empty vector on error, write special minimum function that has eInf on empty + +fncmDD :: MotifDB -> Primary -> Int -> Int -> Int -> Int -> [Table2] -> VU.Vector (Int,Double) +fncmDD MotifDB{..} inp i j k l dncms = VU.fromList $ zipWith3 f (map fst $ VU.toList knownDoubleNCM) [0..] dncms where + f (dk,dl) idx dncm + | k+2>=l = (-1,eInf) + | Just hinge <- ((di,dj),(dk,dl)) `lookup` ddConnect + , Just ncm <- (di,dj) `lookup` dCycles + = (idx,dncm!(k,l) + hinge!(inp `VU.unsafeIndex` k, inp `VU.unsafeIndex` l) + ncm!ci) + | otherwise = (-1,eInf) + where + di = k-i+1 + dj = j-l+1 + ci = mkHashedPrimary (minExtended,maxExtended) $ VU.slice i di inp VU.++ VU.slice l dj inp +{-# INLINE fncmDD #-} + +-- | Add one stem for "external" calculations +-- +-- TODO make efficient + +fStemExt :: [Table2] -> Int -> Int -> VU.Vector (Int,Int,Double) -- (dncms!!,k,value) +fStemExt dncms i j = VU.fromList xs where + xs = [ (d,k,dncm!(i,k)) + | (d,dncm) <- zip [0..] dncms + , k <- [i+1..j] + ] +{-# INLINE fStemExt #-} + +-- | Combine stems for "external" calculations + +fStemExtExt :: [Table2] -> Table2 -> Int -> Int -> VU.Vector (Int,Int,Double) +fStemExtExt dncms extern i j = VU.fromList xs where + xs = [ (d,k,dncm!(i,k) + extern!(k+1,j)) + | (d,dncm) <- zip [0..] dncms + , k <- [i+1..j-1] + ] +{-# INLINE fStemExtExt #-} + +-- | Close a multibranched loop with a singleNCM +-- +-- TODO close with singleNCM + +fMulti :: MotifDB -> Primary -> Int -> Int -> Table2 -> Table2 -> VU.Vector (Int,Double) +fMulti db inp i j mbr mbr1 = xs where + xs = VU.map (\k -> (k, mbr!(i+1,k) + mbr1!(k+1,j-1))) $ (VU.enumFromN (i+1) (j-i-1)) +{-# INLINE fMulti #-} + +-- | Connect a partial multibranched structure with a hairpin. Note that the +-- "dncm" hairpin part wants one table, not the list of all tables. + +fMMbrStem :: Int -> Int -> Table2 -> Table2 -> VU.Vector (Int,Double) +fMMbrStem i j mbr dncm = VU.map (\k -> (k,mbr!(i,k) + dncm!(k+1,j))) $ VU.enumFromN (i+1) (j-i-1) +{-# INLINE fMMbrStem #-} + +-- | Add the first stem + +fMStem :: Int -> Int -> Table2 -> VU.Vector (Int,Double) +fMStem i j dncm = VU.map (\k -> (k,dncm!(k,j))) $ VU.enumFromN i (j-i) +{-# INLINE fMStem #-} + +-- | Interior loops of some size +-- +-- TODO this could profit from a log-based scoring function + +fInterior :: MotifDB -> Primary -> Int -> Int -> Table2 -> VU.Vector ((Int,Int),Double) +{- +fInterior MotifDB{..} inp i j dncm = VU.fromList $ ((-1,-1),eInf) : xs where + xs = [ ((k,l),dncm!(k,l)) + | k<-[i+1 .. i+10] + , l<-[j-1,j-2 .. j-10] + , k ((k,l),dncm!(k,l))) . VU.filter (\(k,l) -> k Double +getScore ts = score where + t = sel5 ts + (_,(n,_)) = bounds t + score = t!(0,n) + +-- | The default two-dim table + +mkTable2 n = mkTable2With eInf n + +-- | Create a 2-dim table + +mkTable2With v n = do + tM <- fromAssocsM (0,0) (n,n) v [] + t <- unsafeFreezeM tM + return (t,tM) + +-- | minimum for unboxed vectors, capturing possible 0-length. Vectors in this +-- algorithm \always\ carry positional information. +-- +-- TODO the next version of the vector library should handle "VU.map snd" +-- better + +vuminimum xs = VU.foldl' (\a (_,x) -> min a x) eInf xs +{-# INLINE vuminimum #-} +-- vuminimum = VU.foldl' min eInf . VU.map snd + + + +-- * types and newtypes + +type Table2 = PrimArray (Int,Int) Double +type Table4 = PrimArray (Int,Int,Int,Int) Double +type Tables = (Table2,[Table2],Table2,Table2,Table2) diff --git a/LICENSE b/LICENSE new file mode 100644 --- /dev/null +++ b/LICENSE @@ -0,0 +1,675 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. + diff --git a/MC-Fold-DP.cabal b/MC-Fold-DP.cabal new file mode 100644 --- /dev/null +++ b/MC-Fold-DP.cabal @@ -0,0 +1,81 @@ +name: MC-Fold-DP +version: 0.1.0.0 +author: Christian Hoener zu Siederdissen, Stephan H Bernhart, Peter F Stadler, Ivo L Hofacker +copyright: Christian Hoener zu Siederdissen, 2010-2011 +homepage: http://www.tbi.univie.ac.at/software/mcfolddp/ +maintainer: choener@tbi.univie.ac.at +category: Bioinformatics +license: GPL-3 +license-file: LICENSE +build-type: Simple +stability: experimental +cabal-version: >= 1.4.0 +synopsis: + Folding algorithm based on nucleotide cyclic motifs. +description: + This is a RNA secondary structure prediction tool based on the + idea of combining small motifs, called nucleotide cyclic motifs + (NCMs). The algorithm implemented here and described in + . + Hoener zu Siederdissen C, Bernhart SH, Stadler PF, Hofacker IL, + "A Folding Algorithm for Extended RNA Secondary Structures", + 2011, submitted + . + has polynomial runtime in O(n^3) and uses a (pseudo-energy) + scoring scheme based on + . + Parisien M, Major F. "The MC-Fold and MC-Sym pipeline infers + RNA structure from sequence data", Nature 2008, + 452(7183):51-55. + . + This program uses the same database as MC-Fold (which has + exponential run-time) and aims to be able to produce the same + results. + . + The underlying grammar of our implementation is unambiguous and + allows the complete evaluation of all structures within an + energy band above the ground state, presenting each unique + structure just once. Alternatively, the grammar allows + partition function calculations. + . + Current status: + . + * comparable prediction accuracy on sequences + . + * possibility to use sparse data correction + . + * handles non-ACGU nucleotides gracefully + . + * suboptimals: return all structures within an energy band above the ground state + . + Todo: + . + * Boltzmann likelihood calculations + . + * pseudoknot calculations (currently aiming for a pknotsRG-like algorithm) + +library + build-depends: + base >= 4 && < 5, + vector, + tuple, + PrimitiveArray, + Biobase == 0.3.1.0 + exposed-modules: + BioInf.MCFoldDP + ghc-options: + -Odph + if impl(ghc > 6.13) + ghc-options: + -fllvm + +executable MCFoldDP + build-depends: + cmdargs == 0.6.8 + main-is: + MCFoldDP.hs + ghc-options: + -Odph + if impl(ghc > 6.13) + ghc-options: + -fllvm diff --git a/MCFoldDP.hs b/MCFoldDP.hs new file mode 100644 --- /dev/null +++ b/MCFoldDP.hs @@ -0,0 +1,75 @@ +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE DeriveDataTypeable #-} + +module Main where + +import System.Console.CmdArgs +import Control.Monad (liftM) +import Text.Printf +import Data.List (sortBy) +import Data.Ord (comparing) + +import Biobase.DataSource.MCFold +import Biobase.DataSource.MCFold.Import +import Biobase.RNA +import Biobase.Structure +import Biobase.Structure.DotBracket + +import BioInf.MCFoldDP + + + +data Options = Options + { database :: FilePath + , strictInput :: Bool + , noSparseDataCorrection :: Bool + , orderSuboptimals :: Bool + , band :: Double + , oneResult :: Bool + } deriving (Data,Typeable,Show) + +options = Options + { database = "./MCFOLD-DB" &= typDir &= help "path to MCFOLD-DB (default: ./MCFOLD-DB)" + , strictInput = False &= help "filter out other characters than ACGU (default: convert other characters to E and handle gracefully)" + , noSparseDataCorrection = False &= help "disable sparse data correction (default: enabled)" + , orderSuboptimals = False &= help "sort suboptimal results by score (better scores first) (default: false)" + , band = 0.1 &= help "score band above the ground state for which suboptimal results are allowed (default: 0.1)" + , oneResult = False &= help "Return only one of several co-optimal structures in the backtracking phase (default: false)" + } &= summary "MCFold-DP, (c) Christian Hoener zu Siederdissen et al, 2010-2011" + &= details [ "This program performs calculations similar to those done by MC-Fold." + , "Important differences are: polynomial runtime, no pseudoknot handling," + , "sparse data correction, and the possibility to gracefully handle all" + , "input sequences." + ] + +main = do + o@Options{..} <- cmdArgs options + db <- parseDir database + -- TODO enable sparsity correction! + cnts <- liftM ((strictFilter strictInput) . lines) $ getContents + mapM_ (doFold o db) cnts + +strictFilter :: Bool -> [String] -> [String] +strictFilter False xs = xs +strictFilter True xs = filter (all (`elem` "ACGUacgu")) xs + +-- | Executes folding a single sequence. Allows + +doFold :: Options -> MotifDB -> String -> IO () +doFold Options{..} db inp = do + putStrLn inp + let pri = mkPrimary inp + let ts = fold db pri + let res = (if oneResult then take 1 else id) $ backtrack db band pri ts + mapM_ (\(e,s) -> printf "%s (%7.2f)\n" (dotbracket s) e) . (if orderSuboptimals then sortBy (comparing fst) else id) $ res + if null res then error $ "XXX " ++ inp else return () + + + +runtest = do + db <- parseDir "/home/choener/tmp/mcfold/MCFOLD-DB" + {- + doFold db True 8.0 "cccaaaggg" + doFold db True 10.0 "ccccccaaagggcccaaagggggg" + -} + doFold (Options undefined False False True 2.0 False) db "UGAGUUUAUCAGCUGAUUUU" diff --git a/Setup.hs b/Setup.hs new file mode 100644 --- /dev/null +++ b/Setup.hs @@ -0,0 +1,2 @@ +import Distribution.Simple +main = defaultMain