hyraxAbif-0.2.3.2: README.md
# HyraxBio AB1 parser, writer and generator (beta 0.2)
This project contains
- Modules for parsing, generating or manipulating AB1 files.
- Support for generating a minimal AB1 file from a FASTA input file
- A simple terminal app to perform these operations
See
- https://hackage.haskell.org/package/hyraxAbif for the hackage documentation
- http://www6.appliedbiosystems.com/support/software_community/ABIF_File_Format.pdf for a high level overview of the AB1 file format.
# Building
Build with one of
- `stack build` or (`make build`)
- `cabal new-build`
# Terminal app
Run with
- `stack exec hyraxAbif-exe -- -- dump` if you are using stack
- `cabal new-run hyraxAbif-exe dump` if you are using cabal 2.x
## Dump AB1
To dump an existing AB1 run
`hyraxAbif-exe dump example.ab1`
This will output the structure of the AB1 like this
```
Header { hName = "ABIF" , hVersion = 101 }
Directory
{ dTagName = "tdir"
, dTagNum = 1
, dElemTypeCode = 1023
, dElemTypeDesc = "root"
, dElemType = ElemRoot
, dElemSize = 28
, dElemNum = 13
, dDataSize = 364
, dDataOffset = 61980
, dData = ""
, dDataDebug = []
}
[ Directory
{ dTagName = "DATA"
, dTagNum = 9
, dElemTypeCode = 4
, dElemTypeDesc = "short"
, dElemType = ElemShort
, dElemSize = 2
, dElemNum = 7440
, dDataSize = 14880
, dDataOffset = 128
, dData = ""
, dDataDebug = []
}
.
.
.
DATA {short} tagNum=9 size=2 count=7440 offset=128 []
DATA {short} tagNum=10 size=2 count=7440 offset=15008 []
DATA {short} tagNum=11 size=2 count=7440 offset=29888 []
DATA {short} tagNum=12 size=2 count=7440 offset=44768 []
FWO_ {char} tagNum=1 size=1 count=4 offset=1195463747 ["GATC"]
LANE {short} tagNum=1 size=2 count=1 offset=65536 ["1"]
PBAS {char} tagNum=1 size=1 count=744 offset=59648 ["GGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGA"]
PDMF {pString} tagNum=1 size=1 count=23 offset=60392 ["KB_3500_POP7_BDTv3.mob"]
PDMF {pString} tagNum=2 size=1 count=23 offset=60415 ["KB_3500_POP7_BDTv3.mob"]
PLOC {short} tagNum=1 size=2 count=744 offset=60438 []
S/N% {short} tagNum=1 size=2 count=4 offset=61926 []
SMPL {pString} tagNum=1 size=1 count=10 offset=61934 ["S17-SeqF1"]
CMNT {pString} tagNum=1 size=1 count=1 offset=61944 ["Generated by HyraxBio AB1 generator"]
```
The data is output twice. The first section is the detail, the second is the summary.
Selected data types have the "debug data" element populated. e.g. the PBAS (FASTA)
## Generate minimal AB1s from FASTAs
To create an AB1 run
`hyraxAbif-exe gen "./pathContainingFastas" "./pathForOutputAb1s"`
This will create an AB1 per input FASTA
### Input FASTA format
Each input data should have the following format
```
> weight
read
> weight
read
```
- The **weight** is a numeric value between 0 and 1 that specifies the weight of the current read. No other header/name is allowed
- The **read** is the set of input nucleotides, IUPAC ambiguity codes are supported (MRWSYKVHDBNX). A read can be single or multi-line
### Weighted reads
- The weigh of a read specifies the intensity of the peak from 0 to 1.
- Weights for each position are added to a maximum of 1 per nucleotide
- You can use `_` as a "blank" nucleotide, in which only the nucleotides from other reads will be considered
For example
```
> 0.5
ACG
> 0.3
AAAA
> 1
__AC
```
Results in the following weighted nucleotide per position
* 0: `A` (0.5 + 0.3)
* 1: `C` (0.5), `A` (0.3)
* 2: `G` (0.5), `A` (0.3 + 1 = 1)
* 3: `A` (0.3), `C` (1)
*Note that the reads do not need to be the same length.*
---
#### Example FASTA - single file
***eg1.fasta***
```
> 1
ACTG
```

Here there is a single FASTA with a single read with a weigh of 1 (100%). The chromatogram for this AB1 shows perfect traces for the input `ACTG` nucleotides
---
#### Example FASTA - two FASTA files
***eg1.fasta***
```
> 1
ACAG
```
***eg2.fasta***
```
> 1
ACTG
```

Two input FASTA files both with a weigh of 1. You can see in the second trace that the third nucleotide is a `T` (the trace is green). Exactly what the base-calling software (phred & recall etc) decide to call the base as depends on your settings and software choices.
---
#### Example FASTA - two FASTA files with different weights
***eg1.fasta***
```
> 1
ACAG
```
***eg2.fasta***
```
> 0.3
ACTG
```

Here the second fasta has a weight of 0.3 and you can see the traces are 30% of the height of the top ones.
---
#### Example FASTA - single FASTA with a mix
***eg1.fasta***
```
> 1
ACAG
> 0.3
ACTG
```

The single input FASTA has an `AT` mix at the third nucleotide. The first read has a weight of 1 and the second a weight of 0.3.
Notice that the maximum weight is 1, e.g. the first `A` has the same intensity as the second even though the first one has the reads weighted both 1 and 0.3
---
#### Example FASTA - Multiple mixes
***eg1.fasta***
```
> 1
ACAG
> 0.3
_GT
> 0.2
_G
```

---
# Using the modules
- Hyrax.Abif: The core AB1 types
- Hyrax.Abif.Fasta: A simple FASTA parser used when generating AB1s
- Hyrax.Abif.Read: Module for parsing an existing AB1
- Hyrax.Abif.Write: Module for writing a new AB1 file
- Hyrax.Abif.Generate: Module for generating a minimal AB1 from a given FASTA input
For a detailed overview of the code see *TODO* and the haddock documentation *TODO*
For now the terminal app (Main.hs) serves as an example and the best starting point to understand the code
## E.g. Add a comment to an existing AB1 file
```
import qualified Hyrax.Abif as H
import qualified Hyrax.Abif.Read as H
import qualified Hyrax.Abif.Write as H
addComment :: IO ()
addComment = do
abif' <- H.readAbif "example.ab1"
case abif' of
Left e -> putText $ "error reading ABIF: " <> e
Right abif -> do
let modified = H.addDirectory abif $ H.mkComment "new comment"
H.writeAbif "example.modified.ab1" modified
```
For additional examples see the Examples directory