flowsim-0.3: src/KitSim.hs
{-| Simulate reagent 'kits', i.e. tack on adapters etc -}
{-# LANGUAGE DeriveDataTypeable #-}
module KitSim where
import Version
import System.Console.CmdArgs
import System.IO
import qualified Data.ByteString.Lazy.Char8 as B
import Bio.Sequence
main :: IO ()
main = do
cf <- cmdArgs conf
let reader = fmap (map castToNuc) $
case input cf of "-" -> hReadFasta stdin
f -> readFasta f
writer = case output cf of "-" -> hWriteFasta stdout
f -> writeFasta f
apply cf `fmap` reader >>= writer
apply :: Conf -> [Sequence Nuc] -> [Sequence Nuc]
apply c = map apply1
where apply1 (Seq s d _) = Seq s (B.concat [k,d,a]) Nothing
k = B.pack (key c)
a = B.pack (adapter c)
conf :: Conf
conf = Conf
{ key = "TCAG" &= help "Sequence for initial key" &= typ "String"
, adapter = "ctgagactgccaaggcacacagggggatagg" &= help "Sequence for B-adapter" &= typ "String"
, input = "-" &= args &= typFile
, output = "-" &= help "Output file" &= typFile
} &= program "kitsim"
&= summary ("kitsim"++version)
&= details ["Simulates the sequencing kit by tacking on the initial key"
,"(really the end of the A-adapter) and B-adapter"]
data Conf = Conf { key, adapter :: String, input, output :: FilePath }
deriving (Data,Typeable)