packages feed

flowsim-0.3.3: src/KitSim.hs

{-| Simulate reagent 'kits', i.e. tack on adapters etc -}
{-# LANGUAGE DeriveDataTypeable #-}

module KitSim where

import Version

import System.Console.CmdArgs
import System.IO
import qualified Data.ByteString.Lazy.Char8 as B

import Bio.Core.Sequence
import Bio.Sequence.Fasta

main :: IO ()
main = do
  cf <- cmdArgs conf
  let reader = case input cf of "-" -> hReadFasta stdin
                                f   -> readFasta f
      writer = case output cf of "-" -> hWriteFasta stdout
                                 f   -> writeFasta f
  apply cf `fmap` reader >>= writer

apply :: Conf -> [Sequence] -> [Sequence]
apply c = map apply1
  where apply1 (Seq s (SeqData d) _) = Seq s (SeqData $ B.concat [k,d,a]) Nothing
        k = B.pack (key c)
        a = B.pack (adapter c)

conf :: Conf
conf = Conf 
  { key = "TCAG" &= help "Sequence for initial key"   &= typ "String"
  , adapter = "ctgagactgccaaggcacacagggggatagg" &= help "Sequence for B-adapter" &= typ "String"
  , input = "-"  &= args                              &= typFile
  , output = "-" &= help "Output file"                &= typFile
  } &= program "kitsim"
    &= summary ("kitsim"++version)
    &= details ["Simulates the sequencing kit by tacking on the initial key"
               ,"(really the end of the A-adapter) and B-adapter"]

data Conf = Conf { key, adapter :: String, input, output :: FilePath }
            deriving (Data,Typeable)