diff --git a/CHANGELOG.md b/CHANGELOG.md --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -93,3 +93,17 @@ * Fixed BOPT deconstruction in deconstructSAM_V1_6 (writeSAM_V1_6). * Added extra writeSAM_V1_6 test cases. + +## 0.9.0.0 -- 2023-10-31 + +* Fixed writeSAM_V1_6 function. +* Added additional test cases for writeSAM_V1_6. + +## 0.10.0.0 -- 2024-07-15 + +* Fixed SAM parsing of optional fields. +* Reorganized/refactored SAM modules. +* Added BAM parsing. +* Added internal modules. +* Updated copyright in all modules. +* Updated LICENSE with updated year. diff --git a/LICENSE b/LICENSE --- a/LICENSE +++ b/LICENSE @@ -1,4 +1,4 @@ -Copyright (c) 2023, Matthew Mosior +Copyright (c) 2024, Matthew Mosior All rights reserved. diff --git a/hs-samtools.cabal b/hs-samtools.cabal --- a/hs-samtools.cabal +++ b/hs-samtools.cabal @@ -20,7 +20,7 @@ -- PVP summary: +-+------- breaking API changes -- | | +----- non-breaking API additions -- | | | +--- code changes with no API change -version: 0.9.0.0 +version: 0.10.0.0 -- A short (one-line) description of the package. synopsis: Read and write SAM, BAM, and CRAM files. @@ -65,15 +65,65 @@ import: warnings -- Modules exported by the library. - exposed-modules: Data.SAM.Version1_6.Base, + exposed-modules: Data.BAM.Version1_6.Base, + Data.BAM.Version1_6.BAM, + Data.BAM.Version1_6.BAM.BAMAlignments, + Data.BAM.Version1_6.BAM.BAMHeader, + Data.BAM.Version1_6.BAM.Alignment, + Data.BAM.Version1_6.BAM.Alignment.Base, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.Base, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.AOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigCOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigIOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigSOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallCOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallIOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallSOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.FOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.HOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.ZOPT, + Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BOPT, + Data.BAM.Version1_6.BAM.Header, + Data.BAM.Version1_6.BAM.Header.CO, + Data.BAM.Version1_6.BAM.Header.HD, + Data.BAM.Version1_6.BAM.Header.PG, + Data.BAM.Version1_6.BAM.Header.RG, + Data.BAM.Version1_6.BAM.Header.SQ, + Data.BAM.Version1_6.BAM.ReferenceInformation, + Data.BAM.Version1_6.BAM.ReferenceInformation.Base, + Data.BAM.Version1_6.BGZFBlock, + Data.BAM.Version1_6.GZipHeader, + Data.BAM.Version1_6.Read.Base, + Data.BAM.Version1_6.Read.Error, + Data.BAM.Version1_6.Read.Parser.BGZFBlock, + Data.BAM.Version1_6.Read.Parser.BAM.Base, + Data.BAM.Version1_6.Read.Parser.BAM.BAMAlignments, + Data.BAM.Version1_6.Read.Parser.BAM.BAMHeader, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Base, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.AOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigCOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigIOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigSOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallCOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallIOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallSOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.FOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.HOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.ZOPT, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BOPT, + Data.BAM.Version1_6.Read.Parser.BAM.ReferenceInformation.Base, + Data.BAM.Version1_6.Write.Base, + Data.BAM.Version1_6.Write.Error, + Data.SAM.Version1_6.Base, Data.SAM.Version1_6.Alignment, Data.SAM.Version1_6.Alignment.Base, - Data.SAM.Version1_6.Alignment.AOPT, - Data.SAM.Version1_6.Alignment.FOPT, - Data.SAM.Version1_6.Alignment.HOPT, - Data.SAM.Version1_6.Alignment.IOPT, - Data.SAM.Version1_6.Alignment.ZOPT, - Data.SAM.Version1_6.Alignment.BOPT, + Data.SAM.Version1_6.Alignment.OptionalFields.Base, + Data.SAM.Version1_6.Alignment.OptionalFields.AOPT, + Data.SAM.Version1_6.Alignment.OptionalFields.FOPT, + Data.SAM.Version1_6.Alignment.OptionalFields.HOPT, + Data.SAM.Version1_6.Alignment.OptionalFields.IOPT, + Data.SAM.Version1_6.Alignment.OptionalFields.ZOPT, + Data.SAM.Version1_6.Alignment.OptionalFields.BOPT, Data.SAM.Version1_6.Header, Data.SAM.Version1_6.Header.CO, Data.SAM.Version1_6.Header.HD, @@ -83,12 +133,12 @@ Data.SAM.Version1_6.Read.Base, Data.SAM.Version1_6.Read.Error, Data.SAM.Version1_6.Read.Parser.Alignment.Base, - Data.SAM.Version1_6.Read.Parser.Alignment.AOPT, - Data.SAM.Version1_6.Read.Parser.Alignment.IOPT, - Data.SAM.Version1_6.Read.Parser.Alignment.FOPT, - Data.SAM.Version1_6.Read.Parser.Alignment.ZOPT, - Data.SAM.Version1_6.Read.Parser.Alignment.HOPT, - Data.SAM.Version1_6.Read.Parser.Alignment.BOPT, + Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.AOPT, + Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.IOPT, + Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.FOPT, + Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.ZOPT, + Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.HOPT, + Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.BOPT, Data.SAM.Version1_6.Read.Parser.Header.HD.Base, Data.SAM.Version1_6.Read.Parser.Header.HD.VN, Data.SAM.Version1_6.Read.Parser.Header.HD.SO, @@ -131,26 +181,37 @@ Data.SAM.Version1_6.Write.Base -- Modules included in this library but not exported. - -- other-modules: + other-modules: Data.BAM.Version1_6.Internal, + Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Internal, + Data.BAM.Version1_6.Write.Internal, + Data.SAM.Version1_6.Internal -- LANGUAGE extensions used by modules in this package. -- other-extensions: -- Other library packages from which modules are imported. - build-depends: base ^>=4.17.1.0, - ascii >= 1.7.0 && < 1.8, - attoparsec >= 0.14.4 && < 0.15, - bitvec >= 1.1.4 && < 1.2, - bytestring >= 0.11.4 && < 0.12, - containers >= 0.6.7 && < 0.7, - crypton >= 0.33 && < 0.34, - generic-deriving >= 1.14.5 && < 1.15, - parser-combinators >= 1.3.0 && < 1.4, - pcre-heavy >= 1.0.0 && < 1.1, - regex-tdfa >= 1.3.2 && < 1.4, - streamly >= 0.9.0 && < 0.10, - streamly-bytestring >= 0.2.0 && < 0.3, - streamly-core >= 0.1.0 && < 0.2 + build-depends: base >= 4.18.2 && < 4.19, + array >= 0.5.6 && < 0.6, + ascii >= 1.7.0 && < 1.8, + base16 >= 1.0 && < 1.1, + binary >= 0.8.9 && < 0.9, + bytestring >= 0.11.5 && < 0.12, + containers >= 0.6.7 && < 0.7, + attoparsec >= 0.14.4 && < 0.15, + bitvec >= 1.1.5 && < 1.2, + crypton >= 1.0.0 && < 1.1, + deepseq >= 1.4.8 && < 1.5, + digest >= 0.0.2 && < 0.1, + generic-deriving >= 1.14.5 && < 1.15, + mason >= 0.2.6 && < 0.3, + parsers >= 0.12.11 && < 0.13, + parser-combinators >= 1.3.0 && < 1.4, + pcre-heavy >= 1.0.0 && < 1.1, + regex-tdfa >= 1.3.2 && < 1.4, + streamly >= 0.10.0 && < 0.11, + streamly-bytestring >= 0.2.1 && < 0.3, + streamly-core >= 0.2.1 && < 0.3, + zlib >= 0.7.1 && < 0.8 -- Directories containing source files. hs-source-dirs: src @@ -181,7 +242,7 @@ main-is: Main.hs -- Test dependencies. - build-depends: base ^>=4.17.1.0, + build-depends: base, bytestring, containers, hspec, diff --git a/src/Data/BAM/Version1_6/BAM.hs b/src/Data/BAM/Version1_6/BAM.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM.hs @@ -0,0 +1,63 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM ( -- * BAM_V1_6_BAM version 1.6 data type + BAM_V1_6_BAM(..) + ) where + +import Data.BAM.Version1_6.BAM.BAMHeader +import Data.BAM.Version1_6.BAM.BAMAlignments + +import Data.Data +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6_BAM"@ (BAM version 1.6) data type. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM = BAM_V1_6_BAM + { bam_v1_6_bam_bamheader :: Maybe BAM_V1_6_BAM_BAMHeader + , bam_v1_6_bam_bamalignments :: Maybe BAM_V1_6_BAM_BAMAlignments + , bam_v1_6_bam_endoffilemarker :: Bool + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM where + BAM_V1_6_BAM bam_v1_6_bam_bamheader1 + bam_v1_6_bam_bamalignments1 + bam_v1_6_bam_endoffilemarker1 == + BAM_V1_6_BAM bam_v1_6_bam_bamheader2 + bam_v1_6_bam_bamalignments2 + bam_v1_6_bam_endoffilemarker2 = + bam_v1_6_bam_bamheader1 == bam_v1_6_bam_bamheader2 && + bam_v1_6_bam_bamalignments1 == bam_v1_6_bam_bamalignments2 && + bam_v1_6_bam_endoffilemarker1 == bam_v1_6_bam_endoffilemarker2 + +instance Show BAM_V1_6_BAM where + show (BAM_V1_6_BAM header + alignments + endoffilemarker + ) = + "BAM_V1_6_BAM { " ++ + "bam_v1_6_bam_bamheader = " ++ + (show header) ++ + " , bam_v1_6_bam_alignments = " ++ + (show alignments) ++ + " , bam_v1_6_bam_endoffilemarker = " ++ + (show endoffilemarker) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment.hs b/src/Data/BAM/Version1_6/BAM/Alignment.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment.hs @@ -0,0 +1,38 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment ( -- * BAM version 1.6 alignment mandatory and optional data types (RE-EXPORT) + module Data.BAM.Version1_6.BAM.Alignment.Base + ) where + +-- | Re-exports. +import Data.BAM.Version1_6.BAM.Alignment.Base diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/Base.hs b/src/Data/BAM/Version1_6/BAM/Alignment/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/Base.hs @@ -0,0 +1,176 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} +{-# OPTIONS_GHC -fno-warn-name-shadowing #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.Base ( -- * BAM version 1.6 alignment mandatory and optional data types + BAM_V1_6_BAM_Alignment(..) + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.Base + +import Data.ByteString +import Data.Int +import Data.Sequence +import Data.Word +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_BAM_Alignment"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment = BAM_V1_6_BAM_Alignment + { bam_v1_6_bam_alignment_block_size :: Word32 -- ^ Total length of the alignment + -- record, excluding this field. + , bam_v1_6_bam_alignment_refID :: Int32 -- ^ Reference sequence ID, -1 <= refID <= n_ref; + -- -1 for a read without a mapping position. + , bam_v1_6_bam_alignment_pos :: Int32 -- ^ 0-based leftmost coordinate (= POS - 1). + , bam_v1_6_bam_alignment_l_read_name :: Word8 -- ^ Length of read_name below (= length(QNAME) + 1). + , bam_v1_6_bam_alignment_mapq :: Word8 -- ^ Mapping quality (= MAPQ). + , bam_v1_6_bam_alignment_bin :: Word16 -- ^ BAI index bin, see Section 4.2.1. + , bam_v1_6_bam_alignment_n_cigar_op :: Word16 -- ^ Number of operations in CIGAR, + -- see section 4.2.2. + , bam_v1_6_bam_alignment_flag :: Word16 -- ^ Bitwise flags (= FLAG). + , bam_v1_6_bam_alignment_l_seq :: Word32 -- ^ Length of SEQ. + , bam_v1_6_bam_alignment_next_refID :: Int32 -- ^ Ref-ID of the next seqment + -- (-1 <= next_refID <= n_ref). + , bam_v1_6_bam_alignment_next_pos :: Int32 -- ^ 0-based leftmost pos of the + -- next segment (= PNEXT - 1). + , bam_v1_6_bam_alignment_tlen :: Int32 -- ^ Template length (= TLEN). + , bam_v1_6_bam_alignment_read_name :: ByteString -- ^ Read name; NUL-terminated + -- (QNAME with trailing 0x00/'\0'). + , bam_v1_6_bam_alignment_cigar :: Seq Word32 -- ^ CIGAR; op_len<<4<<|op. + -- 'MIDNSHP=X' -> '012345678'. + , bam_v1_6_bam_alignment_seq :: Seq Word8 -- ^ 4-bit encoded read: + -- '=ACMGRSVTWYHKDBN' -> [0,15]. + -- See section 4.2.3. + , bam_v1_6_bam_alignment_qual :: ByteString -- ^ Phred-scaled base qualities. + -- See section 4.2.3. + , bam_v1_6_bam_alignment_optionalfields :: Seq BAM_V1_6_BAM_Alignment_OptionalFields -- ^ List of auxiliary data. + -- See section 4.2.4 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment where + BAM_V1_6_BAM_Alignment bam_v1_6_bam_alignment_block_size1 + bam_v1_6_bam_alignment_refID1 + bam_v1_6_bam_alignment_pos1 + bam_v1_6_bam_alignment_l_read_name1 + bam_v1_6_bam_alignment_mapq1 + bam_v1_6_bam_alignment_bin1 + bam_v1_6_bam_alignment_n_cigar_op1 + bam_v1_6_bam_alignment_flag1 + bam_v1_6_bam_alignment_l_seq1 + bam_v1_6_bam_alignment_next_refID1 + bam_v1_6_bam_alignment_next_pos1 + bam_v1_6_bam_alignment_tlen1 + bam_v1_6_bam_alignment_read_name1 + bam_v1_6_bam_alignment_cigar1 + bam_v1_6_bam_alignment_seq1 + bam_v1_6_bam_alignment_qual1 + bam_v1_6_bam_alignment_optional_fields1 == + BAM_V1_6_BAM_Alignment bam_v1_6_bam_alignment_block_size2 + bam_v1_6_bam_alignment_refID2 + bam_v1_6_bam_alignment_pos2 + bam_v1_6_bam_alignment_l_read_name2 + bam_v1_6_bam_alignment_mapq2 + bam_v1_6_bam_alignment_bin2 + bam_v1_6_bam_alignment_n_cigar_op2 + bam_v1_6_bam_alignment_flag2 + bam_v1_6_bam_alignment_l_seq2 + bam_v1_6_bam_alignment_next_refID2 + bam_v1_6_bam_alignment_next_pos2 + bam_v1_6_bam_alignment_tlen2 + bam_v1_6_bam_alignment_read_name2 + bam_v1_6_bam_alignment_cigar2 + bam_v1_6_bam_alignment_seq2 + bam_v1_6_bam_alignment_qual2 + bam_v1_6_bam_alignment_optional_fields2 = + bam_v1_6_bam_alignment_block_size1 == bam_v1_6_bam_alignment_block_size2 && + bam_v1_6_bam_alignment_refID1 == bam_v1_6_bam_alignment_refID2 && + bam_v1_6_bam_alignment_pos1 == bam_v1_6_bam_alignment_pos2 && + bam_v1_6_bam_alignment_l_read_name1 == bam_v1_6_bam_alignment_l_read_name2 && + bam_v1_6_bam_alignment_mapq1 == bam_v1_6_bam_alignment_mapq2 && + bam_v1_6_bam_alignment_bin1 == bam_v1_6_bam_alignment_bin2 && + bam_v1_6_bam_alignment_n_cigar_op1 == bam_v1_6_bam_alignment_n_cigar_op2 && + bam_v1_6_bam_alignment_flag1 == bam_v1_6_bam_alignment_flag2 && + bam_v1_6_bam_alignment_l_seq1 == bam_v1_6_bam_alignment_l_seq2 && + bam_v1_6_bam_alignment_next_refID1 == bam_v1_6_bam_alignment_next_refID2 && + bam_v1_6_bam_alignment_next_pos1 == bam_v1_6_bam_alignment_next_pos2 && + bam_v1_6_bam_alignment_tlen1 == bam_v1_6_bam_alignment_tlen2 && + bam_v1_6_bam_alignment_read_name1 == bam_v1_6_bam_alignment_read_name2 && + bam_v1_6_bam_alignment_cigar1 == bam_v1_6_bam_alignment_cigar2 && + bam_v1_6_bam_alignment_seq1 == bam_v1_6_bam_alignment_seq2 && + bam_v1_6_bam_alignment_qual1 == bam_v1_6_bam_alignment_qual2 && + bam_v1_6_bam_alignment_optional_fields1 == bam_v1_6_bam_alignment_optional_fields2 + +instance Show BAM_V1_6_BAM_Alignment where + show ( BAM_V1_6_BAM_Alignment block_size + refID + pos + l_read_name + mapq + bin + n_cigar_op + flag + l_seq + next_refID + next_pos + tlen + read_name + cigar + seq + qual + optionalfields + ) = + "BAM_V1_6_BAM_Alignment { " ++ + "bam_v1_6_bam_alignment_block_size = " ++ + (show block_size) ++ + " , bam_v1_6_bam_alignment_refID = " ++ + (show refID) ++ + " , bam_v1_6_bam_alignment_pos = " ++ + (show pos) ++ + " , bam_v1_6_bam_alignment_l_read_name = " ++ + (show l_read_name) ++ + " , bam_v1_6_bam_alignment_mapq = " ++ + (show mapq) ++ + " , bam_v1_6_bam_alignment_bin = " ++ + (show bin) ++ + " , bam_v1_6_bam_alignment_n_cigar_op = " ++ + (show n_cigar_op) ++ + " , bam_v1_6_bam_alignment_flag = " ++ + (show flag) ++ + " , bam_v1_6_bam_alignment_l_seq = " ++ + (show l_seq) ++ + " , bam_v1_6_bam_alignment_next_refID = " ++ + (show next_refID) ++ + " , bam_v1_6_bam_alignment_next_pos = " ++ + (show next_pos) ++ + " , bam_v1_6_bam_alignment_tlen = " ++ + (show tlen) ++ + " , bam_v1_6_bam_alignment_read_name = " ++ + (show read_name) ++ + " , bam_v1_6_bam_alignment_cigar = " ++ + (show cigar) ++ + " , bam_v1_6_bam_alignment_seq = " ++ + (show seq) ++ + " , bam_v1_6_bam_alignment_qual = " ++ + (show qual) ++ + " , bam_v1_6_bam_alignment_optionalfields = " ++ + (show optionalfields) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/AOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/AOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/AOPT.hs @@ -0,0 +1,72 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.AOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.AOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_AOPT(..) + ) where + +import Data.ByteString +import Data.Word +import Data.Data +import Generics.Deriving.Base + + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Alignment_OptionalFields_AOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_AOPT = BAM_V1_6_BAM_Alignment_OptionalFields_AOPT + { bam_v1_6_bam_alignment_optionalfields_aopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_aopt_value :: Word8 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_AOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_AOPT bam_v1_6_bam_alignment_optionalfields_aopt_tag1 + bam_v1_6_bam_alignment_optionalfields_aopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_AOPT bam_v1_6_bam_alignment_optionalfields_aopt_tag2 + bam_v1_6_bam_alignment_optionalfields_aopt_value2 = + bam_v1_6_bam_alignment_optionalfields_aopt_tag1 == bam_v1_6_bam_alignment_optionalfields_aopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_aopt_value1 == bam_v1_6_bam_alignment_optionalfields_aopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_AOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_AOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_AOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_aopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_aopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BOPT.hs @@ -0,0 +1,416 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BOPT ( -- * SAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float(..), + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_SumType(..) + ) where + +import Data.ByteString hiding (count) +import Data.Data +import Data.Int +import Data.Sequence +import Data.Word +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_BAM_Alignment_OptionalFields_BOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_float :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT bam_v1_6_bam_alignment_optionalfields_bopt_int81 + bam_v1_6_bam_alignment_optionalfields_bopt_word81 + bam_v1_6_bam_alignment_optionalfields_bopt_int161 + bam_v1_6_bam_alignment_optionalfields_bopt_word161 + bam_v1_6_bam_alignment_optionalfields_bopt_int321 + bam_v1_6_bam_alignment_optionalfields_bopt_word321 + bam_v1_6_bam_alignment_optionalfields_bopt_float1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT bam_v1_6_bam_alignment_optionalfields_bopt_int82 + bam_v1_6_bam_alignment_optionalfields_bopt_word82 + bam_v1_6_bam_alignment_optionalfields_bopt_int162 + bam_v1_6_bam_alignment_optionalfields_bopt_word162 + bam_v1_6_bam_alignment_optionalfields_bopt_int322 + bam_v1_6_bam_alignment_optionalfields_bopt_word322 + bam_v1_6_bam_alignment_optionalfields_bopt_float2 = + bam_v1_6_bam_alignment_optionalfields_bopt_int81 == bam_v1_6_bam_alignment_optionalfields_bopt_int82 && + bam_v1_6_bam_alignment_optionalfields_bopt_word81 == bam_v1_6_bam_alignment_optionalfields_bopt_word82 && + bam_v1_6_bam_alignment_optionalfields_bopt_int161 == bam_v1_6_bam_alignment_optionalfields_bopt_int162 && + bam_v1_6_bam_alignment_optionalfields_bopt_word161 == bam_v1_6_bam_alignment_optionalfields_bopt_word162 && + bam_v1_6_bam_alignment_optionalfields_bopt_int321 == bam_v1_6_bam_alignment_optionalfields_bopt_int322 && + bam_v1_6_bam_alignment_optionalfields_bopt_word321 == bam_v1_6_bam_alignment_optionalfields_bopt_word322 && + bam_v1_6_bam_alignment_optionalfields_bopt_float1 == bam_v1_6_bam_alignment_optionalfields_bopt_float2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT int8 + word8 + int16 + word16 + int32 + word32 + float + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_int8 = " ++ + (show int8) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = " ++ + (show word8) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = " ++ + (show int16) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = " ++ + (show word16) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = " ++ + (show int32) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = " ++ + (show word32) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_float = " ++ + (show float) ++ + " }" + +-- | __c__CsSiIf of the last optional field (type B). +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 + { bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_int8_type :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_int8_count :: Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_int8_value :: Seq Int8 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag1 + bam_v1_6_bam_alignment_optionalfields_bopt_int8_type1 + bam_v1_6_bam_alignment_optionalfields_bopt_int8_count1 + bam_v1_6_bam_alignment_optionalfields_bopt_int8_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag2 + bam_v1_6_bam_alignment_optionalfields_bopt_int8_type2 + bam_v1_6_bam_alignment_optionalfields_bopt_int8_count2 + bam_v1_6_bam_alignment_optionalfields_bopt_int8_value2 = + bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag1 == bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int8_type1 == bam_v1_6_bam_alignment_optionalfields_bopt_int8_type2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int8_count1 == bam_v1_6_bam_alignment_optionalfields_bopt_int8_count2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int8_value1 == bam_v1_6_bam_alignment_optionalfields_bopt_int8_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 tag + bopttype + count + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int8_type = " ++ + (show bopttype) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int8_count = " ++ + (show count) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int8_value = " ++ + (show value) ++ + " }" + +-- | c__C__sSiIf of the last optional field (type B). +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 + { bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_word8_type :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_word8_count :: Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_word8_value :: Seq Word8 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag1 + bam_v1_6_bam_alignment_optionalfields_bopt_word8_type1 + bam_v1_6_bam_alignment_optionalfields_bopt_word8_count1 + bam_v1_6_bam_alignment_optionalfields_bopt_word8_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag2 + bam_v1_6_bam_alignment_optionalfields_bopt_word8_type2 + bam_v1_6_bam_alignment_optionalfields_bopt_word8_count2 + bam_v1_6_bam_alignment_optionalfields_bopt_word8_value2 = + bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag1 == bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word8_type1 == bam_v1_6_bam_alignment_optionalfields_bopt_word8_type2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word8_count1 == bam_v1_6_bam_alignment_optionalfields_bopt_word8_count2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word8_value1 == bam_v1_6_bam_alignment_optionalfields_bopt_word8_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 tag + bopttype + count + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word8_type = " ++ + (show bopttype) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word8_count = " ++ + (show count) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word8_value = " ++ + (show value) ++ + " }" + +-- | cC__s__SiIf of the last optional field (type B). +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 + { bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_int16_type :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_int16_count :: Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_int16_value :: Seq Int16 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag1 + bam_v1_6_bam_alignment_optionalfields_bopt_int16_type1 + bam_v1_6_bam_alignment_optionalfields_bopt_int16_count1 + bam_v1_6_bam_alignment_optionalfields_bopt_int16_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag2 + bam_v1_6_bam_alignment_optionalfields_bopt_int16_type2 + bam_v1_6_bam_alignment_optionalfields_bopt_int16_count2 + bam_v1_6_bam_alignment_optionalfields_bopt_int16_value2 = + bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag1 == bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int16_type1 == bam_v1_6_bam_alignment_optionalfields_bopt_int16_type2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int16_count1 == bam_v1_6_bam_alignment_optionalfields_bopt_int16_count2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int16_value1 == bam_v1_6_bam_alignment_optionalfields_bopt_int16_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 tag + bopttype + count + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int16_type = " ++ + (show bopttype) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int16_count = " ++ + (show count) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int16_value = " ++ + (show value) ++ + " }" + +-- | cCs__S__iIf of the last optional field (type B). +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 + { bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_word16_type :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_word16_count :: Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_word16_value :: Seq Word16 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag1 + bam_v1_6_bam_alignment_optionalfields_bopt_word16_type1 + bam_v1_6_bam_alignment_optionalfields_bopt_word16_count1 + bam_v1_6_bam_alignment_optionalfields_bopt_word16_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag2 + bam_v1_6_bam_alignment_optionalfields_bopt_word16_type2 + bam_v1_6_bam_alignment_optionalfields_bopt_word16_count2 + bam_v1_6_bam_alignment_optionalfields_bopt_word16_value2 = + bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag1 == bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word16_type1 == bam_v1_6_bam_alignment_optionalfields_bopt_word16_type2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word16_count1 == bam_v1_6_bam_alignment_optionalfields_bopt_word16_count2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word16_value1 == bam_v1_6_bam_alignment_optionalfields_bopt_word16_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 tag + bopttype + count + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word16_type = " ++ + (show bopttype) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word16_count = " ++ + (show count) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word16_value = " ++ + (show value) ++ + " }" + +-- | cCsS__i__If of the last optional field (type B). +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 + { bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_int32_type :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_int32_count :: Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_int32_value :: Seq Int32 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag1 + bam_v1_6_bam_alignment_optionalfields_bopt_int32_type1 + bam_v1_6_bam_alignment_optionalfields_bopt_int32_count1 + bam_v1_6_bam_alignment_optionalfields_bopt_int32_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag2 + bam_v1_6_bam_alignment_optionalfields_bopt_int32_type2 + bam_v1_6_bam_alignment_optionalfields_bopt_int32_count2 + bam_v1_6_bam_alignment_optionalfields_bopt_int32_value2 = + bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag1 == bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int32_type1 == bam_v1_6_bam_alignment_optionalfields_bopt_int32_type2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int32_count1 == bam_v1_6_bam_alignment_optionalfields_bopt_int32_count2 && + bam_v1_6_bam_alignment_optionalfields_bopt_int32_value1 == bam_v1_6_bam_alignment_optionalfields_bopt_int32_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 tag + bopttype + count + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int32_type = " ++ + (show bopttype) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int32_count = " ++ + (show count) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_int32_value = " ++ + (show value) ++ + " }" + +-- | cCsSi__I__f of the last optional field (type B). +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 + { bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_word32_type :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_word32_count :: Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_word32_value :: Seq Word32 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag1 + bam_v1_6_bam_alignment_optionalfields_bopt_word32_type1 + bam_v1_6_bam_alignment_optionalfields_bopt_word32_count1 + bam_v1_6_bam_alignment_optionalfields_bopt_word32_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag2 + bam_v1_6_bam_alignment_optionalfields_bopt_word32_type2 + bam_v1_6_bam_alignment_optionalfields_bopt_word32_count2 + bam_v1_6_bam_alignment_optionalfields_bopt_word32_value2 = + bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag1 == bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word32_type1 == bam_v1_6_bam_alignment_optionalfields_bopt_word32_type2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word32_count1 == bam_v1_6_bam_alignment_optionalfields_bopt_word32_count2 && + bam_v1_6_bam_alignment_optionalfields_bopt_word32_value1 == bam_v1_6_bam_alignment_optionalfields_bopt_word32_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 tag + bopttype + count + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word32_type = " ++ + (show bopttype) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word32_count = " ++ + (show count) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_word32_value = " ++ + (show value) ++ + " }" + +-- | cCsSiI__f__ of the last optional field (type B). +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float = BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float + { bam_v1_6_bam_alignment_optionalfields_bopt_float_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_float_type :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bopt_float_count :: Word32 + , bam_v1_6_bam_alignment_optionalfields_bopt_float_value :: Seq Float + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float where + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float bam_v1_6_bam_alignment_optionalfields_bopt_float_tag1 + bam_v1_6_bam_alignment_optionalfields_bopt_float_type1 + bam_v1_6_bam_alignment_optionalfields_bopt_float_count1 + bam_v1_6_bam_alignment_optionalfields_bopt_float_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float bam_v1_6_bam_alignment_optionalfields_bopt_float_tag2 + bam_v1_6_bam_alignment_optionalfields_bopt_float_type2 + bam_v1_6_bam_alignment_optionalfields_bopt_float_count2 + bam_v1_6_bam_alignment_optionalfields_bopt_float_value2 = + bam_v1_6_bam_alignment_optionalfields_bopt_float_tag1 == bam_v1_6_bam_alignment_optionalfields_bopt_float_tag2 && + bam_v1_6_bam_alignment_optionalfields_bopt_float_type1 == bam_v1_6_bam_alignment_optionalfields_bopt_float_type2 && + bam_v1_6_bam_alignment_optionalfields_bopt_float_count1 == bam_v1_6_bam_alignment_optionalfields_bopt_float_count2 && + bam_v1_6_bam_alignment_optionalfields_bopt_float_value1 == bam_v1_6_bam_alignment_optionalfields_bopt_float_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float tag + bopttype + count + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float { " ++ + "bam_v1_6_bam_alignment_optionalfields_bopt_float_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_float_type = " ++ + (show bopttype) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_float_count = " ++ + (show count) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt_float_value = " ++ + (show value) ++ + " }" + +-- | Sum type that can represent any of the +-- BAM_V1_6_BAM_Alignment_OptionalFields_BOPT types. +data BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_SumType = + BOPTInt8 + | BOPTWord8 + | BOPTInt16 + | BOPTWord16 + | BOPTInt32 + | BOPTWord32 + | BOPTFloat + | BOPTEmpty + deriving (Eq,Generic,Typeable) diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/Base.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/Base.hs @@ -0,0 +1,158 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} +{-# OPTIONS_GHC -fno-warn-name-shadowing #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.Base ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields(..) + , BAM_V1_6_BAM_Alignment_OptionalFields_SumType(..) + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.AOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigCOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigIOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigSOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallCOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallIOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallSOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.FOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.ZOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.HOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BOPT + +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_BAM_Alignment_Optional_Fields"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields = BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_AOPT -- ^ A - [!-~] - + -- Printable character. + , bam_v1_6_bam_alignment_optionalfields_smallcopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT -- c - [0-9]+ - + -- Int8 (signed). + , bam_v1_6_bam_alignment_optionalfields_bigcopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT -- C - [0-9]+ - + -- Word8 (unsigned). + , bam_v1_6_bam_alignment_optionalfields_smalliopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT -- i - [0-9]+ - + -- Int32 (signed). + , bam_v1_6_bam_alignment_optionalfields_bigiopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT -- I - [0-9]+ - + -- Word32 (unsigned). + , bam_v1_6_bam_alignment_optionalfields_smallsopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT -- s - [0-9]+ - + -- Int16 (signed). + , bam_v1_6_bam_alignment_optionalfields_bigsopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT -- S - [0-9]+ - + -- Word16 (unsigned). + , bam_v1_6_bam_alignment_optionalfields_fopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_FOPT -- ^ f - [-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? - + -- Single-precision floating number. + , bam_v1_6_bam_alignment_optionalfields_zopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT -- ^ Z - [ !-~]* - + -- Printable string, including space. + , bam_v1_6_bam_alignment_optionalfields_hopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_HOPT -- ^ H - ([0-9A-F][0-9A-F])* - + -- Byte array in the Hex format. + , bam_v1_6_bam_alignment_optionalfields_bopt :: Maybe BAM_V1_6_BAM_Alignment_OptionalFields_BOPT -- ^ B - [cCsSiIf]​(,[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)* - + -- Integer or numeric array. + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields where + BAM_V1_6_BAM_Alignment_OptionalFields bam_v1_6_bam_alignment_optionalfields_aopt1 + bam_v1_6_bam_alignment_optionalfields_smallcopt1 + bam_v1_6_bam_alignment_optionalfields_bigcopt1 + bam_v1_6_bam_alignment_optionalfields_smalliopt1 + bam_v1_6_bam_alignment_optionalfields_bigiopt1 + bam_v1_6_bam_alignment_optionalfields_smallsopt1 + bam_v1_6_bam_alignment_optionalfields_bigsopt1 + bam_v1_6_bam_alignment_optionalfields_fopt1 + bam_v1_6_bam_alignment_optionalfields_zopt1 + bam_v1_6_bam_alignment_optionalfields_hopt1 + bam_v1_6_bam_alignment_optionalfields_bopt1 == + BAM_V1_6_BAM_Alignment_OptionalFields bam_v1_6_bam_alignment_optionalfields_aopt2 + bam_v1_6_bam_alignment_optionalfields_smallcopt2 + bam_v1_6_bam_alignment_optionalfields_bigcopt2 + bam_v1_6_bam_alignment_optionalfields_smalliopt2 + bam_v1_6_bam_alignment_optionalfields_bigiopt2 + bam_v1_6_bam_alignment_optionalfields_smallsopt2 + bam_v1_6_bam_alignment_optionalfields_bigsopt2 + bam_v1_6_bam_alignment_optionalfields_fopt2 + bam_v1_6_bam_alignment_optionalfields_zopt2 + bam_v1_6_bam_alignment_optionalfields_hopt2 + bam_v1_6_bam_alignment_optionalfields_bopt2 = + bam_v1_6_bam_alignment_optionalfields_aopt1 == bam_v1_6_bam_alignment_optionalfields_aopt2 && + bam_v1_6_bam_alignment_optionalfields_smallcopt1 == bam_v1_6_bam_alignment_optionalfields_smallcopt2 && + bam_v1_6_bam_alignment_optionalfields_bigcopt1 == bam_v1_6_bam_alignment_optionalfields_bigcopt2 && + bam_v1_6_bam_alignment_optionalfields_smalliopt1 == bam_v1_6_bam_alignment_optionalfields_smalliopt2 && + bam_v1_6_bam_alignment_optionalfields_bigiopt1 == bam_v1_6_bam_alignment_optionalfields_bigiopt2 && + bam_v1_6_bam_alignment_optionalfields_smallsopt1 == bam_v1_6_bam_alignment_optionalfields_smallsopt2 && + bam_v1_6_bam_alignment_optionalfields_bigsopt1 == bam_v1_6_bam_alignment_optionalfields_bigsopt2 && + bam_v1_6_bam_alignment_optionalfields_fopt1 == bam_v1_6_bam_alignment_optionalfields_fopt2 && + bam_v1_6_bam_alignment_optionalfields_zopt1 == bam_v1_6_bam_alignment_optionalfields_zopt2 && + bam_v1_6_bam_alignment_optionalfields_hopt1 == bam_v1_6_bam_alignment_optionalfields_hopt2 && + bam_v1_6_bam_alignment_optionalfields_bopt1 == bam_v1_6_bam_alignment_optionalfields_bopt2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields where + show ( BAM_V1_6_BAM_Alignment_OptionalFields aopt + smallcopt + bigcopt + smalliopt + bigiopt + smallsopt + bigsopt + fopt + zopt + hopt + bopt + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields { " ++ + "bam_v1_6_bam_alignment_optionalfields_aopt = " ++ + (show aopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_smallcopt = " ++ + (show smallcopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_bigcopt = " ++ + (show bigcopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_smalliopt = " ++ + (show smalliopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_bigiopt = " ++ + (show bigiopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_smallsopt = " ++ + (show smallsopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_bigsopt = " ++ + (show bigsopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_fopt = " ++ + (show fopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_zopt = " ++ + (show zopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_hopt = " ++ + (show hopt) ++ + " , bam_v1_6_bam_alignment_optionalfields_bopt = " ++ + (show bopt) ++ + " }" + +-- | Sum type that can represent any of the +-- BAM_V1_6_BAM_Alignment_OptionalFields types. +data BAM_V1_6_BAM_Alignment_OptionalFields_SumType = + AOPT + | SmallCOPT + | BigCOPT + | SmallIOPT + | BigIOPT + | SmallSOPT + | BigSOPT + | FOPT + | ZOPT + | HOPT + | BOPT + | Empty + deriving (Eq,Generic,Typeable) diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigCOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigCOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigCOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigCOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigCOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT(..) + ) where + +import Data.ByteString +import Data.Word +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Alignment_OptionalFields_BigCOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT = BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT + { bam_v1_6_bam_alignment_optionalfields_bigcopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bigcopt_value :: Word8 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT bam_v1_6_bam_alignment_optionalfields_bigcopt_tag1 + bam_v1_6_bam_alignment_optionalfields_bigcopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT bam_v1_6_bam_alignment_optionalfields_bigcopt_tag2 + bam_v1_6_bam_alignment_optionalfields_bigcopt_value2 = + bam_v1_6_bam_alignment_optionalfields_bigcopt_tag1 == bam_v1_6_bam_alignment_optionalfields_bigcopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_bigcopt_value1 == bam_v1_6_bam_alignment_optionalfields_bigcopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_bigcopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bigcopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigIOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigIOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigIOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigIOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigIOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT(..) + ) where + +import Data.ByteString +import Data.Word +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT = BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT + { bam_v1_6_bam_alignment_optionalfields_bigiopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bigiopt_value :: Word32 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT bam_v1_6_bam_alignment_optionalfields_bigiopt_tag1 + bam_v1_6_bam_alignment_optionalfields_bigiopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT bam_v1_6_bam_alignment_optionalfields_bigiopt_tag2 + bam_v1_6_bam_alignment_optionalfields_bigiopt_value2 = + bam_v1_6_bam_alignment_optionalfields_bigiopt_tag1 == bam_v1_6_bam_alignment_optionalfields_bigiopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_bigiopt_value1 == bam_v1_6_bam_alignment_optionalfields_bigiopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_bigiopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bigiopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigSOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigSOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/BigSOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigSOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigSOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT(..) + ) where + +import Data.ByteString +import Data.Word +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Alignment_OptionalFields_BigSOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT = BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT + { bam_v1_6_bam_alignment_optionalfields_bigsopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_bigsopt_value :: Word16 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT bam_v1_6_bam_alignment_optionalfields_bigsopt_tag1 + bam_v1_6_bam_alignment_optionalfields_bigsopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT bam_v1_6_bam_alignment_optionalfields_bigsopt_tag2 + bam_v1_6_bam_alignment_optionalfields_bigsopt_value2 = + bam_v1_6_bam_alignment_optionalfields_bigsopt_tag1 == bam_v1_6_bam_alignment_optionalfields_bigsopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_bigsopt_value1 == bam_v1_6_bam_alignment_optionalfields_bigsopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_bigsopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_bigsopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/FOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/FOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/FOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.FOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.FOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_FOPT(..) + ) where + +import Data.ByteString +import Data.Word +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Alignment_OptionalFields_FOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_FOPT = BAM_V1_6_BAM_Alignment_OptionalFields_FOPT + { bam_v1_6_bam_alignment_optionalfields_fopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_fopt_value :: Word32 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_FOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_FOPT bam_v1_6_bam_alignment_optionalfields_fopt_tag1 + bam_v1_6_bam_alignment_optionalfields_fopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_FOPT bam_v1_6_bam_alignment_optionalfields_fopt_tag2 + bam_v1_6_bam_alignment_optionalfields_fopt_value2 = + bam_v1_6_bam_alignment_optionalfields_fopt_tag1 == bam_v1_6_bam_alignment_optionalfields_fopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_fopt_value1 == bam_v1_6_bam_alignment_optionalfields_fopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_FOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_FOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_FOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_fopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_fopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/HOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/HOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/HOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.HOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.HOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_HOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Data.Sequence +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Alignment_OptionalFields_HOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_HOPT = BAM_V1_6_BAM_Alignment_OptionalFields_HOPT + { bam_v1_6_bam_alignment_optionalfields_hopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_hopt_value :: Seq ByteString + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_HOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_HOPT bam_v1_6_bam_alignment_optionalfields_hopt_tag1 + bam_v1_6_bam_alignment_optionalfields_hopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_HOPT bam_v1_6_bam_alignment_optionalfields_hopt_tag2 + bam_v1_6_bam_alignment_optionalfields_hopt_value2 = + bam_v1_6_bam_alignment_optionalfields_hopt_tag1 == bam_v1_6_bam_alignment_optionalfields_hopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_hopt_value1 == bam_v1_6_bam_alignment_optionalfields_hopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_HOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_HOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_HOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_hopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_hopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallCOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallCOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallCOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallCOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallCOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT(..) + ) where + +import Data.ByteString +import Data.Int +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Alignment_OptionalFields_SmallCOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT = BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT + { bam_v1_6_bam_alignment_optionalfields_smallcopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_smallcopt_value :: Int8 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT bam_v1_6_bam_alignment_optionalfields_smallcopt_tag1 + bam_v1_6_bam_alignment_optionalfields_smallcopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT bam_v1_6_bam_alignment_optionalfields_smallcopt_tag2 + bam_v1_6_bam_alignment_optionalfields_smallcopt_value2 = + bam_v1_6_bam_alignment_optionalfields_smallcopt_tag1 == bam_v1_6_bam_alignment_optionalfields_smallcopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_smallcopt_value1 == bam_v1_6_bam_alignment_optionalfields_smallcopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_smallcopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_smallcopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallIOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallIOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallIOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallIOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallIOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT(..) + ) where + +import Data.ByteString +import Data.Int +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT = BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT + { bam_v1_6_bam_alignment_optionalfields_smalliopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_smalliopt_value :: Int32 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT bam_v1_6_bam_alignment_optionalfields_smalliopt_tag1 + bam_v1_6_bam_alignment_optionalfields_smalliopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT bam_v1_6_bam_alignment_optionalfields_smalliopt_tag2 + bam_v1_6_bam_alignment_optionalfields_smalliopt_value2 = + bam_v1_6_bam_alignment_optionalfields_smalliopt_tag1 == bam_v1_6_bam_alignment_optionalfields_smalliopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_smalliopt_value1 == bam_v1_6_bam_alignment_optionalfields_smalliopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_smalliopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_smalliopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallSOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallSOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/SmallSOPT.hs @@ -0,0 +1,71 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallSOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallSOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT(..) + ) where + +import Data.ByteString +import Data.Int +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Alignment_OptionalFields_SmallSOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT = BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT + { bam_v1_6_bam_alignment_optionalfields_smallsopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_smallsopt_value :: Int16 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT bam_v1_6_bam_alignment_optionalfields_smallsopt_tag1 + bam_v1_6_bam_alignment_optionalfields_smallsopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT bam_v1_6_bam_alignment_optionalfields_smallsopt_tag2 + bam_v1_6_bam_alignment_optionalfields_smallsopt_value2 = + bam_v1_6_bam_alignment_optionalfields_smallsopt_tag1 == bam_v1_6_bam_alignment_optionalfields_smallsopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_smallsopt_value1 == bam_v1_6_bam_alignment_optionalfields_smallsopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_smallsopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_smallsopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/ZOPT.hs b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/ZOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Alignment/OptionalFields/ZOPT.hs @@ -0,0 +1,72 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Alignment.OptionalFields.ZOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Alignment.OptionalFields.ZOPT ( -- * BAM version 1.6 alignment optional fields data type + BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT(..) + ) where + +import Data.ByteString +import Data.Word +import Data.Data +import Data.Sequence +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"SAM_V1_6_Alignment_OptionalFields_ZOPT"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT = BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT + { bam_v1_6_bam_alignment_optionalfields_zopt_tag :: ByteString + , bam_v1_6_bam_alignment_optionalfields_zopt_value :: Seq Word8 + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT where + BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT bam_v1_6_bam_alignment_optionalfields_zopt_tag1 + bam_v1_6_bam_alignment_optionalfields_zopt_value1 == + BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT bam_v1_6_bam_alignment_optionalfields_zopt_tag2 + bam_v1_6_bam_alignment_optionalfields_zopt_value2 = + bam_v1_6_bam_alignment_optionalfields_zopt_tag1 == bam_v1_6_bam_alignment_optionalfields_zopt_tag2 && + bam_v1_6_bam_alignment_optionalfields_zopt_value1 == bam_v1_6_bam_alignment_optionalfields_zopt_value2 + +instance Show BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT where + show (BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT tag + value + ) = + "BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT { " ++ + "bam_v1_6_bam_alignment_optionalfields_zopt_tag = " ++ + (show tag) ++ + " , bam_v1_6_bam_alignment_optionalfields_zopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/BAMAlignments.hs b/src/Data/BAM/Version1_6/BAM/BAMAlignments.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/BAMAlignments.hs @@ -0,0 +1,49 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.BAMAlignments +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.BAMAlignments ( -- * BAM_V1_6_BAM_BAMAlignment version 1.6 data type + BAM_V1_6_BAM_BAMAlignments(..) + ) where + +import Data.BAM.Version1_6.BAM.Alignment + +import Data.Data +import Data.Sequence +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6_BAM_BAMAlignments"@ (BAM version 1.6) data type. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +newtype BAM_V1_6_BAM_BAMAlignments = BAM_V1_6_BAM_BAMAlignments + { bam_v1_6_bam_bamalignments_alignments :: Seq BAM_V1_6_BAM_Alignment -- ^ List of alignments. + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_BAMAlignments where + BAM_V1_6_BAM_BAMAlignments bam_v1_6_bamalignments_alignments1 == + BAM_V1_6_BAM_BAMAlignments bam_v1_6_bamalignments_alignments2 = + bam_v1_6_bamalignments_alignments1 == bam_v1_6_bamalignments_alignments2 + +instance Show BAM_V1_6_BAM_BAMAlignments where + show (BAM_V1_6_BAM_BAMAlignments alignments + ) = + "BAM_V1_6_BAM_BAMAlignments { " ++ + "bam_v1_6_bamalignments_alignments = " ++ + (show alignments) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/BAMHeader.hs b/src/Data/BAM/Version1_6/BAM/BAMHeader.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/BAMHeader.hs @@ -0,0 +1,81 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.BAMHeader +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.BAMHeader ( -- * BAM_V1_6_BAM_BAMHeader version 1.6 data type + BAM_V1_6_BAM_BAMHeader(..) + ) where + +import Data.BAM.Version1_6.BAM.ReferenceInformation + +import Data.ByteString (ByteString) +import Data.Data +import Data.Sequence +import Data.Word +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6_BAM_BAMHeader"@ (BAM version 1.6) data type. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_BAMHeader = BAM_V1_6_BAM_BAMHeader + { bam_v1_6_bam_bamheader_magic :: ByteString -- ^ BAM magic string (magic). + -- This should be BAM\1. + , bam_v1_6_bam_bamheader_l_text :: Word32 -- ^ Length of the header text, including any NUL padding (l_text). + , bam_v1_6_bam_bamheader_text :: ByteString -- ^ Plain header text in SAM; + -- not necessarily NUL-terminated. + , bam_v1_6_bam_bamheader_n_ref :: Word32 -- ^ Number of reference sequences (n_ref). + , bam_v1_6_bam_bamheader_reference_information :: Seq BAM_V1_6_BAM_Reference_Information -- ^ List of reference information (n = bam_v1_6_bam_n_ref). + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_BAMHeader where + BAM_V1_6_BAM_BAMHeader bam_v1_6_bam_bamheader_magic1 + bam_v1_6_bam_bamheader_l_text1 + bam_v1_6_bam_bamheader_text1 + bam_v1_6_bam_bamheader_n_ref1 + bam_v1_6_bam_bamheader_reference_information1 == + BAM_V1_6_BAM_BAMHeader bam_v1_6_bam_bamheader_magic2 + bam_v1_6_bam_bamheader_l_text2 + bam_v1_6_bam_bamheader_text2 + bam_v1_6_bam_bamheader_n_ref2 + bam_v1_6_bam_bamheader_reference_information2 = + bam_v1_6_bam_bamheader_magic1 == bam_v1_6_bam_bamheader_magic2 && + bam_v1_6_bam_bamheader_l_text1 == bam_v1_6_bam_bamheader_l_text2 && + bam_v1_6_bam_bamheader_text1 == bam_v1_6_bam_bamheader_text2 && + bam_v1_6_bam_bamheader_n_ref1 == bam_v1_6_bam_bamheader_n_ref2 && + bam_v1_6_bam_bamheader_reference_information1 == bam_v1_6_bam_bamheader_reference_information2 + +instance Show BAM_V1_6_BAM_BAMHeader where + show (BAM_V1_6_BAM_BAMHeader magic + l_text + text + n_ref + reference_information + ) = + "BAM_V1_6_BAM_BAMHeader { " ++ + "bam_v1_6_bam_bamheader_magic = " ++ + (show magic) ++ + " , bam_v1_6_bam_bamheader_l_text = " ++ + (show l_text) ++ + " , bam_v1_6_bam_bamheader_text = " ++ + (show text) ++ + " , bam_v1_6_bam_bamheader_n_ref = " ++ + (show n_ref) ++ + " , bam_v1_6_bam_bamheader_reference_information = " ++ + (show reference_information) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Header.hs b/src/Data/BAM/Version1_6/BAM/Header.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Header.hs @@ -0,0 +1,46 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Header +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Header ( -- * BAM version 1.6 header section data type (RE-EXPORT) + module Data.BAM.Version1_6.BAM.Header.CO, + module Data.BAM.Version1_6.BAM.Header.HD, + module Data.BAM.Version1_6.BAM.Header.PG, + module Data.BAM.Version1_6.BAM.Header.RG, + module Data.BAM.Version1_6.BAM.Header.SQ + ) where + +-- | Re-exports. +import Data.BAM.Version1_6.BAM.Header.CO +import Data.BAM.Version1_6.BAM.Header.HD +import Data.BAM.Version1_6.BAM.Header.PG +import Data.BAM.Version1_6.BAM.Header.RG +import Data.BAM.Version1_6.BAM.Header.SQ diff --git a/src/Data/BAM/Version1_6/BAM/Header/CO.hs b/src/Data/BAM/Version1_6/BAM/Header/CO.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Header/CO.hs @@ -0,0 +1,45 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Header.CO +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Header.CO ( -- * BAM version 1.6 One-line text comment data type + BAM_V1_6_One_Line_Comment(..) + ) where + +import Data.ByteString +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"SAM_V1_6_One_Line_Comment"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +newtype BAM_V1_6_One_Line_Comment = BAM_V1_6_One_Line_Comment { bam_v1_6_one_line_comment_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_One_Line_Comment where + BAM_V1_6_One_Line_Comment bam_v1_6_one_line_comment_value1 == + BAM_V1_6_One_Line_Comment bam_v1_6_one_line_comment_value2 = + bam_v1_6_one_line_comment_value1 == bam_v1_6_one_line_comment_value2 + +instance Show BAM_V1_6_One_Line_Comment where + show (BAM_V1_6_One_Line_Comment value) = "BAM_V1_6_One_Line_Comment { " ++ + "bam_v1_6_one_line_comment_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Header/HD.hs b/src/Data/BAM/Version1_6/BAM/Header/HD.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Header/HD.hs @@ -0,0 +1,137 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Header.HD +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Header.HD ( -- * BAM version 1.6 File-level metadata data type + BAM_V1_6_File_Level_Metadata(..), + -- * BAM version 1.6 File-Level Metadata data types + BAM_V1_6_File_Level_Metadata_Format_Version(..), + BAM_V1_6_File_Level_Metadata_Sorting_Order(..), + BAM_V1_6_File_Level_Metadata_Alignment_Grouping(..), + BAM_V1_6_File_Level_Metadata_SubSorting_Order(..) + ) where + +import Data.ByteString +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_File_Level_Metadata"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_File_Level_Metadata = BAM_V1_6_File_Level_Metadata { bam_v1_6_file_level_metadata_format_version :: BAM_V1_6_File_Level_Metadata_Format_Version + , bam_v1_6_file_level_metadata_sorting_order :: Maybe BAM_V1_6_File_Level_Metadata_Sorting_Order + , bam_v1_6_file_level_metadata_alignment_grouping :: Maybe BAM_V1_6_File_Level_Metadata_Alignment_Grouping + , bam_v1_6_file_level_metadata_subsorting_order :: Maybe BAM_V1_6_File_Level_Metadata_SubSorting_Order + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_File_Level_Metadata where + BAM_V1_6_File_Level_Metadata bam_v1_6_file_level_metadata_format_version1 + bam_v1_6_file_level_metadata_sorting_order1 + bam_v1_6_file_level_metadata_alignment_grouping1 + bam_v1_6_file_level_metadata_subsorting_order1 == + BAM_V1_6_File_Level_Metadata bam_v1_6_file_level_metadata_format_version2 + bam_v1_6_file_level_metadata_sorting_order2 + bam_v1_6_file_level_metadata_alignment_grouping2 + bam_v1_6_file_level_metadata_subsorting_order2 = + bam_v1_6_file_level_metadata_format_version1 == bam_v1_6_file_level_metadata_format_version2 && + bam_v1_6_file_level_metadata_sorting_order1 == bam_v1_6_file_level_metadata_sorting_order2 && + bam_v1_6_file_level_metadata_alignment_grouping1 == bam_v1_6_file_level_metadata_alignment_grouping2 && + bam_v1_6_file_level_metadata_subsorting_order1 == bam_v1_6_file_level_metadata_subsorting_order2 + +instance Show BAM_V1_6_File_Level_Metadata where + show (BAM_V1_6_File_Level_Metadata version sorting_order alignment_grouping subsorting_order) = + "BAM_V1_6_File_Level_Metadata { " ++ + "bam_v1_6_file_level_metadata_format_version = " ++ + (show version) ++ + " , bam_v1_6_file_level_metadata_sorting_order = " ++ + (show sorting_order) ++ + " , bam_v1_6_file_level_metadata_alignment_grouping = " ++ + (show alignment_grouping) ++ + " , bam_v1_6_file_level_metadata_subsorting_order = " ++ + (show subsorting_order) ++ + " }" + +-- | VN tag for @"BAM_V1_6_File_Level_Metadata"@. +newtype BAM_V1_6_File_Level_Metadata_Format_Version = BAM_V1_6_File_Level_Metadata_Format_Version { bam_v1_6_file_level_metadata_format_version_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_File_Level_Metadata_Format_Version where + BAM_V1_6_File_Level_Metadata_Format_Version bam_v1_6_file_level_metadata_format_version_value1 == + BAM_V1_6_File_Level_Metadata_Format_Version bam_v1_6_file_level_metadata_format_version_value2 = + bam_v1_6_file_level_metadata_format_version_value1 == bam_v1_6_file_level_metadata_format_version_value2 + +instance Show BAM_V1_6_File_Level_Metadata_Format_Version where + show (BAM_V1_6_File_Level_Metadata_Format_Version value) = + "BAM_V1_6_File_Level_Metadata_Format_Version { " ++ + "bam_v1_6_file_level_metadata_format_version_value = " ++ + (show value) ++ + " }" + +-- | SO tag for @"BAM_V1_6_File_Level_Metadata"@. +newtype BAM_V1_6_File_Level_Metadata_Sorting_Order = BAM_V1_6_File_Level_Metadata_Sorting_Order { bam_v1_6_file_level_metadata_sorting_order_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_File_Level_Metadata_Sorting_Order where + BAM_V1_6_File_Level_Metadata_Sorting_Order bam_v1_6_file_level_metadata_sorting_order_value1 == + BAM_V1_6_File_Level_Metadata_Sorting_Order bam_v1_6_file_level_metadata_sorting_order_value2 = + bam_v1_6_file_level_metadata_sorting_order_value1 == bam_v1_6_file_level_metadata_sorting_order_value2 + +instance Show BAM_V1_6_File_Level_Metadata_Sorting_Order where + show (BAM_V1_6_File_Level_Metadata_Sorting_Order value) = + "BAM_V1_6_File_Level_Metadata_Sorting_Order { " ++ + "bam_v1_6_file_level_metadata_sorting_order_value = " ++ + (show value) ++ + " }" + +-- | GO tag for @"BAM_V1_6_File_Level_Metadata"@. +newtype BAM_V1_6_File_Level_Metadata_Alignment_Grouping = BAM_V1_6_File_Level_Metadata_Alignment_Grouping { bam_v1_6_file_level_metadata_alignment_grouping_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_File_Level_Metadata_Alignment_Grouping where + BAM_V1_6_File_Level_Metadata_Alignment_Grouping bam_v1_6_file_level_metadata_alignment_grouping_value1 == + BAM_V1_6_File_Level_Metadata_Alignment_Grouping bam_v1_6_file_level_metadata_alignment_grouping_value2 = + bam_v1_6_file_level_metadata_alignment_grouping_value1 == bam_v1_6_file_level_metadata_alignment_grouping_value2 + +instance Show BAM_V1_6_File_Level_Metadata_Alignment_Grouping where + show (BAM_V1_6_File_Level_Metadata_Alignment_Grouping value) = + "BAM_V1_6_File_Level_Metadata_Alignment_Grouping { " ++ + "bam_v1_6_file_level_metadata_alignment_grouping_value = " ++ + (show value) ++ + " }" + +-- | SS tag for @"BAM_V1_6_File_Level_Metadata"@. +newtype BAM_V1_6_File_Level_Metadata_SubSorting_Order = BAM_V1_6_File_Level_Metadata_SubSorting_Order { bam_v1_6_file_level_metadata_subsorting_order_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_File_Level_Metadata_SubSorting_Order where + BAM_V1_6_File_Level_Metadata_SubSorting_Order bam_v1_6_file_level_metadata_subsorting_order_value1 == + BAM_V1_6_File_Level_Metadata_SubSorting_Order bam_v1_6_file_level_metadata_subsorting_order_value2 = + bam_v1_6_file_level_metadata_subsorting_order_value1 == bam_v1_6_file_level_metadata_subsorting_order_value2 + +instance Show BAM_V1_6_File_Level_Metadata_SubSorting_Order where + show (BAM_V1_6_File_Level_Metadata_SubSorting_Order value) = + "BAM_V1_6_File_Level_Metadata_SubSorting_Order { " ++ + "bam_v1_6_file_level_metadata_subsorting_order_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Header/PG.hs b/src/Data/BAM/Version1_6/BAM/Header/PG.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Header/PG.hs @@ -0,0 +1,185 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Header.PG +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Header.PG ( -- * BAM version 1.6 program data type + BAM_V1_6_Program(..), + -- * BAM version 1.6 program data types + BAM_V1_6_Program_Record_Identifier(..), + BAM_V1_6_Program_Name(..), + BAM_V1_6_Program_Command_Line(..), + BAM_V1_6_Program_Previous_PG_ID(..), + BAM_V1_6_Program_Description(..), + BAM_V1_6_Program_Version(..) + ) where + +import Data.ByteString +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Program"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_Program = BAM_V1_6_Program { bam_v1_6_program_record_identifier :: BAM_V1_6_Program_Record_Identifier + , bam_v1_6_program_name :: Maybe BAM_V1_6_Program_Name + , bam_v1_6_program_command_line :: Maybe BAM_V1_6_Program_Command_Line + , bam_v1_6_program_previous_pg_id :: Maybe BAM_V1_6_Program_Previous_PG_ID + , bam_v1_6_program_description :: Maybe BAM_V1_6_Program_Description + , bam_v1_6_program_version :: Maybe BAM_V1_6_Program_Version + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Program where + BAM_V1_6_Program bam_v1_6_program_record_identifier1 + bam_v1_6_program_name1 + bam_v1_6_program_command_line1 + bam_v1_6_program_previous_pg_id1 + bam_v1_6_program_description1 + bam_v1_6_program_version1 == + BAM_V1_6_Program bam_v1_6_program_record_identifier2 + bam_v1_6_program_name2 + bam_v1_6_program_command_line2 + bam_v1_6_program_previous_pg_id2 + bam_v1_6_program_description2 + bam_v1_6_program_version2 = + bam_v1_6_program_record_identifier1 == bam_v1_6_program_record_identifier2 && + bam_v1_6_program_name1 == bam_v1_6_program_name2 && + bam_v1_6_program_command_line1 == bam_v1_6_program_command_line2 && + bam_v1_6_program_previous_pg_id1 == bam_v1_6_program_previous_pg_id2 && + bam_v1_6_program_description1 == bam_v1_6_program_description2 && + bam_v1_6_program_version1 == bam_v1_6_program_version2 + +instance Show BAM_V1_6_Program where + show (BAM_V1_6_Program record_identifier name command_line previous_pg_id description version) = + "BAM_V1_6_Program { " ++ + "rbam_v1_6_program_record_identifier = " ++ + (show record_identifier) ++ + " , bam_v1_6_program_name = " ++ + (show name) ++ + " , bam_v1_6_program_command_line = " ++ + (show command_line) ++ + " , bam_v1_6_program_previous_pg_id = " ++ + (show previous_pg_id) ++ + " , bam_v1_6_program_description = " ++ + (show description) ++ + " , bam_v1_6_program_version = " ++ + (show version) ++ + " }" + +-- | ID tag for @"BAM_V1_6_Program"@. +newtype BAM_V1_6_Program_Record_Identifier = BAM_V1_6_Program_Record_Identifier { bam_v1_6_program_record_identifier_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Program_Record_Identifier where + BAM_V1_6_Program_Record_Identifier bam_v1_6_program_record_identifier_value1 == + BAM_V1_6_Program_Record_Identifier bam_v1_6_program_record_identifier_value2 = + bam_v1_6_program_record_identifier_value1 == bam_v1_6_program_record_identifier_value2 + +instance Show BAM_V1_6_Program_Record_Identifier where + show (BAM_V1_6_Program_Record_Identifier value) = + "BAM_V1_6_Program_Record_Identifier { " ++ + "bam_v1_6_program_record_identifier_value = " ++ + (show value) ++ + " }" + +-- | PN tag for @"BAM_V1_6_Program"@. +newtype BAM_V1_6_Program_Name = BAM_V1_6_Program_Name { bam_v1_6_program_name_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Program_Name where + BAM_V1_6_Program_Name bam_v1_6_program_name_value1 == + BAM_V1_6_Program_Name bam_v1_6_program_name_value2 = + bam_v1_6_program_name_value1 == bam_v1_6_program_name_value2 + +instance Show BAM_V1_6_Program_Name where + show (BAM_V1_6_Program_Name value) = + "BAM_V1_6_Program_Name { " ++ + "bam_v1_6_program_name_value = " ++ + (show value) ++ + " }" + +-- | CL tag for @"BAM_V1_6_Program"@. +newtype BAM_V1_6_Program_Command_Line = BAM_V1_6_Program_Command_Line { bam_v1_6_program_command_line_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Program_Command_Line where + BAM_V1_6_Program_Command_Line bam_v1_6_program_command_line_value1 == + BAM_V1_6_Program_Command_Line bam_v1_6_program_command_line_value2 = + bam_v1_6_program_command_line_value1 == bam_v1_6_program_command_line_value2 + +instance Show BAM_V1_6_Program_Command_Line where + show (BAM_V1_6_Program_Command_Line value) = + "BAM_V1_6_Program_Command_Line { " ++ + "bam_v1_6_program_command_line_value = " ++ + (show value) ++ + " }" + +-- | PP tag for @"BAM_V1_6_Program"@. +newtype BAM_V1_6_Program_Previous_PG_ID = BAM_V1_6_Program_Previous_PG_ID { bam_v1_6_program_previous_pg_id_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Program_Previous_PG_ID where + BAM_V1_6_Program_Previous_PG_ID bam_v1_6_program_previous_pg_id_value1 == + BAM_V1_6_Program_Previous_PG_ID bam_v1_6_program_previous_pg_id_value2 = + bam_v1_6_program_previous_pg_id_value1 == bam_v1_6_program_previous_pg_id_value2 + +instance Show BAM_V1_6_Program_Previous_PG_ID where + show (BAM_V1_6_Program_Previous_PG_ID value) = + "BAM_V1_6_Program_Previous_PG_ID { " ++ + "bam_v1_6_program_previous_pg_id_value = " ++ + (show value) ++ + " }" + +-- | DS tag for @"BAM_V1_6_Program"@. +newtype BAM_V1_6_Program_Description = BAM_V1_6_Program_Description { bam_v1_6_program_description_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Program_Description where + BAM_V1_6_Program_Description bam_v1_6_program_description_value1 == + BAM_V1_6_Program_Description bam_v1_6_program_description_value2 = + bam_v1_6_program_description_value1 == bam_v1_6_program_description_value2 + +instance Show BAM_V1_6_Program_Description where + show (BAM_V1_6_Program_Description value) = + "BAM_V1_6_Program_Description { " ++ + "bam_v1_6_program_description_value = " ++ + (show value) ++ + " }" + +-- | VN tag for @"BAM_V1_6_Program"@. +newtype BAM_V1_6_Program_Version = BAM_V1_6_Program_Version { bam_v1_6_program_version_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Program_Version where + BAM_V1_6_Program_Version bam_v1_6_program_version_value1 == + BAM_V1_6_Program_Version bam_v1_6_program_version_value2 = + bam_v1_6_program_version_value1 == bam_v1_6_program_version_value2 + +instance Show BAM_V1_6_Program_Version where + show (BAM_V1_6_Program_Version value) = + "BAM_V1_6_Program_Version { " ++ + "bam_v1_6_program_version_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Header/RG.hs b/src/Data/BAM/Version1_6/BAM/Header/RG.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Header/RG.hs @@ -0,0 +1,391 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Header.RG +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Header.RG ( -- * BAM version 1.6 Read group data type + BAM_V1_6_Read_Group(..), + -- * BAM version 1.6 Read group data types + BAM_V1_6_Read_Group_Identifier(..), + BAM_V1_6_Read_Group_Barcode_Sequence(..), + BAM_V1_6_Read_Group_Sequencing_Center(..), + BAM_V1_6_Read_Group_Description(..), + BAM_V1_6_Read_Group_Run_Date(..), + BAM_V1_6_Read_Group_Flow_Order(..), + BAM_V1_6_Read_Group_Key_Sequence(..), + BAM_V1_6_Read_Group_Library(..), + BAM_V1_6_Read_Group_Programs(..), + BAM_V1_6_Read_Group_Predicted_Median_Insert_Size(..), + BAM_V1_6_Read_Group_Platform(..), + BAM_V1_6_Read_Group_Platform_Model(..), + BAM_V1_6_Read_Group_Platform_Unit(..), + BAM_V1_6_Read_Group_Sample(..) + ) where + +import Data.ByteString +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Read_Group"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_Read_Group = BAM_V1_6_Read_Group { bam_v1_6_read_group_identifier :: BAM_V1_6_Read_Group_Identifier + , bam_v1_6_read_group_barcode_sequence :: Maybe BAM_V1_6_Read_Group_Barcode_Sequence + , bam_v1_6_read_group_sequencing_center :: Maybe BAM_V1_6_Read_Group_Sequencing_Center + , bam_v1_6_read_group_description :: Maybe BAM_V1_6_Read_Group_Description + , bam_v1_6_read_group_run_date :: Maybe BAM_V1_6_Read_Group_Run_Date + , bam_v1_6_read_group_flow_order :: Maybe BAM_V1_6_Read_Group_Flow_Order + , bam_v1_6_read_group_key_sequence :: Maybe BAM_V1_6_Read_Group_Key_Sequence + , bam_v1_6_read_group_library :: Maybe BAM_V1_6_Read_Group_Library + , bam_v1_6_read_group_programs :: Maybe BAM_V1_6_Read_Group_Programs + , bam_v1_6_read_group_predicted_median_insert_size :: Maybe BAM_V1_6_Read_Group_Predicted_Median_Insert_Size + , bam_v1_6_read_group_platform :: Maybe BAM_V1_6_Read_Group_Platform + , bam_v1_6_read_group_platform_model :: Maybe BAM_V1_6_Read_Group_Platform_Model + , bam_v1_6_read_group_platform_unit :: Maybe BAM_V1_6_Read_Group_Platform_Unit + , bam_v1_6_read_group_sample :: Maybe BAM_V1_6_Read_Group_Sample + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group where + BAM_V1_6_Read_Group bam_v1_6_read_group_identifier1 + bam_v1_6_read_group_barcode_sequence1 + bam_v1_6_read_group_sequencing_center1 + bam_v1_6_read_group_description1 + bam_v1_6_read_group_run_date1 + bam_v1_6_read_group_flow_order1 + bam_v1_6_read_group_key_sequence1 + bam_v1_6_read_group_library1 + bam_v1_6_read_group_programs1 + bam_v1_6_read_group_predicted_median_insert_size1 + bam_v1_6_read_group_platform1 + bam_v1_6_read_group_platform_model1 + bam_v1_6_read_group_platform_unit1 + bam_v1_6_read_group_sample1 == + BAM_V1_6_Read_Group bam_v1_6_read_group_identifier2 + bam_v1_6_read_group_barcode_sequence2 + bam_v1_6_read_group_sequencing_center2 + bam_v1_6_read_group_description2 + bam_v1_6_read_group_run_date2 + bam_v1_6_read_group_flow_order2 + bam_v1_6_read_group_key_sequence2 + bam_v1_6_read_group_library2 + bam_v1_6_read_group_programs2 + bam_v1_6_read_group_predicted_median_insert_size2 + bam_v1_6_read_group_platform2 + bam_v1_6_read_group_platform_model2 + bam_v1_6_read_group_platform_unit2 + bam_v1_6_read_group_sample2 = + bam_v1_6_read_group_identifier1 == bam_v1_6_read_group_identifier2 && + bam_v1_6_read_group_barcode_sequence1 == bam_v1_6_read_group_barcode_sequence2 && + bam_v1_6_read_group_sequencing_center1 == bam_v1_6_read_group_sequencing_center2 && + bam_v1_6_read_group_description1 == bam_v1_6_read_group_description2 && + bam_v1_6_read_group_run_date1 == bam_v1_6_read_group_run_date2 && + bam_v1_6_read_group_flow_order1 == bam_v1_6_read_group_flow_order2 && + bam_v1_6_read_group_key_sequence1 == bam_v1_6_read_group_key_sequence2 && + bam_v1_6_read_group_library1 == bam_v1_6_read_group_library2 && + bam_v1_6_read_group_programs1 == bam_v1_6_read_group_programs2 && + bam_v1_6_read_group_predicted_median_insert_size1 == bam_v1_6_read_group_predicted_median_insert_size2 && + bam_v1_6_read_group_platform1 == bam_v1_6_read_group_platform2 && + bam_v1_6_read_group_platform_model1 == bam_v1_6_read_group_platform_model2 && + bam_v1_6_read_group_platform_unit1 == bam_v1_6_read_group_platform_unit2 && + bam_v1_6_read_group_sample1 == bam_v1_6_read_group_sample2 + +instance Show BAM_V1_6_Read_Group where + show (BAM_V1_6_Read_Group group_identifier + barcode_sequence + sequencing_center + description + run_date + flow_order + key_sequence + library + programs + predicted_median_insert_size + platform + platform_model + platform_unit + sample + ) = + "BAM_V1_6_Read_Group { " ++ + "bam_v1_6_read_group_identifier = " ++ + (show group_identifier) ++ + " , bam_v1_6_read_group_barcode_sequence = " ++ + (show barcode_sequence) ++ + " , bam_v1_6_read_group_sequencing_center = " ++ + (show sequencing_center) ++ + " , bam_v1_6_read_group_description = " ++ + (show description) ++ + " , bam_v1_6_read_group_run_date = " ++ + (show run_date) ++ + " , bam_v1_6_read_group_flow_order = " ++ + (show flow_order) ++ + " , bam_v1_6_read_group_key_sequence = " ++ + (show key_sequence) ++ + " , bam_v1_6_read_group_library = " ++ + (show library) ++ + " , bam_v1_6_read_group_programs = " ++ + (show programs) ++ + " , bam_v1_6_read_group_show_predicted_median_insert_size = " ++ + (show predicted_median_insert_size) ++ + " , bam_v1_6_read_group_platform = " ++ + (show platform) ++ + " , bam_v1_6_read_group_platform_model = " ++ + (show platform_model) ++ + " , bam_v1_6_read_group_platform_unit = " ++ + (show platform_unit) ++ + " , bam_v1_6_read_group_sample = " ++ + (show sample) ++ + " }" + +-- | ID tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Identifier = BAM_V1_6_Read_Group_Identifier { bam_v1_6_read_group_identifier_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Identifier where + BAM_V1_6_Read_Group_Identifier bam_v1_6_read_group_identifier_value1 == + BAM_V1_6_Read_Group_Identifier bam_v1_6_read_group_identifier_value2 = + bam_v1_6_read_group_identifier_value1 == bam_v1_6_read_group_identifier_value2 + +instance Show BAM_V1_6_Read_Group_Identifier where + show (BAM_V1_6_Read_Group_Identifier value) = + "BAM_V1_6_Read_Group_Identifier { " ++ + "bam_v1_6_read_group_identifier_value = " ++ + (show value) ++ + " }" + +-- | BC tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Barcode_Sequence = BAM_V1_6_Read_Group_Barcode_Sequence { bam_v1_6_read_group_barcode_sequence_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Barcode_Sequence where + BAM_V1_6_Read_Group_Barcode_Sequence bam_v1_6_read_group_barcode_sequence_value1 == + BAM_V1_6_Read_Group_Barcode_Sequence bam_v1_6_read_group_barcode_sequence_value2 = + bam_v1_6_read_group_barcode_sequence_value1 == bam_v1_6_read_group_barcode_sequence_value2 + +instance Show BAM_V1_6_Read_Group_Barcode_Sequence where + show (BAM_V1_6_Read_Group_Barcode_Sequence value) = + "BAM_V1_6_Read_Group_Barcode_Sequence { " ++ + "bam_v1_6_read_group_barcode_sequence_value = " ++ + (show value) ++ + " }" + +-- | CN tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Sequencing_Center = BAM_V1_6_Read_Group_Sequencing_Center { bam_v1_6_read_group_sequencing_center_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Sequencing_Center where + BAM_V1_6_Read_Group_Sequencing_Center bam_v1_6_read_group_sequencing_center_value1 == + BAM_V1_6_Read_Group_Sequencing_Center bam_v1_6_read_group_sequencing_center_value2 = + bam_v1_6_read_group_sequencing_center_value1 == bam_v1_6_read_group_sequencing_center_value2 + +instance Show BAM_V1_6_Read_Group_Sequencing_Center where + show (BAM_V1_6_Read_Group_Sequencing_Center value) = + "BAM_V1_6_Read_Group_Sequencing_Center { " ++ + "bam_v1_6_read_group_sequencing_center_value = " ++ + (show value) ++ + " }" + +-- | DS tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Description = BAM_V1_6_Read_Group_Description { bam_v1_6_read_group_description_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Description where + BAM_V1_6_Read_Group_Description bam_v1_6_read_group_description_value1 == + BAM_V1_6_Read_Group_Description bam_v1_6_read_group_description_value2 = + bam_v1_6_read_group_description_value1 == bam_v1_6_read_group_description_value2 + +instance Show BAM_V1_6_Read_Group_Description where + show (BAM_V1_6_Read_Group_Description value) = + "BAM_V1_6_Read_Group_Description { " ++ + "bam_v1_6_read_group_description_value = " ++ + (show value) ++ + " }" + +-- | DT tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Run_Date = BAM_V1_6_Read_Group_Run_Date { bam_v1_6_read_group_run_date_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Run_Date where + BAM_V1_6_Read_Group_Run_Date bam_v1_6_read_group_run_date_value1 == + BAM_V1_6_Read_Group_Run_Date bam_v1_6_read_group_run_date_value2 = + bam_v1_6_read_group_run_date_value1 == bam_v1_6_read_group_run_date_value2 + +instance Show BAM_V1_6_Read_Group_Run_Date where + show (BAM_V1_6_Read_Group_Run_Date value) = + "BAM_V1_6_Read_Group_Run_Date { " ++ + "bam_v1_6_read_group_run_date_value = " ++ + (show value) ++ + " }" + +-- | FO tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Flow_Order = BAM_V1_6_Read_Group_Flow_Order { bam_v1_6_read_group_flow_order_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Flow_Order where + BAM_V1_6_Read_Group_Flow_Order bam_v1_6_one_line_comment_value1 == + BAM_V1_6_Read_Group_Flow_Order bam_v1_6_read_group_flow_order_value2 = + bam_v1_6_one_line_comment_value1 == bam_v1_6_read_group_flow_order_value2 + +instance Show BAM_V1_6_Read_Group_Flow_Order where + show (BAM_V1_6_Read_Group_Flow_Order value) = + "BAM_V1_6_Read_Group_Flow_Order { " ++ + "bam_v1_6_read_group_flow_order_value = " ++ + (show value) ++ + " }" + +-- | KS tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Key_Sequence = BAM_V1_6_Read_Group_Key_Sequence { bam_v1_6_read_group_key_sequence_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Key_Sequence where + BAM_V1_6_Read_Group_Key_Sequence bam_v1_6_read_group_key_sequence_value1 == + BAM_V1_6_Read_Group_Key_Sequence bam_v1_6_read_group_key_sequence_value2 = + bam_v1_6_read_group_key_sequence_value1 == bam_v1_6_read_group_key_sequence_value2 + +instance Show BAM_V1_6_Read_Group_Key_Sequence where + show (BAM_V1_6_Read_Group_Key_Sequence value) = + "BAM_V1_6_Read_Group_Key_Sequence { " ++ + "bam_v1_6_read_group_key_sequence_value = " ++ + (show value) ++ + " }" + +-- | LB tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Library = BAM_V1_6_Read_Group_Library { bam_v1_6_read_group_library_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Library where + BAM_V1_6_Read_Group_Library bam_v1_6_read_group_library_value1 == + BAM_V1_6_Read_Group_Library bam_v1_6_read_group_library_value2 = + bam_v1_6_read_group_library_value1 == bam_v1_6_read_group_library_value2 + +instance Show BAM_V1_6_Read_Group_Library where + show (BAM_V1_6_Read_Group_Library value) = + "BAM_V1_6_Read_Group_Library { " ++ + "bam_v1_6_read_group_library_value = " ++ + (show value) ++ + " }" + +-- | PG tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Programs = BAM_V1_6_Read_Group_Programs { bam_v1_6_read_group_programs_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Programs where + BAM_V1_6_Read_Group_Programs bam_v1_6_read_group_programs_value1 == + BAM_V1_6_Read_Group_Programs bam_v1_6_read_group_programs_value2 = + bam_v1_6_read_group_programs_value1 == bam_v1_6_read_group_programs_value2 + +instance Show BAM_V1_6_Read_Group_Programs where + show (BAM_V1_6_Read_Group_Programs value) = + "BAM_V1_6_Read_Group_Programs { " ++ + "bam_v1_6_read_group_programs_value = " ++ + (show value) ++ + " }" + +-- | PI tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Predicted_Median_Insert_Size = BAM_V1_6_Read_Group_Predicted_Median_Insert_Size { bam_v1_6_read_group_predicted_median_insert_size_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Predicted_Median_Insert_Size where + BAM_V1_6_Read_Group_Predicted_Median_Insert_Size bam_v1_6_read_group_predicted_median_insert_size_value1 == + BAM_V1_6_Read_Group_Predicted_Median_Insert_Size bam_v1_6_read_group_predicted_median_insert_size_value2 = + bam_v1_6_read_group_predicted_median_insert_size_value1 == bam_v1_6_read_group_predicted_median_insert_size_value2 + +instance Show BAM_V1_6_Read_Group_Predicted_Median_Insert_Size where + show (BAM_V1_6_Read_Group_Predicted_Median_Insert_Size value) = + "BAM_V1_6_Read_Group_Predicted_Median_Insert_Size { " ++ + "bam_v1_6_read_group_predicted_median_insert_size_value = " ++ + (show value) ++ + " }" + +-- | PL tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Platform = BAM_V1_6_Read_Group_Platform { bam_v1_6_read_group_platform_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Platform where + BAM_V1_6_Read_Group_Platform bam_v1_6_read_group_platform_value1 == + BAM_V1_6_Read_Group_Platform bam_v1_6_read_group_platform_value2 = + bam_v1_6_read_group_platform_value1 == bam_v1_6_read_group_platform_value2 + +instance Show BAM_V1_6_Read_Group_Platform where + show (BAM_V1_6_Read_Group_Platform value) = + "BAM_V1_6_Read_Group_Platform { " ++ + "bam_v1_6_read_group_platform_value = " ++ + (show value) ++ + " }" + +-- | PM tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Platform_Model = BAM_V1_6_Read_Group_Platform_Model { bam_v1_6_read_group_platform_model_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Platform_Model where + BAM_V1_6_Read_Group_Platform_Model bam_v1_6_read_group_platform_model_value1 == + BAM_V1_6_Read_Group_Platform_Model bam_v1_6_read_group_platform_model_value2 = + bam_v1_6_read_group_platform_model_value1 == bam_v1_6_read_group_platform_model_value2 + +instance Show BAM_V1_6_Read_Group_Platform_Model where + show (BAM_V1_6_Read_Group_Platform_Model value) = + "BAM_V1_6_Read_Group_Platform_Model { " ++ + "bam_v1_6_read_group_platform_model_value = " ++ + (show value) ++ + " }" + +-- | PU tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Platform_Unit = BAM_V1_6_Read_Group_Platform_Unit { bam_v1_6_read_group_platform_unit_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Platform_Unit where + BAM_V1_6_Read_Group_Platform_Unit bam_v1_6_read_group_platform_unit_value1 == + BAM_V1_6_Read_Group_Platform_Unit bam_v1_6_read_group_platform_unit_value2 = + bam_v1_6_read_group_platform_unit_value1 == bam_v1_6_read_group_platform_unit_value2 + +instance Show BAM_V1_6_Read_Group_Platform_Unit where + show (BAM_V1_6_Read_Group_Platform_Unit value) = + "BAM_V1_6_Read_Group_Platform_Unit { " ++ + "bam_v1_6_read_group_platform_unit_value = " ++ + (show value) ++ + " }" + +-- | SM tag for @"BAM_V1_6_Read_Group"@. +newtype BAM_V1_6_Read_Group_Sample = BAM_V1_6_Read_Group_Sample { bam_v1_6_read_group_sample_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Read_Group_Sample where + BAM_V1_6_Read_Group_Sample bam_v1_6_read_group_sample_value1 == + BAM_V1_6_Read_Group_Sample bam_v1_6_read_group_sample_value2 = + bam_v1_6_read_group_sample_value1 == bam_v1_6_read_group_sample_value2 + +instance Show BAM_V1_6_Read_Group_Sample where + show (BAM_V1_6_Read_Group_Sample value) = + "BAM_V1_6_Read_Group_Sample { " ++ + "bam_v1_6_read_group_sample_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/Header/SQ.hs b/src/Data/BAM/Version1_6/BAM/Header/SQ.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/Header/SQ.hs @@ -0,0 +1,291 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.Header.SQ +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.Header.SQ ( -- * BAM version 1.6 Reference sequence dictionary data type + BAM_V1_6_Reference_Sequence_Dictionary(..), + -- * BAM version 1.6 Reference sequence dictionary data types + BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name(..), + BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length(..), + BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus(..), + BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names(..), + BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier(..), + BAM_V1_6_Reference_Sequence_Dictionary_Description(..), + BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum(..), + BAM_V1_6_Reference_Sequence_Dictionary_Species(..), + BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology(..), + BAM_V1_6_Reference_Sequence_Dictionary_URI(..) + ) where + +import Data.ByteString +import Data.Data +import Generics.Deriving.Base + +-- | Custom BAM (version 1.6) @"BAM_V1_6_Reference_Sequence_Dictionary"@ data type. +-- +-- See section 4.2 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_Reference_Sequence_Dictionary = BAM_V1_6_Reference_Sequence_Dictionary { bam_v1_6_reference_sequence_dictionary_reference_sequence_name :: BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name + , bam_v1_6_reference_sequence_dictionary_reference_sequence_length :: BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length + , bam_v1_6_reference_sequence_dictionary_alternative_locus :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus + , bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names + , bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier + , bam_v1_6_reference_sequence_dictionary_description :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_Description + , bam_v1_6_reference_sequence_dictionary_md5_checksum :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum + , bam_v1_6_reference_sequence_dictionary_species :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_Species + , bam_v1_6_reference_sequence_dictionary_molecule_topology :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology + , bam_v1_6_reference_sequence_dictionary_uri :: Maybe BAM_V1_6_Reference_Sequence_Dictionary_URI + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary where + BAM_V1_6_Reference_Sequence_Dictionary bam_v1_6_reference_sequence_dictionary_reference_sequence_name1 + bam_v1_6_reference_sequence_dictionary_reference_sequence_length1 + bam_v1_6_reference_sequence_dictionary_reference_alternative_locus1 + bam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names1 + bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier1 + bam_v1_6_reference_sequence_dictionary_description1 + bam_v1_6_reference_sequence_dictionary_md5_checksum1 + bam_v1_6_reference_sequence_dictionary_species1 + bam_v1_6_reference_sequence_dictionary_molecule_topology1 + bam_v1_6_reference_sequence_dictionary_uri1 == + BAM_V1_6_Reference_Sequence_Dictionary bam_v1_6_reference_sequence_dictionary_reference_sequence_name2 + bam_v1_6_reference_sequence_dictionary_reference_sequence_length2 + bam_v1_6_reference_sequence_dictionary_reference_alternative_locus2 + bam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2 + bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2 + bam_v1_6_reference_sequence_dictionary_description2 + bam_v1_6_reference_sequence_dictionary_md5_checksum2 + bam_v1_6_reference_sequence_dictionary_species2 + bam_v1_6_reference_sequence_dictionary_molecule_topology2 + bam_v1_6_reference_sequence_dictionary_uri2 = + bam_v1_6_reference_sequence_dictionary_reference_sequence_name1 == bam_v1_6_reference_sequence_dictionary_reference_sequence_name2 && + bam_v1_6_reference_sequence_dictionary_reference_sequence_length1 == bam_v1_6_reference_sequence_dictionary_reference_sequence_length2 && + bam_v1_6_reference_sequence_dictionary_reference_alternative_locus1 == bam_v1_6_reference_sequence_dictionary_reference_alternative_locus2 && + bam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names1 == bam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2 && + bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier1 == bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2 && + bam_v1_6_reference_sequence_dictionary_description1 == bam_v1_6_reference_sequence_dictionary_description2 && + bam_v1_6_reference_sequence_dictionary_md5_checksum1 == bam_v1_6_reference_sequence_dictionary_md5_checksum2 && + bam_v1_6_reference_sequence_dictionary_species1 == bam_v1_6_reference_sequence_dictionary_species2 && + bam_v1_6_reference_sequence_dictionary_molecule_topology1 == bam_v1_6_reference_sequence_dictionary_molecule_topology2 && + bam_v1_6_reference_sequence_dictionary_uri1 == bam_v1_6_reference_sequence_dictionary_uri2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary where + show (BAM_V1_6_Reference_Sequence_Dictionary reference_sequence_name + reference_sequence_length + reference_alternative_locus + reference_alternative_sequence_names + genome_assembly_identifier + description + md5_checksum + species + molecule_topology + uri + ) = + "BAM_V1_6_Reference_Sequence_Dictionary { " ++ + "bam_v1_6_reference_sequence_dictionary_reference_sequence_name = " ++ + (show reference_sequence_name) ++ + " , bam_v1_6_reference_sequence_dictionary_reference_sequence_length = " ++ + (show reference_sequence_length) ++ + " , bam_v1_6_reference_sequence_dictionary_alternative_locus = " ++ + (show reference_alternative_locus) ++ + " , bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = " ++ + (show reference_alternative_sequence_names) ++ + " , bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = " ++ + (show genome_assembly_identifier) ++ + " , bam_v1_6_reference_sequence_dictionary_description = " ++ + (show description) ++ + " , bam_v1_6_reference_sequence_dictionary_md5_checksum = " ++ + (show md5_checksum) ++ + " , bam_v1_6_reference_sequence_dictionary_species = " ++ + (show species) ++ + " , bam_v1_6_reference_sequence_dictionary_molecule_topology = " ++ + (show molecule_topology) ++ + " , bam_v1_6_reference_sequence_dictionary_uri = " ++ + (show uri) ++ + " }" + +-- | SN tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name = BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { bam_v1_6_reference_sequence_dictionary_reference_sequence_name_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name where + BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name bam_v1_6_reference_sequence_dictionary_reference_sequence_name_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name bam_v1_6_reference_sequence_dictionary_reference_sequence_name_value2 = + bam_v1_6_reference_sequence_dictionary_reference_sequence_name_value1 == bam_v1_6_reference_sequence_dictionary_reference_sequence_name_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name where + show (BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { " ++ + "bam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = " ++ + (show value) ++ + " }" + +-- | LN tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length = BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { bam_v1_6_reference_sequence_dictionary_reference_sequence_length_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length where + BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length bam_v1_6_reference_sequence_dictionary_reference_sequence_length_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length bam_v1_6_reference_sequence_dictionary_reference_sequence_length_value2 = + bam_v1_6_reference_sequence_dictionary_reference_sequence_length_value1 == bam_v1_6_reference_sequence_dictionary_reference_sequence_length_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length where + show (BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { " ++ + "bam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = " ++ + (show value) ++ + " }" + +-- | AH tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus = BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { bam_v1_6_reference_sequence_dictionary_alternative_locus_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus where + BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus bam_v1_6_reference_sequence_dictionary_alternative_locus_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus bam_v1_6_reference_sequence_dictionary_alternative_locus_value2 = + bam_v1_6_reference_sequence_dictionary_alternative_locus_value1 == bam_v1_6_reference_sequence_dictionary_alternative_locus_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus where + show (BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { " ++ + "bam_v1_6_reference_sequence_dictionary_alternative_locus_value = " ++ + (show value) ++ + " }" + +-- | AN tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names = BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names where + BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value2 = + bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value1 == bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names where + show (BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { " ++ + "bam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value = " ++ + (show value) ++ + " }" + +-- | AS tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier = BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier where + BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value2 = + bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value1 == bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier where + show (BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { " ++ + "bam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value = " ++ + (show value) ++ + " }" + +-- | DS tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Description = BAM_V1_6_Reference_Sequence_Dictionary_Description { bam_v1_6_reference_sequence_dictionary_description_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Description where + BAM_V1_6_Reference_Sequence_Dictionary_Description bam_v1_6_reference_sequence_dictionary_description_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Description bam_v1_6_reference_sequence_dictionary_description_value2 = + bam_v1_6_reference_sequence_dictionary_description_value1 == bam_v1_6_reference_sequence_dictionary_description_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Description where + show (BAM_V1_6_Reference_Sequence_Dictionary_Description value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Description { " ++ + "bam_v1_6_reference_sequence_dictionary_description_value = " ++ + (show value) ++ + " }" + +-- | M5 tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum = BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { bam_v1_6_reference_sequence_dictionary_md5_checksum_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum where + BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum bam_v1_6_reference_sequence_dictionary_md5_checksum_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum bam_v1_6_reference_sequence_dictionary_md5_checksum_value2 = + bam_v1_6_reference_sequence_dictionary_md5_checksum_value1 == bam_v1_6_reference_sequence_dictionary_md5_checksum_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum where + show (BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum value) = + "BAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { " ++ + "bam_v1_6_reference_sequence_dictionary_md5_checksum_value = " ++ + (show value) ++ + " }" + +-- | SP tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Species = BAM_V1_6_Reference_Sequence_Dictionary_Species { bam_v1_6_reference_sequence_dictionary_species_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Species where + BAM_V1_6_Reference_Sequence_Dictionary_Species bam_v1_6_reference_sequence_dictionary_species_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Species bam_v1_6_reference_sequence_dictionary_species_value2 = + bam_v1_6_reference_sequence_dictionary_species_value1 == bam_v1_6_reference_sequence_dictionary_species_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Species where + show (BAM_V1_6_Reference_Sequence_Dictionary_Species value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Species { " ++ + "bam_v1_6_reference_sequence_dictionary_species_value = " ++ + (show value) ++ + " }" + +-- | TP tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology = BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { bam_v1_6_reference_sequence_dictionary_molecule_topology_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology where + BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology bam_v1_6_reference_sequence_dictionary_molecule_topology_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology bam_v1_6_reference_sequence_dictionary_molecule_topology_value2 = + bam_v1_6_reference_sequence_dictionary_molecule_topology_value1 == bam_v1_6_reference_sequence_dictionary_molecule_topology_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology where + show (BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology value) = + "BAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { " ++ + "bam_v1_6_reference_sequence_dictionary_molecule_topology_value = " ++ + (show value) ++ + " }" + +-- | UR tag for @"BAM_V1_6_Reference_Sequence_Dictionary"@. +newtype BAM_V1_6_Reference_Sequence_Dictionary_URI = BAM_V1_6_Reference_Sequence_Dictionary_URI { bam_v1_6_reference_sequence_dictionary_uri_value :: ByteString + } + deriving (Generic,Typeable) + +instance Eq BAM_V1_6_Reference_Sequence_Dictionary_URI where + BAM_V1_6_Reference_Sequence_Dictionary_URI bam_v1_6_reference_sequence_dictionary_uri_value1 == + BAM_V1_6_Reference_Sequence_Dictionary_URI bam_v1_6_reference_sequence_dictionary_uri_value2 = + bam_v1_6_reference_sequence_dictionary_uri_value1 == bam_v1_6_reference_sequence_dictionary_uri_value2 + +instance Show BAM_V1_6_Reference_Sequence_Dictionary_URI where + show (BAM_V1_6_Reference_Sequence_Dictionary_URI value) = + "BAM_V1_6_Reference_Sequence_Dictionary_URI { " ++ + "bam_v1_6_reference_sequence_dictionary_uri_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BAM/ReferenceInformation.hs b/src/Data/BAM/Version1_6/BAM/ReferenceInformation.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/ReferenceInformation.hs @@ -0,0 +1,38 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.ReferenceInformation +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.ReferenceInformation ( -- * BAM version 1.6 reference information mandatory and optional data types (RE-EXPORT) + module Data.BAM.Version1_6.BAM.ReferenceInformation.Base + ) where + +-- | Re-exports. +import Data.BAM.Version1_6.BAM.ReferenceInformation.Base diff --git a/src/Data/BAM/Version1_6/BAM/ReferenceInformation/Base.hs b/src/Data/BAM/Version1_6/BAM/ReferenceInformation/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BAM/ReferenceInformation/Base.hs @@ -0,0 +1,62 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BAM.ReferenceInformation.Base +-- Copyright : (c) Matthew Mosior 2023 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BAM.ReferenceInformation.Base ( -- * BAM_V1_6_BAM_Reference_Information version 1.6 data type + BAM_V1_6_BAM_Reference_Information(..) + ) where + +import Data.ByteString +import Data.Data +import Data.Word +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6_BAM_Reference_Information"@ (BAM version 1.6) data type. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BAM_Reference_Information = BAM_V1_6_BAM_Reference_Information + { bam_v1_6_bam_reference_information_l_name :: Word32 -- ^ Length of the reference name plus 1 (including NUL). + , bam_v1_6_bam_reference_information_name :: ByteString -- ^ Reference sequence name; NUL terminated. + , bam_v1_6_bam_reference_information_l_ref :: Word32 -- ^ Length of the reference sequence. + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BAM_Reference_Information where + BAM_V1_6_BAM_Reference_Information bam_v1_6_bam_reference_information_l_name1 + bam_v1_6_bam_reference_information_name1 + bam_v1_6_bam_reference_information_l_ref1 == + BAM_V1_6_BAM_Reference_Information bam_v1_6_bam_reference_information_l_name2 + bam_v1_6_bam_reference_information_name2 + bam_v1_6_bam_reference_information_l_ref2 = + bam_v1_6_bam_reference_information_l_name1 == bam_v1_6_bam_reference_information_l_name2 && + bam_v1_6_bam_reference_information_name1 == bam_v1_6_bam_reference_information_name2 && + bam_v1_6_bam_reference_information_l_ref1 == bam_v1_6_bam_reference_information_l_ref2 + +instance Show BAM_V1_6_BAM_Reference_Information where + show (BAM_V1_6_BAM_Reference_Information l_name + name + l_ref + ) = + "BAM_V1_6_BAM_Reference_Information { " ++ + "bam_v1_6_bam_reference_information_l_name = " ++ + (show l_name) ++ + " , bam_v1_6_bam_reference_information_name = " ++ + (show name) ++ + " , bam_v1_6_bam_reference_information_l_ref = " ++ + (show l_ref) ++ + " }" diff --git a/src/Data/BAM/Version1_6/BGZFBlock.hs b/src/Data/BAM/Version1_6/BGZFBlock.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/BGZFBlock.hs @@ -0,0 +1,112 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.BGZFBlock +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.BGZFBlock ( -- * BAM_V1_6_BGZFBlock version 1.6 data type + BAM_V1_6_BGZFBlock(..) + ) where + +import Data.BAM.Version1_6.BAM +import Data.BAM.Version1_6.GZipHeader + +import Data.Data +import Data.Word +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6_BGZFBlock"@ (BAM version 1.6) data type. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_BGZFBlock = BAM_V1_6_BGZFBlock + { bam_v1_6_bgzfblock_gzip_header :: BAM_V1_6_GZipHeader -- ^ GZip 10 byte header. + -- This contains a magic number (1f 08), + -- the compression method (08 for DEFLATE), + -- 1-byte of header flags, + -- a 4-byte timestamp, + -- compression flags, + -- and the operating system ID. + , bam_v1_6_bgzfblock_subfield_identifier_one :: Word8 -- ^ This should be 'B'. + , bam_v1_6_bgzfblock_subfield_identifier_two :: Word8 -- ^ This should be 'C'. + , bam_v1_6_bgzfblock_subfield_length :: Word16 -- ^ This should be '02 00'. + , bam_v1_6_bgzfblock_total_block_size_minus_one :: Word16 -- ^ The payload of the BGZF + -- extra field is a 16-bit unsigned + -- integer in little endian format. + -- This integer gives the size of the + -- containing BGZF block minus one. + , bam_v1_6_bgzfblock_cdata :: BAM_V1_6_BAM -- ^ Compressed DATA by zlib::deflate(). + -- The data in this field will be + -- in a decompressed and + -- useable state. + , bam_v1_6_bgzfblock_crc32 :: Word32 -- ^ CRC-32. + , bam_v1_6_bgzfblock_isize :: Word32 -- ^ Input SIZE (length of uncompressed data). + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_BGZFBlock where + BAM_V1_6_BGZFBlock bam_v1_6_bgzfblock_gzip_header1 + bam_v1_6_bgzfblock_subfield_identifier_one1 + bam_v1_6_bgzfblock_subfield_identifier_two1 + bam_v1_6_bgzfblock_subfield_length1 + bam_v1_6_bgzfblock_total_block_size_minus_one1 + bam_v1_6_bgzfblock_cdata1 + bam_v1_6_bgzfblock_crc321 + bam_v1_6_bgzfblock_isize1 == + BAM_V1_6_BGZFBlock bam_v1_6_bgzfblock_gzip_header2 + bam_v1_6_bgzfblock_subfield_identifier_one2 + bam_v1_6_bgzfblock_subfield_identifier_two2 + bam_v1_6_bgzfblock_subfield_length2 + bam_v1_6_bgzfblock_total_block_size_minus_one2 + bam_v1_6_bgzfblock_cdata2 + bam_v1_6_bgzfblock_crc322 + bam_v1_6_bgzfblock_isize2 = + bam_v1_6_bgzfblock_gzip_header1 == bam_v1_6_bgzfblock_gzip_header2 && + bam_v1_6_bgzfblock_subfield_identifier_one1 == bam_v1_6_bgzfblock_subfield_identifier_one2 && + bam_v1_6_bgzfblock_subfield_identifier_two1 == bam_v1_6_bgzfblock_subfield_identifier_two2 && + bam_v1_6_bgzfblock_subfield_length1 == bam_v1_6_bgzfblock_subfield_length2 && + bam_v1_6_bgzfblock_total_block_size_minus_one1 == bam_v1_6_bgzfblock_total_block_size_minus_one2 && + bam_v1_6_bgzfblock_cdata1 == bam_v1_6_bgzfblock_cdata2 && + bam_v1_6_bgzfblock_crc321 == bam_v1_6_bgzfblock_crc322 && + bam_v1_6_bgzfblock_isize1 == bam_v1_6_bgzfblock_isize2 + +instance Show BAM_V1_6_BGZFBlock where + show (BAM_V1_6_BGZFBlock gzip_header + subfield_identifier_one + subfield_identifier_two + subfield_length + total_block_size_minus_one + cdata + crc32 + isize + ) = + "BAM_V1_6_BGZFBlock { " ++ + "bam_v1_6_bgzfblock_gzip_header = " ++ + (show gzip_header) ++ + " , bam_v1_6_bgzfblock_subfield_identifier_one = " ++ + (show subfield_identifier_one) ++ + " , bam_v1_6_bgzfblock_subfield_identifier_two = " ++ + (show subfield_identifier_two) ++ + " , bam_v1_6_bgzfblock_subfield_length = " ++ + (show subfield_length) ++ + " , bam_v1_6_bgzfblock_total_block_size_minus_one = " ++ + (show total_block_size_minus_one) ++ + " , bam_v1_6_bgzfblock_cdata = " ++ + (show cdata) ++ + " , bam_v1_6_bgzfblock_crc32 = " ++ + (show crc32) ++ + " , bam_v1_6_bgzfblock_isize = " ++ + (show isize) ++ + " }" diff --git a/src/Data/BAM/Version1_6/Base.hs b/src/Data/BAM/Version1_6/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Base.hs @@ -0,0 +1,51 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Base ( -- * BAM_V1_6 version 1.6 data type + BAM_V1_6(..) + ) where + +import Data.BAM.Version1_6.BGZFBlock + +import Data.Data +import Data.Sequence +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6"@ (BAM version 1.6) newtype. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +newtype BAM_V1_6 = BAM_V1_6 + { bam_v1_6 :: Seq BAM_V1_6_BGZFBlock -- ^ Sequence holding all + -- BGZF blocks of data + -- within the BAM file. + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6 where + BAM_V1_6 bam_v1_61 == + BAM_V1_6 bam_v1_62 = + bam_v1_61 == bam_v1_62 + +instance Show BAM_V1_6 where + show (BAM_V1_6 bam + ) = + "BAM_V1_6 { " ++ + "bam_v1_6 = " ++ + (show bam) ++ + " }" diff --git a/src/Data/BAM/Version1_6/GZipHeader.hs b/src/Data/BAM/Version1_6/GZipHeader.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/GZipHeader.hs @@ -0,0 +1,98 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.GZipHeader +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.GZipHeader ( -- * BAM_V1_6_GZipHeader version 1.6 data type + BAM_V1_6_GZipHeader(..) + ) where + +import Data.Data +import Data.Word +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6_GZipHeader"@ (BAM version 1.6) data type. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_GZipHeader = BAM_V1_6_GZipHeader + { bam_v1_6_gzip_header_gzip_identifier_1 :: Word8 -- ^ Magic number 1f (0x1f). + , bam_v1_6_gzip_header_gzip_identifier_2 :: Word8 -- ^ Magic number 08 (0x08). + , bam_v1_6_gzip_header_compression_method :: Word8 -- ^ Compression method (08 for DEFLATE). + , bam_v1_6_gzip_header_header_flags :: Word8 -- ^ 1-byte for header flags. + , bam_v1_6_gzip_header_modification_time :: Word32 -- ^ 4-byte timestamp. + , bam_v1_6_gzip_header_extra_flags :: Word8 -- ^ 1-byte eXtra FLags. + , bam_v1_6_gzip_header_operating_system :: Word8 -- ^ The operating system id. + , bam_v1_6_gzip_header_extra_length :: Word16 -- ^ If FLG.FEXTRA is set, + -- this gives the length of the optional + -- extra field. + } deriving (Generic,Typeable) + +instance Eq BAM_V1_6_GZipHeader where + BAM_V1_6_GZipHeader bam_v1_6_gzip_header_gzip_identifier_11 + bam_v1_6_gzip_header_gzip_identifier_21 + bam_v1_6_gzip_header_compression_method1 + bam_v1_6_gzip_header_header_flags1 + bam_v1_6_gzip_header_modification_time1 + bam_v1_6_gzip_header_extra_flags1 + bam_v1_6_gzip_header_operating_system_id1 + bam_v1_6_gzip_header_extra_length1 == + BAM_V1_6_GZipHeader bam_v1_6_gzip_header_gzip_identifier_12 + bam_v1_6_gzip_header_gzip_identifier_22 + bam_v1_6_gzip_header_compression_method2 + bam_v1_6_gzip_header_header_flags2 + bam_v1_6_gzip_header_modification_time2 + bam_v1_6_gzip_header_extra_flags2 + bam_v1_6_gzip_header_operating_system_id2 + bam_v1_6_gzip_header_extra_length2 = + bam_v1_6_gzip_header_gzip_identifier_11 == bam_v1_6_gzip_header_gzip_identifier_12 && + bam_v1_6_gzip_header_gzip_identifier_21 == bam_v1_6_gzip_header_gzip_identifier_22 && + bam_v1_6_gzip_header_compression_method1 == bam_v1_6_gzip_header_compression_method2 && + bam_v1_6_gzip_header_header_flags1 == bam_v1_6_gzip_header_header_flags2 && + bam_v1_6_gzip_header_modification_time1 == bam_v1_6_gzip_header_modification_time2 && + bam_v1_6_gzip_header_extra_flags1 == bam_v1_6_gzip_header_extra_flags2 && + bam_v1_6_gzip_header_operating_system_id1 == bam_v1_6_gzip_header_operating_system_id2 && + bam_v1_6_gzip_header_extra_length1 == bam_v1_6_gzip_header_extra_length2 + +instance Show BAM_V1_6_GZipHeader where + show (BAM_V1_6_GZipHeader gzip_identifier_1 + gzip_identifier_2 + compression_method + header_flags + modification_time + extra_flags + operating_system_id + extra_length + ) = + "BAM_V1_6_GZipHeader { " ++ + "bam_v1_6_gzip_header_gzip_identifier_1 = " ++ + (show gzip_identifier_1) ++ + " , bam_v1_6_gzip_header_gzip_identifier_2 = " ++ + (show gzip_identifier_2) ++ + " , bam_v1_6_gzip_header_compression_method = " ++ + (show compression_method) ++ + " , bam_v1_6_gzip_header_header_flags = " ++ + (show header_flags) ++ + " , bam_v1_6_gzip_header_modification_time = " ++ + (show modification_time) ++ + " , bam_v1_6_gzip_header_extra_flags = " ++ + (show extra_flags) ++ + " , bam_v1_6_gzip_header_operating_system_id = " ++ + (show operating_system_id) ++ + " , bam_v1_6_gzip_header_extra_length = " ++ + (show extra_length) ++ + " }" diff --git a/src/Data/BAM/Version1_6/Internal.hs b/src/Data/BAM/Version1_6/Internal.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Internal.hs @@ -0,0 +1,335 @@ +{-# LANGUAGE FlexibleContexts #-} + +-- | +-- Module : Data.BAM.Version1_6.Internal +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Internal ( -- * BAM version 1.6 internal functions + bytestringToFloatLE + , byteStringToIntLE + , byteStringToWord16LE + , floatToByteStringLE + , intToByteStringLE + , intToWord16LE + , intToWord32LE + , int8ToByteString + , int16ToByteStringLE + , int32ToByteStringLE + , maybeOption + , splitByteString + , word8sToInt8LE + , word8sToInt16LE + , word8sToInt32LE + , word8sToWord8LE + , word8sToWord16LE + , word8sToWord32LE + , word32ToByteStringLE + , word16ToByteStringLE + , word16ToByteString + , word16ToIntLE + ) where + +import Data.Attoparsec.ByteString.Lazy +import Data.Binary.Get (runGet,getFloatle) +import Data.Binary.Put (runPut,putFloatle,putInt64le) +import Data.Bits +import Data.ByteString as DB +import Data.ByteString.Builder +import Data.Int +import Data.Word + +-- | Make a parser optional, return Nothing if there is no match. +maybeOption :: Parser a + -> Parser (Maybe a) +maybeOption p = + option Nothing + (Just <$> p) + +-- | Convert a little-endian Word16 to an Int. +word16ToIntLE :: Word16 + -> Int +word16ToIntLE w = do + let signedValue = fromIntegral w :: Int + -- Check if the most significant bit (sign bit) is set + isNegative = testBit signedValue 15 + case isNegative of + True -> + signedValue - 65536 -- If negative, subtract 2^16 + False -> + signedValue + +-- | Split a ByteString into chunks of n bytes. +splitByteString :: Int + -> ByteString + -> [ByteString] +splitByteString n bs = + case (DB.null bs) of + True -> + [] + False -> + case (DB.length bs `mod` n /= 0) of + True -> + error $ + "ByteString length must be a multiple of " ++ + (show n) ++ + "." + False -> + let (chunk,rest) = DB.splitAt n + bs + in chunk : splitByteString n + rest + +-- | Convert a ByteString to a Float (IEEE 754 binary32). +bytestringToFloatLE :: ByteString + -> Float +bytestringToFloatLE bs = + case (DB.length bs == 4) of + True -> + runGet getFloatle $ + fromStrict bs + False -> + error "ByteString must contain exactly 4 bytes" + +-- | Convert a ByteString (little-endian) to an Int. +byteStringToIntLE :: ByteString + -> Int +byteStringToIntLE bs = + Prelude.foldr go 0 (Prelude.zip [0..] + (DB.unpack bs) + ) + where + go :: (Int,Word8) + -> Int + -> Int + go (i,b) + acc = acc + .|. + ( fromIntegral b + `shiftL` + (8 * i) + ) + +-- | Convert a ByteString to [Word16] in little-endian format. +byteStringToWord16LE :: ByteString + -> [Word16] +byteStringToWord16LE bs + | DB.length bs `mod` 2 /= 0 = error "ByteString must have an even length." + | otherwise = go bs + [] + where + go :: ByteString + -> [Word16] + -> [Word16] + go input acc + | DB.null input = Prelude.reverse acc -- Stop processing when no bytes are left + | otherwise = + let byte1 = fromIntegral (DB.index input 0) :: Word16 -- LSB + byte2 = fromIntegral (DB.index input 1) :: Word16 -- MSB + word16 = byte1 .|. (byte2 `shiftL` 8) -- Combine bytes in little-endian order + in go ( DB.drop 2 + input + ) + ( word16 : acc + ) -- Recursively process the rest + +-- | Convert a [Word8] to a Int8 (little endian). +word8sToInt8LE :: [Word8] + -> Int8 +word8sToInt8LE [ b0 + ] = fromIntegral b0 +word8sToInt8LE _ = error "List must contain exactly 1 Word8 element." + +-- | Convert a [Word8] to a Int16 (little endian). +word8sToInt16LE :: [Word8] + -> Int16 +word8sToInt16LE [ b0 + , b1 + ] = + ( fromIntegral b0 + ) .|. + ( fromIntegral b1 + `shiftL` + 8 + ) +word8sToInt16LE _ = error "List must contain exactly 2 Word8 elements." + +-- | Convert a [Word8] to a Int32 (little endian). +word8sToInt32LE :: [Word8] + -> Int32 +word8sToInt32LE [ b0 + , b1 + , b2 + , b3 + ] = + (fromIntegral b0 + ) .|. + ( fromIntegral b1 + `shiftL` + 8 + ) .|. + ( fromIntegral b2 + `shiftL` + 16 + ) .|. + ( fromIntegral b3 + `shiftL` + 24 + ) +word8sToInt32LE _ = error "List must contain exactly 4 Word8 elements." + +-- | Convert a [Word8] to a Word8 (little endian). +word8sToWord8LE :: [Word8] + -> Word8 +word8sToWord8LE [ b0 + ] = b0 +word8sToWord8LE _ = error "List must contain exactly 1 Word8 element." + +-- | Convert a [Word8] to a Word16 (little endian). +word8sToWord16LE :: [Word8] + -> Word16 +word8sToWord16LE [ b0 + , b1 + ] = + ( fromIntegral b0 + ) .|. + ( fromIntegral b1 + `shiftL` + 8 + ) +word8sToWord16LE _ = error "List must contain exactly 2 Word8 elements." + +-- | Convert a [Word8] to a Word32 (little endian). +word8sToWord32LE :: [Word8] + -> Word32 +word8sToWord32LE [ b0 + , b1 + , b2 + , b3 + ] = + ( fromIntegral b0 + ) .|. + ( fromIntegral b1 + `shiftL` + 8 + ) .|. + ( fromIntegral b2 + `shiftL` + 16 + ) .|. + ( fromIntegral b3 + `shiftL` + 24 + ) +word8sToWord32LE _ = error "List must contain exactly 4 Word8 elements." + +-- Convert Word16 to ByteString. +word16ToByteString :: Word16 + -> ByteString +word16ToByteString w = + DB.pack [ fromIntegral (w `shiftR` 8) + , fromIntegral (w .&. 0xFF) + ] + +-- | Convert a Word16 in little endian +-- byte order to a ByteString. +word16ToByteStringLE :: Word16 + -> ByteString +word16ToByteStringLE w = + DB.toStrict $ + toLazyByteString $ + word16LE w + +-- | Convert a Word32 in little endian +-- byte order to a ByteString. +word32ToByteStringLE :: Word32 + -> ByteString +word32ToByteStringLE w = + DB.toStrict $ + toLazyByteString $ + word32LE w + +-- | Convert a Int in little endian +-- byte order to a ByteString. +intToByteStringLE :: Int + -> ByteString +intToByteStringLE i = + DB.toStrict $ + runPut $ + putInt64le $ + fromIntegral i + +-- | Convert an Int in little-endian +-- byte order to a Word16. +intToWord16LE :: Int + -> Word16 +intToWord16LE i + | i >= 0 && i <= 0xFFFF = fromIntegral i + | otherwise = error "Int value is out of Word16 range" + +-- | Convert an Int little-endian +-- byte order to a Word32. +intToWord32LE :: Int + -> Word32 +intToWord32LE i + | i >= 0 = fromIntegral i + | otherwise = error "Int value must be non-negative" + +-- | Convert a Int8 in little endian +-- byte order to a ByteString. +int8ToByteString :: Int8 + -> ByteString +int8ToByteString i = + DB.toStrict $ + toLazyByteString $ + int8 i + +-- | Convert a Int16 in little endian +-- byte order to a ByteString. +int16ToByteStringLE :: Int16 + -> ByteString +int16ToByteStringLE i = + DB.toStrict $ + toLazyByteString $ + int16LE i + +-- | Convert a Int32 in little endian +-- byte order to a ByteString. +int32ToByteStringLE :: Int32 + -> ByteString +int32ToByteStringLE i = + DB.toStrict $ + toLazyByteString $ + int32LE i + +-- | Convert a Float in little endian +-- byte order to a ByteString. +-- See https://stackoverflow.com/questions/6976684/converting-ieee-754-floating-point-in-haskell-word32-64-to-and-from-haskell-floa +floatToByteStringLE :: Float + -> ByteString +floatToByteStringLE f = + DB.toStrict $ + runPut $ + putFloatle f diff --git a/src/Data/BAM/Version1_6/Read/Base.hs b/src/Data/BAM/Version1_6/Read/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Base.hs @@ -0,0 +1,113 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Base ( -- * Reading + readBAM_V1_6 + ) where + +import Data.BAM.Version1_6.Base +import Data.BAM.Version1_6.Read.Error +import Data.BAM.Version1_6.Read.Parser.BGZFBlock + +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.ByteString as DB +import Data.ByteString.Lazy as DBL +import Data.Sequence as DSeq +import qualified Streamly.Data.Stream as S +import Streamly.External.ByteString.Lazy as StreamlyLByteString (fromChunksIO) +import Streamly.Internal.FileSystem.File as StreamlyInternalFile (chunkReader) +import qualified System.IO as SIO + +-- | Define the @"BAM_V1_6"@ parser. +parse_BAM_V1_6 :: Parser BAM_V1_6 +parse_BAM_V1_6 = do + bgzfblocks <- + DABL.many' parse_BAM_V1_6_BGZFBlock + return BAM_V1_6 + { bam_v1_6 = DSeq.fromList bgzfblocks + } + +-- | Run the @"SAM_V1_6"@ parser. +readBAM_V1_6_LBS :: DBL.ByteString + -> IO BAM_V1_6 +readBAM_V1_6_LBS lbs = + case (DABL.parseOnly parse_BAM_V1_6 lbs) of + Left samparseerror -> + error samparseerror + Right sam -> + return sam + +-- | Read a @"BAM_V1_6"@ from a file. +-- +-- The file is checked for errors as it is parsed. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +readBAM_V1_6 :: FilePath -- ^ Input path to BAM file. + -> IO BAM_V1_6 +readBAM_V1_6 fp = do + -- Ensure that BAM file is intact + -- by checking for end-of-file + -- marker. + bamfileh <- + SIO.openBinaryFile fp + SIO.ReadMode + _ <- + SIO.hSeek bamfileh + SIO.SeekFromEnd + (-28) + endoffilemarker <- + DB.hGetContents bamfileh + case ( endoffilemarker == endoffilemarkerbytes + ) of + False -> + error $ + show BAM_V1_6_Read_Error_End_Of_File_Marker_Incorrect_Format + True -> do + let lazybamfile = S.unfold StreamlyInternalFile.chunkReader fp + lazybamfilef <- + StreamlyLByteString.fromChunksIO lazybamfile + readBAM_V1_6_LBS lazybamfilef + where + endoffilemarkerbytes = DB.pack + [ 0x1f + , 0x8b + , 0x08 + , 0x04 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + , 0xff + , 0x06 + , 0x00 + , 0x42 + , 0x43 + , 0x02 + , 0x00 + , 0x1b + , 0x00 + , 0x03 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + , 0x00 + ] diff --git a/src/Data/BAM/Version1_6/Read/Error.hs b/src/Data/BAM/Version1_6/Read/Error.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Error.hs @@ -0,0 +1,319 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Error +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Error ( -- * BAM version 1.6 data type + BAM_V1_6_Read_Error(..) + ) where + +import Data.Data +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6_Read_Error"@ (BAM version 1.6) error data type. +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_Read_Error = -- | Identification 1 (IDentification 1; ID1) field + -- of the GZip header not in accepted format. + BAM_V1_6_Read_Error_GZipHeader_ID1_Incorrect_Format + -- | Identification 2 (IDentification 2; ID2) field + -- of the GZip header not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_ID2_Incorrect_Format + -- | Compression Method (CM) field of the GZip header not + -- in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Compression_Method_Incorrect_Format + -- | Flag (FLG) field of the GZip header not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Flag_Incorrect_Format + -- | Modification TIME (MTIME) field of the GZip header not + -- in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Modification_TIME_Incorrect_Format + -- | Extra flags (eXtra FLags; XFL) field of the GZip header + -- not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Extra_Flags_Incorrect_Format + -- | Operating System (OS) field of the GZip header + -- not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Operating_System_Incorrect_Format + -- | Extra Length (eXtra LENgth; XLEN) field of the + -- GZip header is not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Extra_Length_Incorrect_Format + -- | Subfield Identifier 1 (Subfield Identifier1; SI1) + -- field of the GZip header is not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Subfield_Identifier_1_Incorrect_Format + -- | Subfield Identifier 2 (Subfield Identifier2; SI2) + -- field of the GZip header is not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Subfield_Identifier_2_Incorrect_Format + -- | Subfield Length (Subfield LENgth; SLEN) + -- field of the GZip header is not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Subfield_Length_Incorrect_Format + -- | Total block size minus 1 (total Block SIZE minus 1; BSIZE) + -- field of the GZip header is not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Total_Block_SIZE_Minus_1_Incorrect_Format + -- | Compressed DATA by zlib::deflate() (CDATA) is not + -- in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Compressed_DATA_Incorrect_Format + -- | @HD tag not in accepted format (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Tag_Incorrect_Format + -- | VN tag missing (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Format_Version_Tag_Missing + -- | VN tag not in accepted format (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Format_Version_Tag_Incorrect_Format + -- | VN value not in accepted format (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Format_Version_Value_Incorrect_Format + -- | Sorting order tag not in accepted format (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Sorting_Order_Tag_Incorrect_Format + -- | Sorting order invalid value (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Sorting_Order_Invalid_Value + -- | Grouping of alignments no in accepted format (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Grouping_Of_Alignments_Tag_Incorrect_Format + -- | Grouping of Alignments invalid value (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Grouping_Of_Alignments_Invalid_Value + -- | Subsorting order tag not in accepted format (only important + -- if @HD tag is present). + | BAM_V1_6_Read_Error_File_Level_Metadata_Subsorting_Order_Tag_Incorrect_Format + -- | Subsorting order of alignments not in accepted format (only + -- if @HD tag is present. + | BAM_V1_6_Read_Error_File_Level_Metadata_Subsorting_Order_Incorrect_Format + -- | The BAM magic string in the BAM header is not BAM\SOH (BAM\1). + | BAM_V1_6_Read_Error_BAMHeader_BAM_Magic_String_Invalid_Value + -- | SN tag missing (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Tag_Missing + -- | Reference Sequence Name not in accepted format (only important + -- if @SQ tag is present. + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Incorrect_Format + -- | Reference Sequence Name invalid value (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Invalid_Value + -- | LN tag missing (only important + -- if @SQ tag is present). + | BAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Missing + -- | Reference Sequence Length not in accepted format (only important + -- if @SQ tag is present. + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Incorrect_Format + -- | Reference Sequence Length invalid value (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Invalid_Value + -- | Alternative locus not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Alternative_Locus_Incorrect_Format + -- | Alternative Reference Sequence Names not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Incorrect_Format + -- | Alternative Reference Sequence Names invalid value (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Invalid_Value + -- | Genome Assembly Identifier not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Genome_Assembly_Identifier_Incorrect_Format + -- | Description not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Description_Incorrect_Format + -- | MD5 checksum not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_MD5_Checksum_Incorrect_Format + -- | Species not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Species_Incorrect_Format + -- | Molecule topology not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Molecule_Topology_Incorrect_Format + -- | Molecule topology invalid value (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_Molecule_Topology_Invalid_Value + -- | URI not in accepted format (only important + -- if @SQ tag is present). + | BAM_V1_6_Read_Error_Reference_Sequence_Dictionary_URI_Incorrect_Format + -- | ID tag not accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Read_Group_Identifier_Incorrect_Format + -- | ID tag is missing (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Read_Group_Identifier_Tag_Missing + -- | BC tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Barcode_Sequence_Incorrect_Format + -- | CN tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Sequencing_Center_Incorrect_Format + -- | DS tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Description_Incorrect_Format + -- | DT tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Date_Run_Produced_Incorrect_Format + -- | FO tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Flow_Order_Incorrect_Format + -- | KS tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Key_Sequence_Incorrect_Format + -- | LB tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Library_Incorrect_Format + -- | PG tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Programs_Incorrect_Format + -- | PI tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Predicted_Median_Insert_Size_Incorrect_Format + -- | PL tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Platform_Incorrect_Format + -- | PM tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Platform_Model_Incorrect_Format + -- | PU tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Platform_Unit_Incorrect_Format + -- | SM tag not in accepted format (only important + -- if @RG tag is present). + | BAM_V1_6_Read_Error_Read_Group_Sample_Incorrect_Format + -- | RG tag not in accepted format. + | BAM_V1_6_Read_Error_Read_Group_Tag_Incorrect_Format + -- | ID tag not in accepted format (only important + -- if @PG tag is present). + | BAM_V1_6_Read_Error_Program_Identifier_Incorrect_Format + -- | PN tag not in accepted format (only important + -- if @PG tag is present). + | BAM_V1_6_Read_Error_Program_Name_Incorrect_Format + -- | CL tag not in accepted format (only important + -- if @PG tag is present). + | BAM_V1_6_Read_Error_Program_Command_Line_Incorrect_Format + -- | PP tag not in accepted format (only important + -- if @PG tag is present). + | BAM_V1_6_Read_Error_Program_Previous_PG_ID_Incorrect_Format + -- | DS tag not in accepted format (only important + -- if @PG tag is present). + | BAM_V1_6_Read_Error_Program_Description_Incorrect_Format + -- | VN tag not in accepted format (only important + -- if @PG tag is present). + | BAM_V1_6_Read_Error_Program_Version_Incorrect_Format + -- | PG tag not in accepted format. + | BAM_V1_6_Read_Error_Program_Tag_Incorrect_Format + -- | CO tag not in accepted format. + | BAM_V1_6_Read_Error_One_Line_Comment_Tag_Incorrect_Format + -- | QNAME of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_QNAME_Incorrect_Format + -- | FLAG of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_FLAG_Incorrect_Format + -- | RNAME of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_RNAME_Incorrect_Format + -- | POS of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_POS_Incorrect_Format + -- | MAPQ of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_MAPQ_Incorrect_Format + -- | CIGAR of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_CIGAR_Incorrect_Format + -- | RNEXT of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_RNEXT_Incorrect_Format + -- | PNEXT of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_PNEXT_Incorrect_Format + -- | TLEN of alignment section not in accpepted format. + | BAM_V1_6_Read_Error_Alignment_TLEN_Incorrect_Format + -- | SEQ of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_SEQ_Incorrect_Format + -- | QUAL of alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_QUAL_Incorrect_Format + -- | Optional field is missing a type. + | BAM_V1_6_Read_Error_Alignment_OptionalFields_Missing_Type + -- | Optional field BOPT is missing a type. + | BAM_V1_6_Read_Error_Alignment_OptionalFields_BOPT_Missing_Type + -- | Optional field doesn't have a type. + | BAM_V1_6_Read_Error_Alignment_OptionalFields_Index_Missing + -- | Optional field has left-over bytes following parsing. + | BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- | AOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_AOPT_Tag_Incorrect_Format + -- | AOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_AOPT_Type_Incorrect_Format + -- | AOPT value of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_AOPT_Value_Incorrect_Format + -- | BigCOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BigCOPT_Tag_Incorrect_Format + -- | BigCOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BigCOPT_Type_Incorrect_Format + -- | BigIOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BigIOPT_Tag_Incorrect_Format + -- | BigIOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BigIOPT_Type_Incorrect_Format + -- | BigSOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BigSOPT_Tag_Incorrect_Format + -- | BigSOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BigSOPT_Type_Incorrect_Format + -- | SmallCOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_SmallCOPT_Tag_Incorrect_Format + -- | SmallCOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_SmallCOPT_Type_Incorrect_Format + -- | SmallIOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_SmallIOPT_Tag_Incorrect_Format + -- | SmallIOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_SmallIOPT_Type_Incorrect_Format + -- | SmallSOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_SmallSOPT_Tag_Incorrect_Format + -- | SmallSOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_SmallSOPT_Type_Incorrect_Format + -- | FOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_FOPT_Tag_Incorrect_Format + -- | FOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_FOPT_Type_Incorrect_Format + -- | FOPT value of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_FOPT_Value_Incorrect_Format + -- | ZOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_ZOPT_Tag_Incorrect_Format + -- | ZOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_ZOPT_Type_Incorrect_Format + -- | ZOPT value of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_ZOPT_Value_Incorrect_Format + -- | HOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_HOPT_Tag_Incorrect_Format + -- | HOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_HOPT_Type_Incorrect_Format + -- | HOPT value of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_HOPT_Value_Incorrect_Format + -- | BOPT tag of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BOPT_Tag_Incorrect_Format + -- | BOPT type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BOPT_Type_Incorrect_Format + -- | BOPT value type of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BOPT_Value_Type_Incorrect_Format + -- | BOPT value data of the alignment section not in accepted format. + | BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + -- | The CDATA field of a BGZF block not in accepted format. + | BAM_V1_6_Read_Error_CDATA_Incorrect_Format + -- | A CDATA BAM block alignment optional fields + -- are not in accepted format. + | BAM_V1_6_Read_Error_CDATA_BAM_Alignment_Optional_Fields_Incorrect_Format + -- | CRC-32 (CRC32) field of the GZip header + -- not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_CRC32_Incorrect_Format + -- | Input Size (Input SIZE, i.e. length of uncompressed data) + -- not in accepted format. + | BAM_V1_6_Read_Error_GZipHeader_Input_Size_Incorrect_Format + -- | The calculated crc32 of the uncompressed CDATA + -- is not equivalent to the CRC32 field of the BGZF block. + | BAM_V1_6_Read_Error_Calculated_CRC32_Not_Equivalent_To_CRC32 + -- | The last 28 bytes of the BAM file are not equivalent + -- to the standardized 28 byte end-of-file marker. + | BAM_V1_6_Read_Error_End_Of_File_Marker_Incorrect_Format + deriving (Eq,Generic,Show,Typeable) diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/Base.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/Base.hs @@ -0,0 +1,1117 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE TypeFamilies #-} +{-# LANGUAGE ViewPatterns #-} +{-# Language QuasiQuotes #-} +{-# OPTIONS_GHC -fno-warn-name-shadowing #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Base ( -- * BAM_V1_6_BAM parser - alignment section + parse_BAM_V1_6_BAM_Alignment + ) where + +import Data.BAM.Version1_6.BAM.Alignment +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.Base +import Data.BAM.Version1_6.Read.Error +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Internal +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.AOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigCOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigIOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigSOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallCOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallIOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallSOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.FOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.ZOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.HOPT +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BOPT + +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.ByteString as DB hiding (intercalate,map) +import Data.List (intercalate) +import Data.Sequence as DSeq (empty,fromList,singleton,Seq(..)) + +-- | @"BAM_V1_6_BAM_Alignment"@ parser. +-- +-- Defines a parser for the alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment :: Parser BAM_V1_6_BAM_Alignment +parse_BAM_V1_6_BAM_Alignment = do + block_size <- + DABL.take 4 + refID <- + DABL.take 4 + pos <- + DABL.take 4 + l_read_name <- + DABL.take 1 + mapq <- + DABL.take 1 + bin <- + DABL.take 2 + n_cigar_op <- + DABL.take 2 + flag <- + DABL.take 2 + l_seq <- + DABL.take 4 + next_refID <- + DABL.take 4 + next_pos <- + DABL.take 4 + tlen <- + DABL.take 4 + read_name <- + DABL.take + ( fromIntegral $ + word8sToWord8LE $ + DB.unpack l_read_name :: Int + ) + cigar <- + DABL.take + ( ( ( fromIntegral $ + word8sToWord16LE $ + DB.unpack n_cigar_op + ) * 4 + ) :: Int + ) + seq <- + DABL.take + ( ( ( ( fromIntegral $ + word8sToWord32LE $ + DB.unpack l_seq + ) + 1 + ) `div` 2 + ) :: Int + ) + qual <- + DABL.take + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack l_seq :: Int + ) + let bytesuptooptionalfields = 4 + + 4 + + 1 + + 1 + + 2 + + 2 + + 2 + + 4 + + 4 + + 4 + + 4 + + ( fromIntegral $ + word8sToWord8LE $ + DB.unpack l_read_name :: Int + ) + + ( ( ( fromIntegral $ + word8sToWord16LE $ + DB.unpack n_cigar_op + ) * 4 + ) :: Int + ) + + ( ( ( ( fromIntegral $ + word8sToWord32LE $ + DB.unpack l_seq + ) + 1 + ) `div` 2 + ) :: Int + ) + + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack l_seq + ) :: Int + let block_size_int = fromIntegral $ + word8sToWord32LE $ + DB.unpack block_size :: Int + case (bytesuptooptionalfields == block_size_int) of + True -> + return BAM_V1_6_BAM_Alignment + { bam_v1_6_bam_alignment_block_size = word8sToWord32LE $ + DB.unpack block_size + , bam_v1_6_bam_alignment_refID = word8sToInt32LE $ + DB.unpack refID + , bam_v1_6_bam_alignment_pos = word8sToInt32LE $ + DB.unpack pos + , bam_v1_6_bam_alignment_l_read_name = word8sToWord8LE $ + DB.unpack l_read_name + , bam_v1_6_bam_alignment_mapq = word8sToWord8LE $ + DB.unpack mapq + , bam_v1_6_bam_alignment_bin = word8sToWord16LE $ + DB.unpack bin + , bam_v1_6_bam_alignment_n_cigar_op = word8sToWord16LE $ + DB.unpack n_cigar_op + , bam_v1_6_bam_alignment_flag = word8sToWord16LE $ + DB.unpack flag + , bam_v1_6_bam_alignment_l_seq = word8sToWord32LE $ + DB.unpack l_seq + , bam_v1_6_bam_alignment_next_refID = word8sToInt32LE $ + DB.unpack next_refID + , bam_v1_6_bam_alignment_next_pos = word8sToInt32LE $ + DB.unpack next_pos + , bam_v1_6_bam_alignment_tlen = word8sToInt32LE $ + DB.unpack tlen + , bam_v1_6_bam_alignment_read_name = read_name + , bam_v1_6_bam_alignment_cigar = DSeq.fromList $ + map (word8sToWord32LE . DB.unpack) $ + splitByteString 4 + cigar + , bam_v1_6_bam_alignment_seq = DSeq.fromList $ + decodeSeqField seq + , bam_v1_6_bam_alignment_qual = qual + , bam_v1_6_bam_alignment_optionalfields = DSeq.singleton + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + } + False -> do + -- This parser assumes that + -- the optional alignment + -- tags can appear in any order. + optionalfieldbytes <- + parse_BAM_V1_6_BAM_Alignment_OptionalFields block_size_int + bytesuptooptionalfields + return BAM_V1_6_BAM_Alignment + { bam_v1_6_bam_alignment_block_size = word8sToWord32LE $ + DB.unpack block_size + , bam_v1_6_bam_alignment_refID = word8sToInt32LE $ + DB.unpack refID + , bam_v1_6_bam_alignment_pos = word8sToInt32LE $ + DB.unpack pos + , bam_v1_6_bam_alignment_l_read_name = word8sToWord8LE $ + DB.unpack l_read_name + , bam_v1_6_bam_alignment_mapq = word8sToWord8LE $ + DB.unpack mapq + , bam_v1_6_bam_alignment_bin = word8sToWord16LE $ + DB.unpack bin + , bam_v1_6_bam_alignment_n_cigar_op = word8sToWord16LE $ + DB.unpack n_cigar_op + , bam_v1_6_bam_alignment_flag = word8sToWord16LE $ + DB.unpack flag + , bam_v1_6_bam_alignment_l_seq = word8sToWord32LE $ + DB.unpack l_seq + , bam_v1_6_bam_alignment_next_refID = word8sToInt32LE $ + DB.unpack next_refID + , bam_v1_6_bam_alignment_next_pos = word8sToInt32LE $ + DB.unpack next_pos + , bam_v1_6_bam_alignment_tlen = word8sToInt32LE $ + DB.unpack tlen + , bam_v1_6_bam_alignment_read_name = read_name + , bam_v1_6_bam_alignment_cigar = DSeq.fromList $ + map (word8sToWord32LE . DB.unpack) $ + splitByteString 4 + cigar + , bam_v1_6_bam_alignment_seq = DSeq.fromList $ + decodeSeqField seq + , bam_v1_6_bam_alignment_qual = qual + , bam_v1_6_bam_alignment_optionalfields = optionalfieldbytes + } + where + parse_BAM_V1_6_BAM_Alignment_OptionalFields :: Int + -> Int + -> Parser (Seq BAM_V1_6_BAM_Alignment_OptionalFields) + parse_BAM_V1_6_BAM_Alignment_OptionalFields block_size_int + bytesuptooptionalfields = do + optionalfieldbytes' <- + DABL.take $ + block_size_int - + bytesuptooptionalfields + return $ + parse_OptionalFields optionalfieldbytes' + where + parse_OptionalFields :: DB.ByteString + -> Seq BAM_V1_6_BAM_Alignment_OptionalFields + parse_OptionalFields bs = + case DB.null bs of + True -> + DSeq.empty + False -> + case DB.indexMaybe bs 2 of + Nothing -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Index_Missing + -- AOPT <-> 'A' + Just 0x41 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_AOPT + ( DB.fromStrict $ + DB.take 4 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing AOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 4 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- SmallCOPT <-> 'c' + Just 0x63 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT + ( DB.fromStrict $ + DB.take 4 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing SmallCOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 4 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- BigCOPT <-> 'C' + Just 0x43 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT + ( DB.fromStrict $ + DB.take 4 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BigCOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 4 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- SmallIOPT <-> 'i' + Just 0x69 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT + ( DB.fromStrict $ + DB.take 7 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing SmallIOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 7 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- BigIOPT <-> 'I' + Just 0x49 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT + ( DB.fromStrict $ + DB.take 7 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BigIOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 7 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- SmallSOPT <-> 's' + Just 0x73 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT + ( DB.fromStrict $ + DB.take 5 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing SmallSOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 5 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- BigSOPT <-> 'S' + Just 0x53 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT + ( DB.fromStrict $ + DB.take 5 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BigSOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 5 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- FOPT <-> 'f' + Just 0x66 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_FOPT + ( DB.fromStrict $ + DB.take 7 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing FOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 7 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- ZOPT <-> 'Z' + Just 0x5A -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT + ( DB.fromStrict $ + takeUpTo 0x00 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing ZOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( dropUpTo 0x00 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- HOPT <-> 'H' + Just 0x48 -> + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_HOPT + ( DB.fromStrict $ + takeUpTo 0x00 + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing HOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Just parsedbs + , bam_v1_6_bam_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( dropUpTo 0x00 + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- BOPT <-> 'B' + Just 0x42 -> + case DB.indexMaybe bs 3 of + Nothing -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Missing_Type + Just boptcharacter -> + case boptcharacter of + -- 'c' + 0x63 -> do + let boptcount = fromIntegral $ + word8sToWord32LE $ + DB.unpack $ + DB.take 4 $ + DB.drop 4 + bs + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.take + ( ( boptcount * 1 + ) + 8 + ) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop ( ( boptcount * 1 + ) + 8 + ) + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- 'C' + 0x43 -> do + let boptcount = fromIntegral $ + word8sToWord32LE $ + DB.unpack $ + DB.take 4 $ + DB.drop 4 + bs + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.take + ( ( boptcount * 1 + ) + 8 + ) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop ( ( boptcount * 1 + ) + 8 + ) + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- 'i' + 0x69 -> do + let boptcount = fromIntegral $ + word8sToWord32LE $ + DB.unpack $ + DB.take 4 $ + DB.drop 4 + bs + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.take + ( ( boptcount * 4 + ) + 8 + ) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop ( ( boptcount * 4 + ) + 8 + ) + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- 'I' + 0x49 -> do + let boptcount = fromIntegral $ + word8sToWord32LE $ + DB.unpack $ + DB.take 4 $ + DB.drop 4 + bs + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.take + ( ( boptcount * 4 + ) + 8 + ) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop ( ( boptcount * 4 + ) + 8 + ) + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- 's' + 0x73 -> do + let boptcount = fromIntegral $ + word8sToWord32LE $ + DB.unpack $ + DB.take 4 $ + DB.drop 4 + bs + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.take + ( ( boptcount * 2 + ) + 8 + ) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop ( ( boptcount * 2 + ) + 8 + ) + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- 'S' + 0x53 -> do + let boptcount = fromIntegral $ + word8sToWord32LE $ + DB.unpack $ + DB.take 4 $ + DB.drop 4 + bs + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.take + ( ( boptcount * 2 + ) + 8 + ) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop ( ( boptcount * 2 + ) + 8 + ) + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- 'f' + 0x66 -> do + let boptcount = fromIntegral $ + word8sToWord32LE $ + DB.unpack $ + DB.take 4 $ + DB.drop 4 + bs + case ( DABL.parse parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.take + ( ( boptcount * 4 + ) + 8 + ) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + BAM_V1_6_BAM_Alignment_OptionalFields + { bam_v1_6_bam_alignment_optionalfields_aopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigcopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smalliopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigiopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_smallsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bigsopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_fopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_zopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_hopt = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop ( ( boptcount * 4 + ) + 8 + ) + bs + ) + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + _ -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_BOPT_Missing_Type + _ -> + error $ + show BAM_V1_6_Read_Error_Alignment_OptionalFields_Missing_Type diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/Internal.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/Internal.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/Internal.hs @@ -0,0 +1,79 @@ +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Internal +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Internal ( -- * BAM_V1_6_BAM_BAMAlignments parser - internal functions + decodeSeqField + , dropUpTo + , takeUpTo + ) where + +import Data.Bits +import Data.ByteString as DB hiding (concatMap) +import Data.Word + +-- | Decode SEQ field to a [Word8] +-- (each byte represents two bases). +decodeSeqField :: DB.ByteString + -> [Word8] +decodeSeqField bytes = + concatMap decodeByte (DB.unpack bytes) + where + decodeByte :: Word8 + -> [Word8] + decodeByte byte = + [ byte `shiftR` 4 + , byte .&. 0x0F + ] + +-- | Extract a sub ByteString starting from +-- and including the first occurrence of the given byte. +dropUpTo :: Word8 + -> ByteString + -> ByteString +dropUpTo byte bs = + let (_,suffix) = DB.break (== byte) bs + in case DB.uncons suffix of + Nothing -> + DB.empty -- Specified byte not found, return an empty ByteString. + Just _ -> + suffix + +-- | Extract a sub ByteString up to +-- and including the first occurrence of a given byte. +takeUpTo :: Word8 + -> ByteString + -> ByteString +takeUpTo byte + bs = + let (prefix,suffix) = DB.break (== byte) bs + in case DB.uncons suffix of + Nothing -> + prefix -- No 0x00 found, return the entire ByteString. + Just (_,_) -> + DB.concat [ prefix + , DB.singleton byte + ] diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/AOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/AOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/AOPT.hs @@ -0,0 +1,92 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.AOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.AOPT ( -- * BAM_V1_6_BAM parser - alignment section - aopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_AOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.AOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional aopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_AOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_AOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_AOPT = do + alignmentaoptfieldtag <- do + alignmentaoptfieldtagp <- + DABL.take 2 + -- Parse AOPT tag of the alignment section. + case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_AOPT_Tag_Incorrect_Format + True -> + -- AOPT tag is in the accepted format. + return alignmentaoptfieldtagp + _ <- do + alignmentaoptfieldtypep <- + DABL.take 1 + -- Parse AOPT type of the alignment section. + case (alignmentaoptfieldtypep =~ [re|[A]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_AOPT_Type_Incorrect_Format + True -> + -- AOPT type is in the accepted format. + return () + alignmentaoptfieldvalue <- do + alignmentaoptfieldvaluep <- + DABL.take 1 + -- Parse AOPT value of the alignment section. + case (alignmentaoptfieldvaluep =~ [re|[!-~]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_AOPT_Value_Incorrect_Format + True -> + -- AOPT value is in the accepted format. + return alignmentaoptfieldvaluep + return BAM_V1_6_BAM_Alignment_OptionalFields_AOPT + { bam_v1_6_bam_alignment_optionalfields_aopt_tag = alignmentaoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_aopt_value = word8sToWord8LE $ + DB.unpack alignmentaoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BOPT.hs @@ -0,0 +1,343 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BOPT ( -- * BAM_V1_6_BAM parser - alignment section - bopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Lazy as DABL +import qualified Data.ByteString as DB (unpack) +import qualified Data.ByteString.Char8 as DBC8 +import Data.Sequence as DSeq +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional bopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_BOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BOPT = do + alignmentboptfieldtag <- do + alignmentboptfieldtagp <- + DABL.take 2 + -- Parse BOPT tag of the alignment section. + case (alignmentboptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Tag_Incorrect_Format + True -> + -- BOPT tag is in the accepted format. + return alignmentboptfieldtagp + _ <- do + alignmentboptfieldtypep <- + DABL.take 1 + -- Parse BOPT type of the alignment section. + case (alignmentboptfieldtypep =~ [re|[B]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Type_Incorrect_Format + True -> + -- BOPT type is in the accepted format. + return () + alignmentboptfieldvaluetype <- do + alignmentboptfieldvaluetypep <- + DABL.take 1 + -- Parse BOPT value type of the alignment section. + case (alignmentboptfieldvaluetypep =~ [re|[cCsSiIf]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Type_Incorrect_Format + True -> + -- BOPT value type is in the accepted format. + return alignmentboptfieldvaluetypep + alignmentboptfieldcount <- + DABL.take 4 + case (DBC8.unpack alignmentboptfieldvaluetype) of + "c" -> do + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.take $ + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + ) * 1 + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Just BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int8 + { bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag = alignmentboptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bopt_int8_type = alignmentboptfieldvaluetype + , bam_v1_6_bam_alignment_optionalfields_bopt_int8_count = word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + , bam_v1_6_bam_alignment_optionalfields_bopt_int8_value = DSeq.fromList $ + map (word8sToInt8LE . DB.unpack) $ + splitByteString 1 + alignmentboptfieldvaluedata + } + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Nothing + } + "C" -> do + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.take $ + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + ) * 1 + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Just BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word8 + { bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag = alignmentboptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bopt_word8_type = alignmentboptfieldvaluetype + , bam_v1_6_bam_alignment_optionalfields_bopt_word8_count = word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + , bam_v1_6_bam_alignment_optionalfields_bopt_word8_value = DSeq.fromList $ + map (word8sToWord8LE . DB.unpack) $ + splitByteString 1 + alignmentboptfieldvaluedata + } + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Nothing + } + "s" -> do + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.take $ + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + ) * 2 + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Just BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int16 + { bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag = alignmentboptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bopt_int16_type = alignmentboptfieldvaluetype + , bam_v1_6_bam_alignment_optionalfields_bopt_int16_count = word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + , bam_v1_6_bam_alignment_optionalfields_bopt_int16_value = DSeq.fromList $ + map (word8sToInt16LE . DB.unpack) $ + splitByteString 2 + alignmentboptfieldvaluedata + } + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Nothing + } + "S" -> do + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.take $ + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + ) * 2 + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Just BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word16 + { bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag = alignmentboptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bopt_word16_type = alignmentboptfieldvaluetype + , bam_v1_6_bam_alignment_optionalfields_bopt_word16_count = word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + , bam_v1_6_bam_alignment_optionalfields_bopt_word16_value = DSeq.fromList $ + map (word8sToWord16LE . DB.unpack) $ + splitByteString 2 + alignmentboptfieldvaluedata + } + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Nothing + } + "i" -> do + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.take $ + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + ) * 4 + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Just BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Int32 + { bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag = alignmentboptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bopt_int32_type = alignmentboptfieldvaluetype + , bam_v1_6_bam_alignment_optionalfields_bopt_int32_count = word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + , bam_v1_6_bam_alignment_optionalfields_bopt_int32_value = DSeq.fromList $ + map (word8sToInt32LE . DB.unpack) $ + splitByteString 4 + alignmentboptfieldvaluedata + } + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Nothing + } + "I" -> do + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.take $ + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + ) * 4 + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Just BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Word32 + { bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag = alignmentboptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bopt_word32_type = alignmentboptfieldvaluetype + , bam_v1_6_bam_alignment_optionalfields_bopt_word32_count = word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + , bam_v1_6_bam_alignment_optionalfields_bopt_word32_value = DSeq.fromList $ + map (word8sToWord32LE . DB.unpack) $ + splitByteString 4 + alignmentboptfieldvaluedata + } + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Nothing + } + "f" -> do + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.take $ + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + ) * 4 + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Just BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_Float + { bam_v1_6_bam_alignment_optionalfields_bopt_float_tag = alignmentboptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bopt_float_type = alignmentboptfieldvaluetype + , bam_v1_6_bam_alignment_optionalfields_bopt_float_count = word8sToWord32LE $ + DB.unpack alignmentboptfieldcount + , bam_v1_6_bam_alignment_optionalfields_bopt_float_value = DSeq.fromList $ + map bytestringToFloatLE $ + splitByteString 4 + alignmentboptfieldvaluedata + } + } + _ -> + return BAM_V1_6_BAM_Alignment_OptionalFields_BOPT + { bam_v1_6_bam_alignment_optionalfields_bopt_int8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word8 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word16 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_int32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_word32 = Nothing + , bam_v1_6_bam_alignment_optionalfields_bopt_float = Nothing + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigCOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigCOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigCOPT.hs @@ -0,0 +1,84 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigCOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigCOPT ( -- * BAM_V1_6_BAM parser - alignment section - bigcopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigCOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional bigcopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT = do + alignmentbigcoptfieldtag <- do + alignmentbigcoptfieldtagp <- + DABL.take 2 + -- Parse BigCOPT tag of the alignment section. + case (alignmentbigcoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_BigCOPT_Tag_Incorrect_Format + True -> + -- BigCOPT tag is in the accepted format. + return alignmentbigcoptfieldtagp + _ <- do + alignmentbigcoptfieldtypep <- + DABL.take 1 + -- Parse BigCOPT type of the alignment section. + case (alignmentbigcoptfieldtypep =~ [re|[C]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_BigCOPT_Type_Incorrect_Format + True -> + -- BigCOPT type is in the accepted format. + return () + alignmentbigcoptfieldvalue <- + DABL.take 1 + return BAM_V1_6_BAM_Alignment_OptionalFields_BigCOPT + { bam_v1_6_bam_alignment_optionalfields_bigcopt_tag = alignmentbigcoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bigcopt_value = word8sToWord8LE $ + DB.unpack alignmentbigcoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigIOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigIOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigIOPT.hs @@ -0,0 +1,84 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigIOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigIOPT ( -- * BAM_V1_6_BAM parser - alignment section - bigiopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigIOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional bigiopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT = do + alignmentbigioptfieldtag <- do + alignmentbigioptfieldtagp <- + DABL.take 2 + -- Parse BigIOPT tag of the alignment section. + case (alignmentbigioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_BigIOPT_Tag_Incorrect_Format + True -> + -- BigIOPT tag is in the accepted format. + return alignmentbigioptfieldtagp + _ <- do + alignmentbigioptfieldtypep <- + DABL.take 1 + -- Parse BigIOPT type of the alignment section. + case (alignmentbigioptfieldtypep =~ [re|[I]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_BigIOPT_Type_Incorrect_Format + True -> + -- BigIOPT type is in the accepted format. + return () + alignmentbigioptfieldvalue <- + DABL.take 4 + return BAM_V1_6_BAM_Alignment_OptionalFields_BigIOPT + { bam_v1_6_bam_alignment_optionalfields_bigiopt_tag = alignmentbigioptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bigiopt_value = word8sToWord32LE $ + DB.unpack alignmentbigioptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigSOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigSOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/BigSOPT.hs @@ -0,0 +1,84 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigSOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.BigSOPT ( -- * BAM_V1_6_BAM parser - alignment section - bigsopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigSOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional bigsopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT = do + alignmentbigsoptfieldtag <- do + alignmentbigsoptfieldtagp <- + DABL.take 2 + -- Parse BigSOPT tag of the alignment section. + case (alignmentbigsoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_BigSOPT_Tag_Incorrect_Format + True -> + -- BigSOPT tag is in the accepted format. + return alignmentbigsoptfieldtagp + _ <- do + alignmentbigsoptfieldtypep <- + DABL.take 1 + -- Parse BigSOPT type of the alignment section. + case (alignmentbigsoptfieldtypep =~ [re|[S]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_BigSOPT_Type_Incorrect_Format + True -> + -- BigSOPT type is in the accepted format. + return () + alignmentbigsoptfieldvalue <- + DABL.take 2 + return BAM_V1_6_BAM_Alignment_OptionalFields_BigSOPT + { bam_v1_6_bam_alignment_optionalfields_bigsopt_tag = alignmentbigsoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_bigsopt_value = word8sToWord16LE $ + DB.unpack alignmentbigsoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/FOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/FOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/FOPT.hs @@ -0,0 +1,95 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.FOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.FOPT ( -- * BAM_V1_6 parser - alignment section - fopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_FOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.FOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional fopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_FOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_FOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_FOPT = do + alignmentfoptfieldtag <- do + alignmentfoptfieldtagp <- + DABL.take 2 + -- Parse FOPT tag of the alignment section. + case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_FOPT_Tag_Incorrect_Format + True -> + -- FOPT tag is in the accepted format. + return alignmentfoptfieldtagp + _ <- do + alignmentfoptfieldtypep <- + DABL.take 1 + -- Parse FOPT type of the alignment section. + case (alignmentfoptfieldtypep =~ [re|[f]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_FOPT_Type_Incorrect_Format + True -> + -- FOPT type is in the accepted format. + return () + alignmentfoptfieldvalue <- do + alignmentfoptfieldvaluep <- + DABL.take 4 + -- Parse FOPT value of the alignment section. + case (alignmentfoptfieldvaluep =~ [re|[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_FOPT_Value_Incorrect_Format + True -> + -- FOPT value is in the accepted format. + return alignmentfoptfieldvaluep + return BAM_V1_6_BAM_Alignment_OptionalFields_FOPT + { bam_v1_6_bam_alignment_optionalfields_fopt_tag = alignmentfoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_fopt_value = word8sToWord32LE $ + DB.unpack alignmentfoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/HOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/HOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/HOPT.hs @@ -0,0 +1,110 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.HOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.HOPT ( -- * BAM_V1_6 parser - alignment section - hopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_HOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.HOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString.Base16 as DBB16 +import Data.Base16.Types as DBB16T +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.Sequence as DSeq +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional hopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_HOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_HOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_HOPT = do + alignmenthoptfieldtag <- do + alignmenthoptfieldtagp <- + DABL.take 2 + -- Parse HOPT tag of the alignment section. + case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_HOPT_Tag_Incorrect_Format + True -> + -- HOPT tag is in the accepted format. + return alignmenthoptfieldtagp + _ <- do + alignmenthoptfieldtypep <- + DABL.take 1 + -- Parse HOPT type of the alignment section. + case (alignmenthoptfieldtypep =~ [re|[H]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_HOPT_Type_Incorrect_Format + True -> + -- HOPT type is in the accepted format. + return () + alignmenthoptfieldvalue <- do + alignmenthoptfieldvaluep <- + DABL.takeTill (\x -> x == 0x00) + -- Parse HOPT value of the alignment section. + case (alignmenthoptfieldvaluep =~ [re|([0-9A-F][0-9A-F])*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_HOPT_Value_Incorrect_Format + True -> + -- HOPT value is in the accepted format. + return $ + Prelude.map (\currenthexvalue -> do + case (DBB16.isBase16 alignmenthoptfieldvaluep) of + False -> + error $ + show BAM_V1_6_Read_Error_Alignment_HOPT_Value_Incorrect_Format + True -> + DBB16.decodeBase16 $ + DBB16T.assertBase16 currenthexvalue + ) $ + ( splitByteString 2 + alignmenthoptfieldvaluep + ) + _ <- + DABL.take 1 + return BAM_V1_6_BAM_Alignment_OptionalFields_HOPT + { bam_v1_6_bam_alignment_optionalfields_hopt_tag = alignmenthoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_hopt_value = DSeq.fromList alignmenthoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallCOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallCOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallCOPT.hs @@ -0,0 +1,84 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallCOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallCOPT ( -- * BAM_V1_6_BAM parser - alignment section - smallcopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallCOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.ByteString as DB +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional smallcopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT = do + alignmentsmallcoptfieldtag <- do + alignmentsmallcoptfieldtagp <- + DABL.take 2 + -- Parse SmallCOPT tag of the alignment section. + case (alignmentsmallcoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_SmallCOPT_Tag_Incorrect_Format + True -> + -- SmallCOPT tag is in the accepted format. + return alignmentsmallcoptfieldtagp + _ <- do + alignmentsmallcoptfieldtypep <- + DABL.take 1 + -- Parse SmallCOPT type of the alignment section. + case (alignmentsmallcoptfieldtypep =~ [re|[c]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_SmallCOPT_Type_Incorrect_Format + True -> + -- SmallCOPT type is in the accepted format. + return () + alignmentsmallcoptfieldvalue <- + DABL.take 1 + return BAM_V1_6_BAM_Alignment_OptionalFields_SmallCOPT + { bam_v1_6_bam_alignment_optionalfields_smallcopt_tag = alignmentsmallcoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_smallcopt_value = word8sToInt8LE $ + DB.unpack alignmentsmallcoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallIOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallIOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallIOPT.hs @@ -0,0 +1,84 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallIOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallIOPT ( -- * BAM_V1_6_BAM parser - alignment section - smalliopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallIOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional smalliopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT = do + alignmentsmallioptfieldtag <- do + alignmentsmallioptfieldtagp <- + DABL.take 2 + -- Parse SmallIOPT tag of the alignment section. + case (alignmentsmallioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_SmallIOPT_Tag_Incorrect_Format + True -> + -- SmallIOPT tag is in the accepted format. + return alignmentsmallioptfieldtagp + _ <- do + alignmentsmallioptfieldtypep <- + DABL.take 1 + -- Parse SmallIOPT type of the alignment section. + case (alignmentsmallioptfieldtypep =~ [re|[i]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_SmallIOPT_Type_Incorrect_Format + True -> + -- SmallIOPT type is in the accepted format. + return () + alignmentsmallioptfieldvalue <- + DABL.take 4 + return BAM_V1_6_BAM_Alignment_OptionalFields_SmallIOPT + { bam_v1_6_bam_alignment_optionalfields_smalliopt_tag = alignmentsmallioptfieldtag + , bam_v1_6_bam_alignment_optionalfields_smalliopt_value = word8sToInt32LE $ + DB.unpack alignmentsmallioptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallSOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallSOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/SmallSOPT.hs @@ -0,0 +1,84 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallSOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.SmallSOPT ( -- * BAM_V1_6_BAM parser - alignment section - smallsopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallSOPT +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional smallsopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT = do + alignmentsmallsoptfieldtag <- do + alignmentsmallsoptfieldtagp <- + DABL.take 2 + -- Parse SmallSOPT tag of the alignment section. + case (alignmentsmallsoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_SmallSOPT_Tag_Incorrect_Format + True -> + -- SmallSOPT tag is in the accepted format. + return alignmentsmallsoptfieldtagp + _ <- do + alignmentsmallsoptfieldtypep <- + DABL.take 1 + -- Parse SmallSOPT type of the alignment section. + case (alignmentsmallsoptfieldtypep =~ [re|[s]|]) of + False -> + fail $ show BAM_V1_6_Read_Error_Alignment_SmallSOPT_Type_Incorrect_Format + True -> + -- SmallSOPT type is in the accepted format. + return () + alignmentsmallsoptfieldvalue <- + DABL.take 2 + return BAM_V1_6_BAM_Alignment_OptionalFields_SmallSOPT + { bam_v1_6_bam_alignment_optionalfields_smallsopt_tag = alignmentsmallsoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_smallsopt_value = word8sToInt16LE $ + DB.unpack alignmentsmallsoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/ZOPT.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/ZOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Alignment/OptionalFields/ZOPT.hs @@ -0,0 +1,97 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.SAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.ZOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Alignment.OptionalFields.ZOPT ( -- * BAM_V1_6 parser - alignment section - zopt field + parse_BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT + ) where + +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.ZOPT +import Data.BAM.Version1_6.Read.Error + +import Data.ByteString as DB +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.Sequence as DSeq +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional zopt field of alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT :: Parser BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT +parse_BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT = do + alignmentzoptfieldtag <- do + alignmentzoptfieldtagp <- + DABL.take 2 + -- Parse ZOPT tag of the alignment section. + case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_ZOPT_Tag_Incorrect_Format + True -> + -- ZOPT tag is in the accepted format. + return alignmentzoptfieldtagp + _ <- do + alignmentzoptfieldtypep <- + DABL.take 1 + -- Parse ZOPT type of the alignment section. + case (alignmentzoptfieldtypep =~ [re|[Z]|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_ZOPT_Type_Incorrect_Format + True -> + -- ZOPT type is in the accepted format. + return () + alignmentzoptfieldvalue <- do + alignmentzoptfieldvaluep <- + DABL.takeTill (\x -> x == 0x00) + -- Parse ZOPT value of the alignment section. + case (alignmentzoptfieldvaluep =~ [re|[ !-~]*|]) of + False -> + fail $ + show BAM_V1_6_Read_Error_Alignment_ZOPT_Value_Incorrect_Format + True -> + -- ZOPT value is in the accepted format. + return alignmentzoptfieldvaluep + _ <- + DABL.take 1 + return BAM_V1_6_BAM_Alignment_OptionalFields_ZOPT + { bam_v1_6_bam_alignment_optionalfields_zopt_tag = alignmentzoptfieldtag + , bam_v1_6_bam_alignment_optionalfields_zopt_value = DSeq.fromList $ + DB.unpack alignmentzoptfieldvalue + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/BAMAlignments.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/BAMAlignments.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/BAMAlignments.hs @@ -0,0 +1,34 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.BAMAlignments +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.BAMAlignments ( -- * BAM_V1_6_BAM parser + parse_BAM_V1_6_BAM_BAMAlignments + ) where + +import Data.BAM.Version1_6.BAM.BAMAlignments +import Data.BAM.Version1_6.Read.Parser.BAM.Alignment.Base + +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.Sequence as DSeq + +-- | Define the @"BAM_V1_6_BAM_BAMAlignments"@ parser. +parse_BAM_V1_6_BAM_BAMAlignments :: Parser BAM_V1_6_BAM_BAMAlignments +parse_BAM_V1_6_BAM_BAMAlignments = do + alignments <- + DABL.many' parse_BAM_V1_6_BAM_Alignment + return BAM_V1_6_BAM_BAMAlignments + { bam_v1_6_bam_bamalignments_alignments = DSeq.fromList alignments + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/BAMHeader.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/BAMHeader.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/BAMHeader.hs @@ -0,0 +1,72 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.BAMHeader +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.BAMHeader ( -- * BAM_V1_6_BAM_BAMHeader parser + parse_BAM_V1_6_BAM_BAMHeader + ) where + +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.BAM.BAMHeader +import Data.BAM.Version1_6.Read.Error +import Data.BAM.Version1_6.Read.Parser.BAM.ReferenceInformation.Base + +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.ByteString as DB +import Data.Sequence as DSeq + +-- | Define the @"BAM_V1_6_BAM_BAMHeader"@ parser. +parse_BAM_V1_6_BAM_BAMHeader :: Parser BAM_V1_6_BAM_BAMHeader +parse_BAM_V1_6_BAM_BAMHeader = do + magic <- do + magicp <- + DABL.take 4 + case (magicp == bammagicstring) of + False -> + fail $ + show BAM_V1_6_Read_Error_BAMHeader_BAM_Magic_String_Invalid_Value + True -> + return magicp + l_text <- + DABL.take 4 + text <- + DABL.take + ( fromIntegral $ + word8sToWord32LE $ + DB.unpack l_text -- :: Int + ) + n_ref <- + DABL.take 4 + reference_information <- + DABL.count ( fromIntegral $ + word8sToWord32LE $ + DB.unpack n_ref :: Int + ) + parse_BAM_V1_6_BAM_Reference_Information + return BAM_V1_6_BAM_BAMHeader + { bam_v1_6_bam_bamheader_magic = magic + , bam_v1_6_bam_bamheader_l_text = word8sToWord32LE $ + DB.unpack l_text + , bam_v1_6_bam_bamheader_text = text + , bam_v1_6_bam_bamheader_n_ref = word8sToWord32LE $ + DB.unpack n_ref + , bam_v1_6_bam_bamheader_reference_information = DSeq.fromList reference_information + } + where + bammagicstring = DB.pack [ 0x42 + , 0x41 + , 0x4D + , 0x01 + ] diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/Base.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/Base.hs @@ -0,0 +1,57 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.Base ( -- * BAM_V1_6_BAM parser + parse_BAM_V1_6_BAM + ) where + +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.BAM +import Data.BAM.Version1_6.Read.Parser.BAM.BAMAlignments +import Data.BAM.Version1_6.Read.Parser.BAM.BAMHeader + +import Data.Attoparsec.ByteString.Lazy as DABL + +-- | Define the @"BAM_V1_6_BAM"@ parser. +parse_BAM_V1_6_BAM :: Parser BAM_V1_6_BAM +parse_BAM_V1_6_BAM = do + emptycdatablock <- + peekWord8 + case emptycdatablock of + Nothing -> + return BAM_V1_6_BAM + { bam_v1_6_bam_bamheader = Nothing + , bam_v1_6_bam_bamalignments = Nothing + , bam_v1_6_bam_endoffilemarker = True + } + Just _ -> do + header <- + maybeOption parse_BAM_V1_6_BAM_BAMHeader + case header of + Nothing -> do + alignments <- + parse_BAM_V1_6_BAM_BAMAlignments + return BAM_V1_6_BAM + { bam_v1_6_bam_bamheader = Nothing + , bam_v1_6_bam_bamalignments = Just alignments + , bam_v1_6_bam_endoffilemarker = False + } + Just header' -> + return BAM_V1_6_BAM + { bam_v1_6_bam_bamheader = Just header' + , bam_v1_6_bam_bamalignments = Nothing + , bam_v1_6_bam_endoffilemarker = False + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BAM/ReferenceInformation/Base.hs b/src/Data/BAM/Version1_6/Read/Parser/BAM/ReferenceInformation/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BAM/ReferenceInformation/Base.hs @@ -0,0 +1,66 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} +{-# OPTIONS_GHC -fno-warn-name-shadowing #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BAM.ReferenceInformation.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BAM.ReferenceInformation.Base ( -- * BAM_V1_6_BAM parser - reference information section + parse_BAM_V1_6_BAM_Reference_Information + ) where + +import Data.BAM.Version1_6.BAM.ReferenceInformation +import Data.BAM.Version1_6.Internal + +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.ByteString as DB + +-- | @"BAM_V1_6_BAM_Reference_Information"@ parser. +-- +-- Defines a parser for the alignment section of the BAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BAM_Reference_Information :: Parser BAM_V1_6_BAM_Reference_Information +parse_BAM_V1_6_BAM_Reference_Information = do + l_name <- + DABL.take 4 + name <- + DABL.take $ + fromIntegral $ + word8sToWord32LE $ + DB.unpack l_name + l_ref <- + DABL.take 4 + return BAM_V1_6_BAM_Reference_Information + { bam_v1_6_bam_reference_information_l_name = word8sToWord32LE $ + DB.unpack l_name + , bam_v1_6_bam_reference_information_name = name + , bam_v1_6_bam_reference_information_l_ref = word8sToWord32LE $ + DB.unpack l_ref + } diff --git a/src/Data/BAM/Version1_6/Read/Parser/BGZFBlock.hs b/src/Data/BAM/Version1_6/Read/Parser/BGZFBlock.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Read/Parser/BGZFBlock.hs @@ -0,0 +1,268 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Read.Parser.BGZFBlock +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Read.Parser.BGZFBlock ( -- * BAM_V1_6 parser - BGZF block section. + parse_BAM_V1_6_BGZFBlock + ) where + +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Read.Parser.BAM.Base +import Data.BAM.Version1_6.BGZFBlock +import Data.BAM.Version1_6.GZipHeader +import Data.BAM.Version1_6.Read.Error + +import Codec.Compression.Zlib.Raw as CCZlibR (decompress) +import Data.Attoparsec.ByteString.Lazy as DABL +import qualified Data.ByteString as DB (fromStrict,unpack) +import Data.Digest.CRC32 (crc32) +import Data.Word + +-- | Defines a parser for a single BGZF block. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_BAM_V1_6_BGZFBlock :: Parser BAM_V1_6_BGZFBlock +parse_BAM_V1_6_BGZFBlock = do + gzipheaderidentification1field <- do + gzipheaderidentification1fieldp <- + DABL.take 1 + -- Parse GZip header Identification 1 field. + case ( ( word8sToWord8LE $ + DB.unpack gzipheaderidentification1fieldp + ) == 0x1f + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_GZipHeader_ID1_Incorrect_Format + True -> do + -- Identification field 1 is in the accepted format. + return gzipheaderidentification1fieldp + gzipheaderidentification2field <- do + gzipheaderidentification2fieldp <- + DABL.take 1 + -- Parse GZip header Identification 2 field. + case ( ( word8sToWord8LE $ + DB.unpack gzipheaderidentification2fieldp + ) == 0x8b + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_GZipHeader_ID2_Incorrect_Format + True -> + -- Identification field 2 is in the accepted format. + return gzipheaderidentification2fieldp + gzipheadercompressionmethodfield <- do + gzipheadercompressionmethodfieldp <- + DABL.take 1 + -- Parse GZip header Compression Method field. + case ( elem + ( word8sToWord8LE $ + DB.unpack gzipheadercompressionmethodfieldp + ) + compressionmethodpossiblebytes + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_GZipHeader_Compression_Method_Incorrect_Format + True -> + -- Compression Method is in the accepted format. + return gzipheadercompressionmethodfieldp + gzipheaderflagsfield <- do + gzipheaderflagsfieldp <- + DABL.take 1 + -- Parse GZip Flags (FLaGs) field. + case ( elem + ( word8sToWord8LE $ + DB.unpack gzipheaderflagsfieldp + ) + flagpossiblebytes + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_GZipHeader_Flag_Incorrect_Format + True -> + -- Flags (FLaGs) is in the accepted format. + return gzipheaderflagsfieldp + gzipheadermodificationtimefield <- + DABL.take 4 + gzipheaderextraflagsfield <- + DABL.take 1 + gzipheaderoperatingsystemfield <- do + gzipheaderoperatingsystemfieldp <- + DABL.take 1 + -- Parse GZip header Operating System field. + case ( elem + ( word8sToWord8LE $ + DB.unpack gzipheaderoperatingsystemfieldp + ) + operatingsystempossiblebytes + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_GZipHeader_Operating_System_Incorrect_Format + True -> + -- Operating System is in the accepted format. + return gzipheaderoperatingsystemfieldp + gzipheaderextralengthfield <- + DABL.take 2 + let gzipheader = BAM_V1_6_GZipHeader + { bam_v1_6_gzip_header_gzip_identifier_1 = word8sToWord8LE $ + DB.unpack gzipheaderidentification1field + , bam_v1_6_gzip_header_gzip_identifier_2 = word8sToWord8LE $ + DB.unpack gzipheaderidentification2field + , bam_v1_6_gzip_header_compression_method = word8sToWord8LE $ + DB.unpack gzipheadercompressionmethodfield + , bam_v1_6_gzip_header_header_flags = word8sToWord8LE $ + DB.unpack gzipheaderflagsfield + , bam_v1_6_gzip_header_modification_time = word8sToWord32LE $ + DB.unpack gzipheadermodificationtimefield + , bam_v1_6_gzip_header_extra_flags = word8sToWord8LE $ + DB.unpack gzipheaderextraflagsfield + , bam_v1_6_gzip_header_operating_system = word8sToWord8LE $ + DB.unpack gzipheaderoperatingsystemfield + , bam_v1_6_gzip_header_extra_length = word8sToWord16LE $ + DB.unpack gzipheaderextralengthfield + } + bgzfblocksubfieldidentifier1field <- do + bgzfblocksubfieldidentifier1fieldp <- + DABL.take 1 + -- Parse GZip header Subfield Identifier 1 field. + case ( ( word8sToWord8LE $ + DB.unpack bgzfblocksubfieldidentifier1fieldp + ) == 0x42 + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_GZipHeader_Subfield_Identifier_1_Incorrect_Format + True -> + -- Subfield Identifier 1 is in the accepted format. + return bgzfblocksubfieldidentifier1fieldp + bgzfblocksubfieldidentifier2field <- do + bgzfblocksubfieldidentifier2fieldp <- + DABL.take 1 + -- Parse GZip header Subfield Identifier 2 field. + case ( ( word8sToWord8LE $ + DB.unpack bgzfblocksubfieldidentifier2fieldp + ) == 0x43 + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_GZipHeader_Subfield_Identifier_2_Incorrect_Format + True -> + -- Subfield Identifier 2 is in the accepted format. + return bgzfblocksubfieldidentifier2fieldp + bgzfblocksubfieldlengthfield <- + DABL.take 2 + bgzfblocktotalblocksizeminus1field <- + DABL.take 2 + bgzfblockcdata <- + DABL.take $ + ( fromIntegral $ + word8sToWord16LE $ + DB.unpack bgzfblocktotalblocksizeminus1field + ) - + ( fromIntegral $ + bam_v1_6_gzip_header_extra_length gzipheader + ) - + 19 + let bgzfblockcdataf = CCZlibR.decompress $ + DB.fromStrict bgzfblockcdata + case (parseOnly parse_BAM_V1_6_BAM bgzfblockcdataf) of + Left _ -> + fail $ + show BAM_V1_6_Read_Error_CDATA_Incorrect_Format + Right bgzfblockcdataf' -> do + bgzfblockcrc32field <- + DABL.take 4 + case (crc32 bgzfblockcdataf == ( word8sToWord32LE $ + DB.unpack bgzfblockcrc32field + ) + ) of + False -> + fail $ + show BAM_V1_6_Read_Error_Calculated_CRC32_Not_Equivalent_To_CRC32 + True -> do + bgzfblockisizefield <- + DABL.take 4 + return BAM_V1_6_BGZFBlock + { bam_v1_6_bgzfblock_gzip_header = gzipheader + , bam_v1_6_bgzfblock_subfield_identifier_one = word8sToWord8LE $ + DB.unpack bgzfblocksubfieldidentifier1field + , bam_v1_6_bgzfblock_subfield_identifier_two = word8sToWord8LE $ + DB.unpack bgzfblocksubfieldidentifier2field + , bam_v1_6_bgzfblock_subfield_length = word8sToWord16LE $ + DB.unpack bgzfblocksubfieldlengthfield + , bam_v1_6_bgzfblock_total_block_size_minus_one = word8sToWord16LE $ + DB.unpack bgzfblocktotalblocksizeminus1field + , bam_v1_6_bgzfblock_cdata = bgzfblockcdataf' + , bam_v1_6_bgzfblock_crc32 = word8sToWord32LE $ + DB.unpack bgzfblockcrc32field + , bam_v1_6_bgzfblock_isize = word8sToWord32LE $ + DB.unpack bgzfblockisizefield + } + where + compressionmethodpossiblebytes = [ 0x00 + , 0x01 + , 0x02 + , 0x03 + , 0x04 + , 0x05 + , 0x06 + , 0x07 + , 0x08 + ] :: [Word8] + flagpossiblebytes = [ 0x00 + , 0x01 + , 0x02 + , 0x03 + , 0x04 + , 0x05 + , 0x06 + , 0x07 + ] :: [Word8] + operatingsystempossiblebytes = [ 0x00 + , 0x01 + , 0x02 + , 0x03 + , 0x04 + , 0x05 + , 0x06 + , 0x07 + , 0x08 + , 0x09 + , 0x0A + , 0x0B + , 0x0C + , 0x0D + , 0xFF + ] :: [Word8] diff --git a/src/Data/BAM/Version1_6/Write/Base.hs b/src/Data/BAM/Version1_6/Write/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Write/Base.hs @@ -0,0 +1,1082 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Write.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Write.Base ( -- * Writing + writeBAM_V1_6 + ) where + +import Data.BAM.Version1_6.Base +import Data.BAM.Version1_6.BAM +import Data.BAM.Version1_6.BAM.BAMAlignments +import Data.BAM.Version1_6.BAM.BAMHeader +import Data.BAM.Version1_6.BAM.Alignment.Base +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.Base +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.AOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigCOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigIOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BigSOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallCOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallIOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.SmallSOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.FOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.ZOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.HOPT +import Data.BAM.Version1_6.BAM.Alignment.OptionalFields.BOPT +import Data.BAM.Version1_6.BAM.ReferenceInformation +import Data.BAM.Version1_6.BGZFBlock +import Data.BAM.Version1_6.GZipHeader +import Data.BAM.Version1_6.Internal +import Data.BAM.Version1_6.Write.Error +import Data.BAM.Version1_6.Write.Internal + +import Codec.Compression.Zlib.Raw as CCZlibR (compress) +import Data.ByteString as DB (append,concat,empty,fromStrict,hPutStr,length,pack,singleton,toStrict) +import Data.ByteString.Base16 as DBB16 +import Data.Base16.Types as DBB16T +import Data.Digest.CRC32 as DDCRC32 (crc32) +import Data.Foldable (forM_,toList) +import Data.List as DL (elem) +import Data.Maybe (fromJust) +import System.IO (hFlush,hClose,IOMode(..),openBinaryFile,Handle) + +-- | Deconstruct a @"BAM_V1_6"@ and +-- write to a file. +deconstructBAM_V1_6 :: Handle + -> BAM_V1_6 + -> IO () +deconstructBAM_V1_6 h + bamv16 = + forM_ (bam_v1_6 bamv16) $ \currentbgzfblock -> + case ( bam_v1_6_bam_endoffilemarker $ + bam_v1_6_bgzfblock_cdata currentbgzfblock + ) of + True -> do + -- Write to file. + -- GZip header. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_gzip_identifier_1 $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_gzip_identifier_2 $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_compression_method $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_header_flags $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + word32ToByteStringLE $ + bam_v1_6_gzip_header_modification_time $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_extra_flags $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_operating_system $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + bam_v1_6_gzip_header_extra_length $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + -- Subfield Identifier 1. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_bgzfblock_subfield_identifier_one currentbgzfblock + -- Subfield Identifier 2. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_bgzfblock_subfield_identifier_two currentbgzfblock + -- Subfield LENgth. + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + bam_v1_6_bgzfblock_subfield_length currentbgzfblock + -- total Block SIZE minus 1. + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + bam_v1_6_bgzfblock_total_block_size_minus_one currentbgzfblock + -- Write the empty CDATA block. + _ <- + DB.hPutStr h $ + DB.pack + [ 0x03 + , 0x00 + ] + -- CRC-32. + _ <- + DB.hPutStr h $ + word32ToByteStringLE $ + bam_v1_6_bgzfblock_crc32 currentbgzfblock + -- Input SIZE (length of uncompressed data). + DB.hPutStr h $ + word32ToByteStringLE $ + bam_v1_6_bgzfblock_isize currentbgzfblock + False -> + case ( bam_v1_6_bam_bamheader $ + bam_v1_6_bgzfblock_cdata currentbgzfblock + ) of + Nothing -> + case ( bam_v1_6_bam_bamalignments $ + bam_v1_6_bgzfblock_cdata currentbgzfblock + ) of + Nothing -> + error $ + show BAM_V1_6_Write_Error_No_Data + Just bam_v1_6_bam_bamalignments' -> do + -- Write to file. + -- GZip header. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_gzip_identifier_1 $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_gzip_identifier_2 $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_compression_method $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_header_flags $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + word32ToByteStringLE $ + bam_v1_6_gzip_header_modification_time $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_extra_flags $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_operating_system $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + bam_v1_6_gzip_header_extra_length $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + -- Subfield Identifier 1. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_bgzfblock_subfield_identifier_one currentbgzfblock + -- Subfield Identifier 2. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_bgzfblock_subfield_identifier_two currentbgzfblock + -- Subfield LENgth. + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + bam_v1_6_bgzfblock_subfield_length currentbgzfblock + let bam_v1_6_bam_bamalignments'' = fmap (\currentbamalignmentrecord -> do + let preoptionalfields = ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_block_size currentbamalignmentrecord + ) + `DB.append` + ( int32ToByteStringLE $ + bam_v1_6_bam_alignment_refID currentbamalignmentrecord + ) + `DB.append` + ( int32ToByteStringLE $ + bam_v1_6_bam_alignment_pos currentbamalignmentrecord + ) + `DB.append` + ( DB.singleton $ + bam_v1_6_bam_alignment_l_read_name currentbamalignmentrecord + ) + `DB.append` + ( DB.singleton $ + bam_v1_6_bam_alignment_mapq currentbamalignmentrecord + ) + `DB.append` + ( word16ToByteStringLE $ + bam_v1_6_bam_alignment_bin currentbamalignmentrecord + ) + `DB.append` + ( word16ToByteStringLE $ + bam_v1_6_bam_alignment_n_cigar_op currentbamalignmentrecord + ) + `DB.append` + ( word16ToByteStringLE $ + bam_v1_6_bam_alignment_flag currentbamalignmentrecord + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_l_seq currentbamalignmentrecord + ) + `DB.append` + ( int32ToByteStringLE $ + bam_v1_6_bam_alignment_next_refID currentbamalignmentrecord + ) + `DB.append` + ( int32ToByteStringLE $ + bam_v1_6_bam_alignment_next_pos currentbamalignmentrecord + ) + `DB.append` + ( int32ToByteStringLE $ + bam_v1_6_bam_alignment_tlen currentbamalignmentrecord + ) + `DB.append` + bam_v1_6_bam_alignment_read_name currentbamalignmentrecord + `DB.append` + ( DB.concat $ + toList $ + fmap (\currentcigar -> + word32ToByteStringLE currentcigar + ) + (bam_v1_6_bam_alignment_cigar currentbamalignmentrecord) + ) + `DB.append` + ( encodeSeqField $ + toList $ + bam_v1_6_bam_alignment_seq currentbamalignmentrecord + ) + `DB.append` + ( bam_v1_6_bam_alignment_qual currentbamalignmentrecord + ) + let optionalfields = DB.concat $ + toList $ + fmap (\currentbamalignmentoptionalfield -> do + -- Walk through optional fields. + let optionalfieldsl = [ case ( bam_v1_6_bam_alignment_optionalfields_aopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + AOPT + , case ( bam_v1_6_bam_alignment_optionalfields_smallcopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + SmallCOPT + , case ( bam_v1_6_bam_alignment_optionalfields_bigcopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + BigCOPT + , case ( bam_v1_6_bam_alignment_optionalfields_smalliopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + SmallIOPT + , case ( bam_v1_6_bam_alignment_optionalfields_bigiopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + BigIOPT + , case ( bam_v1_6_bam_alignment_optionalfields_smallsopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + SmallSOPT + , case ( bam_v1_6_bam_alignment_optionalfields_bigsopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + BigSOPT + , case ( bam_v1_6_bam_alignment_optionalfields_fopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + FOPT + , case ( bam_v1_6_bam_alignment_optionalfields_zopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + ZOPT + , case ( bam_v1_6_bam_alignment_optionalfields_hopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + HOPT + , case ( bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + Empty + Just _ -> + BOPT + ] :: [BAM_V1_6_BAM_Alignment_OptionalFields_SumType] + if | AOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_aopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_aopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x41 --'A' + ) + `DB.append` + ( DB.singleton $ + bam_v1_6_bam_alignment_optionalfields_aopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_aopt + currentbamalignmentoptionalfield + ) + | SmallCOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_smallcopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_smallcopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x63 --'c' + ) + `DB.append` + ( int8ToByteString $ + bam_v1_6_bam_alignment_optionalfields_smallcopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_smallcopt + currentbamalignmentoptionalfield + ) + | BigCOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_bigcopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bigcopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x43 --'C' + ) + `DB.append` + ( DB.singleton $ + bam_v1_6_bam_alignment_optionalfields_bigcopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bigcopt + currentbamalignmentoptionalfield + ) + | SmallIOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_smalliopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_smalliopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x69 --'i' + ) + `DB.append` + ( int32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_smalliopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_smalliopt + currentbamalignmentoptionalfield + ) + | BigIOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_bigiopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bigiopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x49 --'I' + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bigiopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bigiopt + currentbamalignmentoptionalfield + ) + | SmallSOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_smallsopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_smallsopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x73 --'s' + ) + `DB.append` + ( int16ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_smallsopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_smallsopt + currentbamalignmentoptionalfield + ) + | BigSOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_bigsopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bigsopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x53 --'S' + ) + `DB.append` + ( word16ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bigsopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bigsopt + currentbamalignmentoptionalfield + ) + | FOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_fopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_fopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x66 --'f' + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_fopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_fopt + currentbamalignmentoptionalfield + ) + | ZOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_zopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_zopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x5A --'Z' + ) + `DB.append` + ( DB.pack $ + toList $ + bam_v1_6_bam_alignment_optionalfields_zopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_zopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x00 + ) + | HOPT `DL.elem` optionalfieldsl + -> ( bam_v1_6_bam_alignment_optionalfields_hopt_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_hopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x48 --'H' + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currenthexvalue -> + case ( DBB16.isBase16 ( DBB16T.extractBase16 $ + DBB16.encodeBase16' currenthexvalue + ) + ) of + False -> + error $ + show BAM_V1_6_Write_Error_HOPT_Incorrect_Format + True -> + DBB16T.extractBase16 $ + DBB16.encodeBase16' currenthexvalue + ) + ( bam_v1_6_bam_alignment_optionalfields_hopt_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_hopt + currentbamalignmentoptionalfield + ) + ) + ) + `DB.append` + ( DB.singleton 0x00 + ) + | BOPT `DL.elem` optionalfieldsl + -> do + let optionalfieldsboptl = [ case ( bam_v1_6_bam_alignment_optionalfields_bopt_int8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + BOPTEmpty + Just _ -> + BOPTInt8 + , case ( bam_v1_6_bam_alignment_optionalfields_bopt_word8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + BOPTEmpty + Just _ -> + BOPTWord8 + , case ( bam_v1_6_bam_alignment_optionalfields_bopt_int16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + BOPTEmpty + Just _ -> + BOPTInt16 + , case ( bam_v1_6_bam_alignment_optionalfields_bopt_word16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + BOPTEmpty + Just _ -> + BOPTWord16 + , case ( bam_v1_6_bam_alignment_optionalfields_bopt_int32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + BOPTEmpty + Just _ -> + BOPTInt32 + , case ( bam_v1_6_bam_alignment_optionalfields_bopt_word32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + BOPTEmpty + Just _ -> + BOPTWord32 + , case ( bam_v1_6_bam_alignment_optionalfields_bopt_float $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) of + Nothing -> + BOPTEmpty + Just _ -> + BOPTFloat + ] :: [BAM_V1_6_BAM_Alignment_OptionalFields_BOPT_SumType] + if | BOPTInt8 `DL.elem` optionalfieldsboptl + -> ( bam_v1_6_bam_alignment_optionalfields_bopt_int8_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x42 --'B' + ) + `DB.append` + ( bam_v1_6_bam_alignment_optionalfields_bopt_int8_type $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bopt_int8_count $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currentint8value -> + int8ToByteString currentint8value + ) + ( bam_v1_6_bam_alignment_optionalfields_bopt_int8_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + ) + ) + | BOPTWord8 `DL.elem` optionalfieldsboptl + -> ( bam_v1_6_bam_alignment_optionalfields_bopt_word8_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x42 --'B' + ) + `DB.append` + ( bam_v1_6_bam_alignment_optionalfields_bopt_word8_type $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bopt_word8_count $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currentword8value -> + DB.singleton currentword8value + ) + ( bam_v1_6_bam_alignment_optionalfields_bopt_word8_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word8 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + ) + ) + | BOPTInt16 `DL.elem` optionalfieldsboptl + -> ( bam_v1_6_bam_alignment_optionalfields_bopt_int16_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x42 --'B' + ) + `DB.append` + ( bam_v1_6_bam_alignment_optionalfields_bopt_int16_type $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bopt_int16_count $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currentint16value -> + int16ToByteStringLE currentint16value + ) + ( bam_v1_6_bam_alignment_optionalfields_bopt_int16_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + ) + ) + | BOPTWord16 `DL.elem` optionalfieldsboptl + -> ( bam_v1_6_bam_alignment_optionalfields_bopt_word16_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x42 --'B' + ) + `DB.append` + ( bam_v1_6_bam_alignment_optionalfields_bopt_word16_type $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bopt_word16_count $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currentword16value -> + word16ToByteStringLE currentword16value + ) + ( bam_v1_6_bam_alignment_optionalfields_bopt_word16_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word16 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + ) + ) + | BOPTInt32 `DL.elem` optionalfieldsboptl + -> ( bam_v1_6_bam_alignment_optionalfields_bopt_int32_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x42 --'B' + ) + `DB.append` + ( bam_v1_6_bam_alignment_optionalfields_bopt_int32_type $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bopt_int32_count $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currentint32value -> + int32ToByteStringLE currentint32value + ) + ( bam_v1_6_bam_alignment_optionalfields_bopt_int32_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_int32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + ) + ) + | BOPTWord32 `DL.elem` optionalfieldsboptl + -> ( bam_v1_6_bam_alignment_optionalfields_bopt_word32_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x42 --'B' + ) + `DB.append` + ( bam_v1_6_bam_alignment_optionalfields_bopt_word32_type $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bopt_word32_count $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currentword32value -> + word32ToByteStringLE currentword32value + ) + ( bam_v1_6_bam_alignment_optionalfields_bopt_word32_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_word32 $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + ) + ) + | BOPTFloat `DL.elem` optionalfieldsboptl + -> ( bam_v1_6_bam_alignment_optionalfields_bopt_float_tag $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_float $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.singleton 0x42 --'B' + ) + `DB.append` + ( bam_v1_6_bam_alignment_optionalfields_bopt_float_type $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_float $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_alignment_optionalfields_bopt_float_count $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_float $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + `DB.append` + ( DB.concat $ + toList + ( fmap (\currentfloatvalue -> + floatToByteStringLE currentfloatvalue + ) + ( bam_v1_6_bam_alignment_optionalfields_bopt_float_value $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt_float $ + fromJust $ + bam_v1_6_bam_alignment_optionalfields_bopt + currentbamalignmentoptionalfield + ) + ) + ) + | BOPTEmpty `DL.elem` optionalfieldsboptl + -> DB.empty + | otherwise + -> DB.empty + | Empty `DL.elem` optionalfieldsl + -> DB.empty + | otherwise + -> DB.empty + ) + ( bam_v1_6_bam_alignment_optionalfields currentbamalignmentrecord + ) + preoptionalfields `DB.append` optionalfields + ) + ( bam_v1_6_bam_bamalignments_alignments bam_v1_6_bam_bamalignments' + ) + let bam_v1_6_bam_bamalignments''' = DB.toStrict $ + CCZlibR.compress $ + DB.fromStrict $ + DB.concat $ + toList bam_v1_6_bam_bamalignments'' + -- total Block SIZE minus 1. + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + intToWord16LE ((DB.length bam_v1_6_bam_bamalignments''' + 26) - 1) + -- Write the BAM alignment(s). + _ <- + DB.hPutStr h + bam_v1_6_bam_bamalignments''' + -- CRC-32. + _ <- + DB.hPutStr h $ + word32ToByteStringLE $ + DDCRC32.crc32 $ + DB.concat $ + toList bam_v1_6_bam_bamalignments'' + -- Input SIZE (length of uncompressed data). + DB.hPutStr h $ + word32ToByteStringLE $ + intToWord32LE $ + DB.length $ + DB.concat $ + toList bam_v1_6_bam_bamalignments'' + Just bam_v1_6_bam_bamheader' -> do + -- Write to file. + -- GZip header. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_gzip_identifier_1 $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_gzip_identifier_2 $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_compression_method $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_header_flags $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + word32ToByteStringLE $ + bam_v1_6_gzip_header_modification_time $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_extra_flags $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_gzip_header_operating_system $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + bam_v1_6_gzip_header_extra_length $ + bam_v1_6_bgzfblock_gzip_header currentbgzfblock + -- Subfield Identifier 1. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_bgzfblock_subfield_identifier_one currentbgzfblock + -- Subfield Identifier 2. + _ <- + DB.hPutStr h $ + DB.singleton $ + bam_v1_6_bgzfblock_subfield_identifier_two currentbgzfblock + -- Subfield LENgth. + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + bam_v1_6_bgzfblock_subfield_length currentbgzfblock + let bam_v1_6_bam_bamheader'' = bam_v1_6_bam_bamheader_magic bam_v1_6_bam_bamheader' + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_bamheader_l_text bam_v1_6_bam_bamheader' + ) + `DB.append` + bam_v1_6_bam_bamheader_text bam_v1_6_bam_bamheader' + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_bamheader_n_ref bam_v1_6_bam_bamheader' + ) + let bam_v1_6_bam_bamheader_reference_information' = DB.concat $ + toList $ + fmap (\currentreferenceinformation -> + ( word32ToByteStringLE $ + bam_v1_6_bam_reference_information_l_name currentreferenceinformation + ) + `DB.append` + bam_v1_6_bam_reference_information_name currentreferenceinformation + `DB.append` + ( word32ToByteStringLE $ + bam_v1_6_bam_reference_information_l_ref currentreferenceinformation + ) + ) + (bam_v1_6_bam_bamheader_reference_information bam_v1_6_bam_bamheader') + let bam_v1_6_bam_bamheader''' = DB.toStrict $ + CCZlibR.compress $ + DB.fromStrict $ + bam_v1_6_bam_bamheader'' + `DB.append` + bam_v1_6_bam_bamheader_reference_information' + -- total Block SIZE minus 1. + _ <- + DB.hPutStr h $ + word16ToByteStringLE $ + intToWord16LE ((DB.length bam_v1_6_bam_bamheader''' + 26) - 1) + -- Write the BAM header. + _ <- + DB.hPutStr h + bam_v1_6_bam_bamheader''' + -- CRC-32. + _ <- + DB.hPutStr h $ + word32ToByteStringLE $ + DDCRC32.crc32 $ + bam_v1_6_bam_bamheader'' + `DB.append` + bam_v1_6_bam_bamheader_reference_information' + -- Input SIZE (length of uncompressed data). + DB.hPutStr h $ + word32ToByteStringLE $ + intToWord32LE $ + DB.length $ + bam_v1_6_bam_bamheader'' + `DB.append` + bam_v1_6_bam_bamheader_reference_information' + +-- | Write a @"BAM_V1_6"@ to a file. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +writeBAM_V1_6 :: FilePath -- ^ Output path to BAM file. + -> BAM_V1_6 + -> IO () +writeBAM_V1_6 fp bamv16 = do + h <- openBinaryFile fp + WriteMode + deconstructBAM_V1_6 h + bamv16 + hFlush h + hClose h diff --git a/src/Data/BAM/Version1_6/Write/Error.hs b/src/Data/BAM/Version1_6/Write/Error.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Write/Error.hs @@ -0,0 +1,33 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.BAM.Version1_6.Write.Error +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Write.Error ( -- * BAM version 1.6 data type + BAM_V1_6_Write_Error(..) + ) where + +import Data.Data +import Generics.Deriving.Base + +-- | Custom @"BAM_V1_6"@ (BAM version 1.6) error data type. +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data BAM_V1_6_Write_Error = -- | No data to write to file. + BAM_V1_6_Write_Error_No_Data + | -- | HOPT alignment optional field is not hex-formatted byte array. + BAM_V1_6_Write_Error_HOPT_Incorrect_Format + deriving (Eq,Generic,Show,Typeable) diff --git a/src/Data/BAM/Version1_6/Write/Internal.hs b/src/Data/BAM/Version1_6/Write/Internal.hs new file mode 100644 --- /dev/null +++ b/src/Data/BAM/Version1_6/Write/Internal.hs @@ -0,0 +1,68 @@ +-- | +-- Module : Data.BAM.Version1_6.Write.Internal +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.BAM.Version1_6.Write.Internal ( -- * BAM_V1_6 writing - internal functions + encodeSeqField + ) where + +import Data.ByteString as DB hiding (concatMap,length) +import Data.Bits +import Data.List as DL +import Data.Word + +-- | Encode a [Word8] (each byte represents two bases) +-- into a ByteString representing the SEQ field. +encodeSeqField :: [Word8] + -> DB.ByteString +encodeSeqField bases = + DB.pack $ + concatMap encodeByte pairs + where + pairs = + case ( odd $ DL.length bases + ) of + True -> + pairsWithPadding bases + False -> + pairsWithoutPadding bases + encodeByte :: (Word8,Word8) + -> [Word8] + encodeByte (high,low) = + [ (high `shiftL` 4) + .|. + low + ] + pairsWithPadding :: [Word8] + -> [(Word8,Word8)] + pairsWithPadding [] = [] + pairsWithPadding [x] = [(x,0)] + pairsWithPadding (x:y:xs) = (x,y) : pairsWithPadding xs + pairsWithoutPadding :: [Word8] + -> [(Word8,Word8)] + pairsWithoutPadding [] = [] + pairsWithoutPadding [_] = [] + pairsWithoutPadding (x:y:xs) = (x,y) : pairsWithoutPadding xs diff --git a/src/Data/SAM/Version1_6/Alignment.hs b/src/Data/SAM/Version1_6/Alignment.hs --- a/src/Data/SAM/Version1_6/Alignment.hs +++ b/src/Data/SAM/Version1_6/Alignment.hs @@ -5,7 +5,7 @@ -- | -- Module : Data.SAM.Version1_6.Alignment --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable diff --git a/src/Data/SAM/Version1_6/Alignment/AOPT.hs b/src/Data/SAM/Version1_6/Alignment/AOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Alignment/AOPT.hs +++ /dev/null @@ -1,68 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE TypeFamilies #-} - --- | --- Module : Data.SAM.Version1_6.Alignment.AOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Alignment.AOPT ( -- * SAM version 1.6 alignment optional fields data type - SAM_V1_6_Alignment_AOPT(..) - ) where - -import Data.ByteString (ByteString) -import Data.Data -import Generics.Deriving.Base - - --- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_AOPT"@ data type. --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_AOPT = SAM_V1_6_Alignment_AOPT { sam_v1_6_alignment_aopt_tag :: ByteString - , sam_v1_6_alignment_aopt_value :: ByteString - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_AOPT where - SAM_V1_6_Alignment_AOPT sam_v1_6_alignment_aopt_tag1 - sam_v1_6_alignment_aopt_value1 == SAM_V1_6_Alignment_AOPT sam_v1_6_alignment_aopt_tag2 - sam_v1_6_alignment_aopt_value2 = sam_v1_6_alignment_aopt_tag1 == sam_v1_6_alignment_aopt_tag2 && - sam_v1_6_alignment_aopt_value1 == sam_v1_6_alignment_aopt_value2 - -instance Show SAM_V1_6_Alignment_AOPT where - show (SAM_V1_6_Alignment_AOPT tag - value - ) = - "SAM_V1_6_Alignment_AOPT { " ++ - "sam_v1_6_alignment_aopt_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_aopt_value = " ++ - (show value) ++ - " }" diff --git a/src/Data/SAM/Version1_6/Alignment/BOPT.hs b/src/Data/SAM/Version1_6/Alignment/BOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Alignment/BOPT.hs +++ /dev/null @@ -1,294 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE TypeFamilies #-} - --- | --- Module : Data.SAM.Version1_6.Alignment.BOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Alignment.BOPT ( -- * SAM version 1.6 alignment optional fields data type - SAM_V1_6_Alignment_BOPT(..), - SAM_V1_6_Alignment_BOPT_Int8(..), - SAM_V1_6_Alignment_BOPT_Word8(..), - SAM_V1_6_Alignment_BOPT_Int16(..), - SAM_V1_6_Alignment_BOPT_Word16(..), - SAM_V1_6_Alignment_BOPT_Int32(..), - SAM_V1_6_Alignment_BOPT_Word32(..), - SAM_V1_6_Alignment_BOPT_Float(..) - ) where - -import Data.Data -import Data.Int -import Data.Sequence -import Data.Word -import Generics.Deriving.Base - - --- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_BOPT"@ data type. --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT = SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 :: Maybe SAM_V1_6_Alignment_BOPT_Int8 - , sam_v1_6_alignment_bopt_word8 :: Maybe SAM_V1_6_Alignment_BOPT_Word8 - , sam_v1_6_alignment_bopt_int16 :: Maybe SAM_V1_6_Alignment_BOPT_Int16 - , sam_v1_6_alignment_bopt_word16 :: Maybe SAM_V1_6_Alignment_BOPT_Word16 - , sam_v1_6_alignment_bopt_int32 :: Maybe SAM_V1_6_Alignment_BOPT_Int32 - , sam_v1_6_alignment_bopt_word32 :: Maybe SAM_V1_6_Alignment_BOPT_Word32 - , sam_v1_6_alignment_bopt_float :: Maybe SAM_V1_6_Alignment_BOPT_Float - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT where - SAM_V1_6_Alignment_BOPT sam_v1_6_alignment_bopt_int81 - sam_v1_6_alignment_bopt_word81 - sam_v1_6_alignment_bopt_int161 - sam_v1_6_alignment_bopt_word161 - sam_v1_6_alignment_bopt_int321 - sam_v1_6_alignment_bopt_word321 - sam_v1_6_alignment_bopt_float1 == SAM_V1_6_Alignment_BOPT sam_v1_6_alignment_bopt_int82 - sam_v1_6_alignment_bopt_word82 - sam_v1_6_alignment_bopt_int162 - sam_v1_6_alignment_bopt_word162 - sam_v1_6_alignment_bopt_int322 - sam_v1_6_alignment_bopt_word322 - sam_v1_6_alignment_bopt_float2 = sam_v1_6_alignment_bopt_int81 == sam_v1_6_alignment_bopt_int82 && - sam_v1_6_alignment_bopt_word81 == sam_v1_6_alignment_bopt_word82 && - sam_v1_6_alignment_bopt_int161 == sam_v1_6_alignment_bopt_int162 && - sam_v1_6_alignment_bopt_word161 == sam_v1_6_alignment_bopt_word162 && - sam_v1_6_alignment_bopt_int321 == sam_v1_6_alignment_bopt_int322 && - sam_v1_6_alignment_bopt_word321 == sam_v1_6_alignment_bopt_word322 && - sam_v1_6_alignment_bopt_float1 == sam_v1_6_alignment_bopt_float2 - -instance Show SAM_V1_6_Alignment_BOPT where - show (SAM_V1_6_Alignment_BOPT int8 - word8 - int16 - word16 - int32 - word32 - float - ) = - "SAM_V1_6_Alignment_BOPT { " ++ - "sam_v1_6_alignment_bopt_int8 = " ++ - (show int8) ++ - " , sam_v1_6_alignment_bopt_word8 = " ++ - (show word8) ++ - " , sam_v1_6_alignment_bopt_int16 = " ++ - (show int16) ++ - " , sam_v1_6_alignment_bopt_word16 = " ++ - (show word16) ++ - " , sam_v1_6_alignment_bopt_int32 = " ++ - (show int32) ++ - " , sam_v1_6_alignment_bopt_word32 = " ++ - (show word32) ++ - " , sam_v1_6_alignment_bopt_float = " ++ - (show float) ++ - " }" - --- | __c__CsSiIf of the last optional field (type B). --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT_Int8 = SAM_V1_6_Alignment_BOPT_Int8 { sam_v1_6_alignment_bopt_int8_tag :: Seq Word8 - , sam_v1_6_alignment_bopt_int8_type :: Word8 - , sam_v1_6_alignment_bopt_int8_value :: Seq Int8 - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT_Int8 where - SAM_V1_6_Alignment_BOPT_Int8 sam_v1_6_alignment_bopt_int8_tag1 sam_v1_6_alignment_bopt_int8_type1 sam_v1_6_alignment_bopt_int8_value1 == SAM_V1_6_Alignment_BOPT_Int8 sam_v1_6_alignment_bopt_int8_tag2 sam_v1_6_alignment_bopt_int8_type2 sam_v1_6_alignment_bopt_int8_value2 = sam_v1_6_alignment_bopt_int8_tag1 == sam_v1_6_alignment_bopt_int8_tag2 && sam_v1_6_alignment_bopt_int8_type1 == sam_v1_6_alignment_bopt_int8_type2 && sam_v1_6_alignment_bopt_int8_value1 == sam_v1_6_alignment_bopt_int8_value2 - -instance Show SAM_V1_6_Alignment_BOPT_Int8 where - show (SAM_V1_6_Alignment_BOPT_Int8 tag - bopttype - value - ) = - "SAM_V1_6_Alignment_BOPT_Int8 { " ++ - "sam_v1_6_alignment_bopt_int8_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_bopt_int8_type = " ++ - (show bopttype) ++ - " , sam_v1_6_alignment_bopt_int8_value = " ++ - (show value) ++ - " }" - --- | c__C__sSiIf of the last optional field (type B). --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT_Word8 = SAM_V1_6_Alignment_BOPT_Word8 { sam_v1_6_alignment_bopt_word8_tag :: Seq Word8 - , sam_v1_6_alignment_bopt_word8_type :: Word8 - , sam_v1_6_alignment_bopt_word8_value :: Seq Word8 - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT_Word8 where - SAM_V1_6_Alignment_BOPT_Word8 sam_v1_6_alignment_bopt_word8_tag1 sam_v1_6_alignment_bopt_word8_type1 sam_v1_6_alignment_bopt_word8_value1 == SAM_V1_6_Alignment_BOPT_Word8 sam_v1_6_alignment_bopt_word8_tag2 sam_v1_6_alignment_bopt_word8_type2 sam_v1_6_alignment_bopt_word8_value2 = sam_v1_6_alignment_bopt_word8_tag1 == sam_v1_6_alignment_bopt_word8_tag2 && sam_v1_6_alignment_bopt_word8_type1 == sam_v1_6_alignment_bopt_word8_type2 && sam_v1_6_alignment_bopt_word8_value1 == sam_v1_6_alignment_bopt_word8_value2 - -instance Show SAM_V1_6_Alignment_BOPT_Word8 where - show (SAM_V1_6_Alignment_BOPT_Word8 tag - bopttype - value - ) = - "SAM_V1_6_Alignment_BOPT_Word8 { " ++ - "sam_v1_6_alignment_bopt_word8_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_bopt_word8_type = " ++ - (show bopttype) ++ - " , sam_v1_6_alignment_bopt_word8_value = " ++ - (show value) ++ - " }" - --- | cC__s__SiIf of the last optional field (type B). --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT_Int16 = SAM_V1_6_Alignment_BOPT_Int16 { sam_v1_6_alignment_bopt_int16_tag :: Seq Word8 - , sam_v1_6_alignment_bopt_int16_type :: Word8 - , sam_v1_6_alignment_bopt_int16_value :: Seq Int16 - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT_Int16 where - SAM_V1_6_Alignment_BOPT_Int16 sam_v1_6_alignment_bopt_int16_tag1 sam_v1_6_alignment_bopt_int16_type1 sam_v1_6_alignment_bopt_int16_value1 == SAM_V1_6_Alignment_BOPT_Int16 sam_v1_6_alignment_bopt_int16_tag2 sam_v1_6_alignment_bopt_int16_type2 sam_v1_6_alignment_bopt_int16_value2 = sam_v1_6_alignment_bopt_int16_tag1 == sam_v1_6_alignment_bopt_int16_tag2 && sam_v1_6_alignment_bopt_int16_type1 == sam_v1_6_alignment_bopt_int16_type2 && sam_v1_6_alignment_bopt_int16_value1 == sam_v1_6_alignment_bopt_int16_value2 - -instance Show SAM_V1_6_Alignment_BOPT_Int16 where - show (SAM_V1_6_Alignment_BOPT_Int16 tag - bopttype - value - ) = - "SAM_V1_6_Alignment_BOPT_Int16 { " ++ - "sam_v1_6_alignment_bopt_int16_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_bopt_int16_type = " ++ - (show bopttype) ++ - " , sam_v1_6_alignment_bopt_int16_value = " ++ - (show value) ++ - " }" - --- | cCs__S__iIf of the last optional field (type B). --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT_Word16 = SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag :: Seq Word8 - , sam_v1_6_alignment_bopt_word16_type :: Word8 - , sam_v1_6_alignment_bopt_word16_value :: Seq Word16 - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT_Word16 where - SAM_V1_6_Alignment_BOPT_Word16 sam_v1_6_alignment_bopt_word16_tag1 sam_v1_6_alignment_bopt_word16_type1 sam_v1_6_alignment_bopt_word16_value1 == SAM_V1_6_Alignment_BOPT_Word16 sam_v1_6_alignment_bopt_word16_tag2 sam_v1_6_alignment_bopt_word16_type2 sam_v1_6_alignment_bopt_word16_value2 = sam_v1_6_alignment_bopt_word16_tag1 == sam_v1_6_alignment_bopt_word16_tag2 && sam_v1_6_alignment_bopt_word16_type1 == sam_v1_6_alignment_bopt_word16_type2 && sam_v1_6_alignment_bopt_word16_value1 == sam_v1_6_alignment_bopt_word16_value2 - -instance Show SAM_V1_6_Alignment_BOPT_Word16 where - show (SAM_V1_6_Alignment_BOPT_Word16 tag - bopttype - value - ) = - "SAM_V1_6_Alignment_BOPT_Word16 { " ++ - "sam_v1_6_alignment_bopt_word16_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_bopt_word16_type = " ++ - (show bopttype) ++ - " , sam_v1_6_alignment_bopt_word16_value = " ++ - (show value) ++ - " }" - --- | cCsS__i__If of the last optional field (type B). --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT_Int32 = SAM_V1_6_Alignment_BOPT_Int32 { sam_v1_6_alignment_bopt_int32_tag :: Seq Word8 - , sam_v1_6_alignment_bopt_int32_type :: Word8 - , sam_v1_6_alignment_bopt_int32_value :: Seq Int32 - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT_Int32 where - SAM_V1_6_Alignment_BOPT_Int32 sam_v1_6_alignment_bopt_int32_tag1 sam_v1_6_alignment_bopt_int32_type1 sam_v1_6_alignment_bopt_int32_value1 == SAM_V1_6_Alignment_BOPT_Int32 sam_v1_6_alignment_bopt_int32_tag2 sam_v1_6_alignment_bopt_int32_type2 sam_v1_6_alignment_bopt_int32_value2 = sam_v1_6_alignment_bopt_int32_tag1 == sam_v1_6_alignment_bopt_int32_tag2 && sam_v1_6_alignment_bopt_int32_type1 == sam_v1_6_alignment_bopt_int32_type2 && sam_v1_6_alignment_bopt_int32_value1 == sam_v1_6_alignment_bopt_int32_value2 - -instance Show SAM_V1_6_Alignment_BOPT_Int32 where - show (SAM_V1_6_Alignment_BOPT_Int32 tag - bopttype - value - ) = - "SAM_V1_6_Alignment_BOPT_Int32 { " ++ - "sam_v1_6_alignment_bopt_int32_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_bopt_int32_type = " ++ - (show bopttype) ++ - " , sam_v1_6_alignment_bopt_int32_value = " ++ - (show value) ++ - " }" - --- | cCsSi__I__f of the last optional field (type B). --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT_Word32 = SAM_V1_6_Alignment_BOPT_Word32 { sam_v1_6_alignment_bopt_word32_tag :: Seq Word8 - , sam_v1_6_alignment_bopt_word32_type :: Word8 - , sam_v1_6_alignment_bopt_word32_value :: Seq Word32 - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT_Word32 where - SAM_V1_6_Alignment_BOPT_Word32 sam_v1_6_alignment_bopt_word32_tag1 sam_v1_6_alignment_bopt_word32_type1 sam_v1_6_alignment_bopt_word32_value1 == SAM_V1_6_Alignment_BOPT_Word32 sam_v1_6_alignment_bopt_word32_tag2 sam_v1_6_alignment_bopt_word32_type2 sam_v1_6_alignment_bopt_word32_value2 = sam_v1_6_alignment_bopt_word32_tag1 == sam_v1_6_alignment_bopt_word32_tag2 && sam_v1_6_alignment_bopt_word32_type1 == sam_v1_6_alignment_bopt_word32_type2 && sam_v1_6_alignment_bopt_word32_value1 == sam_v1_6_alignment_bopt_word32_value2 - -instance Show SAM_V1_6_Alignment_BOPT_Word32 where - show (SAM_V1_6_Alignment_BOPT_Word32 tag - bopttype - value - ) = - "SAM_V1_6_Alignment_BOPT_Word32 { " ++ - "sam_v1_6_alignment_bopt_word32_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_bopt_word32_type = " ++ - (show bopttype) ++ - " , sam_v1_6_alignment_bopt_word32_value = " ++ - (show value) ++ - " }" - --- | cCsSiI__f__ of the last optional field (type B). --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_BOPT_Float = SAM_V1_6_Alignment_BOPT_Float { sam_v1_6_alignment_bopt_float_tag :: Seq Word8 - , sam_v1_6_alignment_bopt_float_type :: Word8 - , sam_v1_6_alignment_bopt_float_value :: Seq Float - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_BOPT_Float where - SAM_V1_6_Alignment_BOPT_Float sam_v1_6_alignment_bopt_float_tag1 sam_v1_6_alignment_bopt_float_type1 sam_v1_6_alignment_bopt_float_value1 == SAM_V1_6_Alignment_BOPT_Float sam_v1_6_alignment_bopt_float_tag2 sam_v1_6_alignment_bopt_float_type2 sam_v1_6_alignment_bopt_float_value2 = sam_v1_6_alignment_bopt_float_tag1 == sam_v1_6_alignment_bopt_float_tag2 && sam_v1_6_alignment_bopt_float_type1 == sam_v1_6_alignment_bopt_float_type2 && sam_v1_6_alignment_bopt_float_value1 == sam_v1_6_alignment_bopt_float_value2 - -instance Show SAM_V1_6_Alignment_BOPT_Float where - show (SAM_V1_6_Alignment_BOPT_Float tag - bopttype - value - ) = - "SAM_V1_6_Alignment_BOPT_Float { " ++ - "sam_v1_6_alignment_bopt_float_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_bopt_float_type = " ++ - (show bopttype) ++ - " , sam_v1_6_alignment_bopt_float_value = " ++ - (show value) ++ - " }" diff --git a/src/Data/SAM/Version1_6/Alignment/Base.hs b/src/Data/SAM/Version1_6/Alignment/Base.hs --- a/src/Data/SAM/Version1_6/Alignment/Base.hs +++ b/src/Data/SAM/Version1_6/Alignment/Base.hs @@ -4,12 +4,13 @@ {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} {-# LANGUAGE TypeFamilies #-} {-# OPTIONS_GHC -fno-warn-name-shadowing #-} -- | -- Module : Data.SAM.Version1_6.Alignment.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -22,92 +23,83 @@ SAM_V1_6_Alignment(..) ) where -import Data.SAM.Version1_6.Alignment.AOPT -import Data.SAM.Version1_6.Alignment.IOPT -import Data.SAM.Version1_6.Alignment.FOPT -import Data.SAM.Version1_6.Alignment.ZOPT -import Data.SAM.Version1_6.Alignment.HOPT -import Data.SAM.Version1_6.Alignment.BOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.Base import Data.ByteString import Data.Data +import Data.Sequence import Generics.Deriving.Base -- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment"@ data type. -- -- See section 1.4 and 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment = SAM_V1_6_Alignment { sam_v1_6_alignment_qname :: ByteString -- ^ Query template NAME. - -- reads/segments having identical QNAME are regarded to come from - -- the same template. A QNAME ‘*’ indicates the information - -- is unavailable. In a SAM file, a read may - -- occupy multiple alignment lines, when its alignment is chimeric - -- or when multiple mappings are given. - , sam_v1_6_alignment_flag :: Int -- ^ Combination of bitwise FLAGs. - , sam_v1_6_alignment_rname :: ByteString -- ^ Reference sequence NAME of the alignment. - -- If @SQ header lines are present, RNAME (if not - -- ‘*’) must be present in one of the SQ-SN tag. - -- An unmapped segment without coordinate has a ‘*’ at - -- this field. However, an unmapped segment may also have - -- an ordinary coordinate such that it can be - -- placed at a desired position after sorting. - -- If RNAME is ‘*’, no assumptions can be made about POS - -- and CIGAR. - , sam_v1_6_alignment_pos :: Integer -- ^ 1-based leftmost mapping POSition of the first CIGAR - -- operation that “consumes” a reference - -- base. The first base in a reference sequence has coordinate 1. - -- POS is set as 0 for an unmapped read without coordinate. - -- If POS is 0, no assumptions can be made about RNAME and CIGAR. - , sam_v1_6_alignment_mapq :: Int -- ^ MAPping Quality. It equals −10 log10 Pr{mapping position is wrong}, - -- rounded to the nearest integer. A value 255 indicates that the - -- mapping quality is not available. - , sam_v1_6_alignment_cigar :: ByteString -- ^ CIGAR string (set ‘*’ if unavailable). - , sam_v1_6_alignment_rnext :: ByteString -- ^ Reference sequence name of the primary alignment of the - -- NEXT read in the template. For the last read, the next read - -- is the first read in the template. If @SQ header lines are present, - -- RNEXT (if not ‘*’ or ‘=’) must be present in one of the SQ-SN tag. - -- This field is set as ‘*’ when the information is unavailable, - -- and set as ‘=’ if RNEXT is identical RNAME. If not ‘=’ and the next - -- read in the template has one primary mapping (see also bit 0x100 in FLAG), - -- this field is identical to RNAME at the primary line of the next read. - -- If RNEXT is ‘*’, no assumptions can be made on PNEXT and bit 0x20. - , sam_v1_6_alignment_pnext :: Integer -- ^ 1-based Position of the primary alignment of the NEXT read in - -- the template. Set as 0 when the information is unavailable. - -- This field equals POS at the primary line of the next read. - -- If PNEXT is 0, no assumptions can be made on RNEXT and bit 0x20. - , sam_v1_6_alignment_tlen :: Integer -- ^ signed observed Template LENgth. For primary reads where the primary - -- alignments of all reads in the template are mapped to the same reference - -- sequence, the absolute value of TLEN equals the distance between the - -- mapped end of the template and the mapped start of the template, - -- inclusively (i.e., end − start + 1). - -- Note that mapped base is defined to be one that aligns to the - -- reference as described by CIGAR, hence excludes soft-clipped bases. - -- The TLEN field is positive for the leftmost segment of the template, - -- negative for the rightmost, and the sign for any middle segment is undefined. - -- If segments cover the same coordinates then the choice of which is leftmost - -- and rightmost is arbitrary, but the two ends must still have differing signs. - -- It is set as 0 for a single-segment template or when the information - -- is unavailable (e.g., when the first or last segment of a multi-segment - -- template is unmapped or when the two are mapped to - -- different reference sequences). - , sam_v1_6_alignment_seq :: ByteString -- ^ segment SEQuence. This field can be a ‘*’ when the sequence - -- is not stored. If not a ‘*’, the length of the sequence must - -- equal the sum of lengths of M/I/S/=/X operations in CIGAR. - -- An ‘=’ denotes the base is identical to the reference base. - -- No assumptions can be made on the letter cases. - , sam_v1_6_alignment_qual :: ByteString -- ^ ASCII of base QUALity plus 33 (same as the quality string - -- in the Sanger FASTQ format). A base quality is the phred-scaled - -- base error probability which equals −10 log10 Pr{base is wrong}. - -- This field can be a ‘*’ when quality is not stored. - -- If not a ‘*’, SEQ must not be a ‘*’ and the length of the quality - -- string ought to equal the length of SEQ. - , sam_v1_6_alignment_aopt :: Maybe SAM_V1_6_Alignment_AOPT -- ^ A - [!-~] - Printable characters. - , sam_v1_6_alignment_iopt :: Maybe SAM_V1_6_Alignment_IOPT -- ^ i - [-+]?[0-9]+ - Signed integer. - , sam_v1_6_alignment_fopt :: Maybe SAM_V1_6_Alignment_FOPT -- ^ f - [-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? - Single-precision floating number. - , sam_v1_6_alignment_zopt :: Maybe SAM_V1_6_Alignment_ZOPT -- ^ Z - [ !-~]* - Printable string, including space. - , sam_v1_6_alignment_hopt :: Maybe SAM_V1_6_Alignment_HOPT -- ^ H - ([0-9A-F][0-9A-F])* - Byte array in the Hex format. - , sam_v1_6_alignment_bopt :: Maybe SAM_V1_6_Alignment_BOPT -- ^ B - [cCsSiIf]​(,[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)* - Integer or numeric array. - } - deriving (Generic,Typeable) +data SAM_V1_6_Alignment = SAM_V1_6_Alignment + { sam_v1_6_alignment_qname :: ByteString -- ^ Query template NAME. + -- reads/segments having identical QNAME are regarded to come from + -- the same template. A QNAME ‘*’ indicates the information + -- is unavailable. In a SAM file, a read may + -- occupy multiple alignment lines, when its alignment is chimeric + -- or when multiple mappings are given. + , sam_v1_6_alignment_flag :: Int -- ^ Combination of bitwise FLAGs. + , sam_v1_6_alignment_rname :: ByteString -- ^ Reference sequence NAME of the alignment. + -- If @SQ header lines are present, RNAME (if not + -- ‘*’) must be present in one of the SQ-SN tag. + -- An unmapped segment without coordinate has a ‘*’ at + -- this field. However, an unmapped segment may also have + -- an ordinary coordinate such that it can be + -- placed at a desired position after sorting. + -- If RNAME is ‘*’, no assumptions can be made about POS + -- and CIGAR. + , sam_v1_6_alignment_pos :: Integer -- ^ 1-based leftmost mapping POSition of the first CIGAR + -- operation that “consumes” a reference + -- base. The first base in a reference sequence has coordinate 1. + -- POS is set as 0 for an unmapped read without coordinate. + -- If POS is 0, no assumptions can be made about RNAME and CIGAR. + , sam_v1_6_alignment_mapq :: Int -- ^ MAPping Quality. It equals −10 log10 Pr{mapping position is wrong}, + -- rounded to the nearest integer. A value 255 indicates that the + -- mapping quality is not available. + , sam_v1_6_alignment_cigar :: ByteString -- ^ CIGAR string (set ‘*’ if unavailable). + , sam_v1_6_alignment_rnext :: ByteString -- ^ Reference sequence name of the primary alignment of the + -- NEXT read in the template. For the last read, the next read + -- is the first read in the template. If @SQ header lines are present, + -- RNEXT (if not ‘*’ or ‘=’) must be present in one of the SQ-SN tag. + -- This field is set as ‘*’ when the information is unavailable, + -- and set as ‘=’ if RNEXT is identical RNAME. If not ‘=’ and the next + -- read in the template has one primary mapping (see also bit 0x100 in FLAG), + -- this field is identical to RNAME at the primary line of the next read. + -- If RNEXT is ‘*’, no assumptions can be made on PNEXT and bit 0x20. + , sam_v1_6_alignment_pnext :: Integer -- ^ 1-based Position of the primary alignment of the NEXT read in + -- the template. Set as 0 when the information is unavailable. + -- This field equals POS at the primary line of the next read. + -- If PNEXT is 0, no assumptions can be made on RNEXT and bit 0x20. + , sam_v1_6_alignment_tlen :: Integer -- ^ signed observed Template LENgth. For primary reads where the primary + -- alignments of all reads in the template are mapped to the same reference + -- sequence, the absolute value of TLEN equals the distance between the + -- mapped end of the template and the mapped start of the template, + -- inclusively (i.e., end − start + 1). + -- Note that mapped base is defined to be one that aligns to the + -- reference as described by CIGAR, hence excludes soft-clipped bases. + -- The TLEN field is positive for the leftmost segment of the template, + -- negative for the rightmost, and the sign for any middle segment is undefined. + -- If segments cover the same coordinates then the choice of which is leftmost + -- and rightmost is arbitrary, but the two ends must still have differing signs. + -- It is set as 0 for a single-segment template or when the information + -- is unavailable (e.g., when the first or last segment of a multi-segment + -- template is unmapped or when the two are mapped to + -- different reference sequences). + , sam_v1_6_alignment_seq :: ByteString -- ^ segment SEQuence. This field can be a ‘*’ when the sequence + -- is not stored. If not a ‘*’, the length of the sequence must + -- equal the sum of lengths of M/I/S/=/X operations in CIGAR. + -- An ‘=’ denotes the base is identical to the reference base. + -- No assumptions can be made on the letter cases. + , sam_v1_6_alignment_qual :: ByteString -- ^ ASCII of base QUALity plus 33 (same as the quality string + -- in the Sanger FASTQ format). A base quality is the phred-scaled + -- base error probability which equals −10 log10 Pr{base is wrong}. + -- This field can be a ‘*’ when quality is not stored. + -- If not a ‘*’, SEQ must not be a ‘*’ and the length of the quality + -- string ought to equal the length of SEQ. + , sam_v1_6_alignment_optionalfields :: Maybe (Seq SAM_V1_6_Alignment_OptionalFields) -- ^ Optional fields. + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Alignment where SAM_V1_6_Alignment sam_v1_6_alignment_qname1 @@ -121,80 +113,69 @@ sam_v1_6_alignment_tlen1 sam_v1_6_alignment_seq1 sam_v1_6_alignment_qual1 - sam_v1_6_alignment_aopt1 - sam_v1_6_alignment_iopt1 - sam_v1_6_alignment_fopt1 - sam_v1_6_alignment_zopt1 - sam_v1_6_alignment_hopt1 - sam_v1_6_alignment_bopt1 == SAM_V1_6_Alignment sam_v1_6_alignment_qname2 - sam_v1_6_alignment_flag2 - sam_v1_6_alignment_rname2 - sam_v1_6_alignment_pos2 - sam_v1_6_alignment_mapq2 - sam_v1_6_alignment_cigar2 - sam_v1_6_alignment_rnext2 - sam_v1_6_alignment_pnext2 - sam_v1_6_alignment_tlen2 - sam_v1_6_alignment_seq2 - sam_v1_6_alignment_qual2 - sam_v1_6_alignment_aopt2 - sam_v1_6_alignment_iopt2 - sam_v1_6_alignment_fopt2 - sam_v1_6_alignment_zopt2 - sam_v1_6_alignment_hopt2 - sam_v1_6_alignment_bopt2 = sam_v1_6_alignment_qname1 == sam_v1_6_alignment_qname2 && - sam_v1_6_alignment_flag1 == sam_v1_6_alignment_flag2 && - sam_v1_6_alignment_rname1 == sam_v1_6_alignment_rname2 && - sam_v1_6_alignment_pos1 == sam_v1_6_alignment_pos2 && - sam_v1_6_alignment_mapq1 == sam_v1_6_alignment_mapq2 && - sam_v1_6_alignment_cigar1 == sam_v1_6_alignment_cigar2 && - sam_v1_6_alignment_rnext1 == sam_v1_6_alignment_rnext2 && - sam_v1_6_alignment_pnext1 == sam_v1_6_alignment_pnext2 && - sam_v1_6_alignment_tlen1 == sam_v1_6_alignment_tlen2 && - sam_v1_6_alignment_seq1 == sam_v1_6_alignment_seq2 && - sam_v1_6_alignment_qual1 == sam_v1_6_alignment_qual2 && - sam_v1_6_alignment_aopt1 == sam_v1_6_alignment_aopt2 && - sam_v1_6_alignment_iopt1 == sam_v1_6_alignment_iopt2 && - sam_v1_6_alignment_fopt1 == sam_v1_6_alignment_fopt2 && - sam_v1_6_alignment_zopt1 == sam_v1_6_alignment_zopt2 && - sam_v1_6_alignment_hopt1 == sam_v1_6_alignment_hopt2 && - sam_v1_6_alignment_bopt1 == sam_v1_6_alignment_bopt2 + sam_v1_6_alignment_optfields1 == + SAM_V1_6_Alignment sam_v1_6_alignment_qname2 + sam_v1_6_alignment_flag2 + sam_v1_6_alignment_rname2 + sam_v1_6_alignment_pos2 + sam_v1_6_alignment_mapq2 + sam_v1_6_alignment_cigar2 + sam_v1_6_alignment_rnext2 + sam_v1_6_alignment_pnext2 + sam_v1_6_alignment_tlen2 + sam_v1_6_alignment_seq2 + sam_v1_6_alignment_qual2 + sam_v1_6_alignment_optfields2 = + sam_v1_6_alignment_qname1 == sam_v1_6_alignment_qname2 && + sam_v1_6_alignment_flag1 == sam_v1_6_alignment_flag2 && + sam_v1_6_alignment_rname1 == sam_v1_6_alignment_rname2 && + sam_v1_6_alignment_pos1 == sam_v1_6_alignment_pos2 && + sam_v1_6_alignment_mapq1 == sam_v1_6_alignment_mapq2 && + sam_v1_6_alignment_cigar1 == sam_v1_6_alignment_cigar2 && + sam_v1_6_alignment_rnext1 == sam_v1_6_alignment_rnext2 && + sam_v1_6_alignment_pnext1 == sam_v1_6_alignment_pnext2 && + sam_v1_6_alignment_tlen1 == sam_v1_6_alignment_tlen2 && + sam_v1_6_alignment_seq1 == sam_v1_6_alignment_seq2 && + sam_v1_6_alignment_qual1 == sam_v1_6_alignment_qual2 && + sam_v1_6_alignment_optfields1 == sam_v1_6_alignment_optfields2 instance Show SAM_V1_6_Alignment where - show (SAM_V1_6_Alignment qname flag rname pos mapq cigar rnext pnext tlen seq qual aopt iopt fopt zopt hopt bopt) = - "SAM_V1_6_Alignment { " ++ - "sam_v1_6_alignment_qname = " ++ - (show qname) ++ - " , sam_v1_6_alignment_flag = " ++ - (show flag) ++ - " , sam_v1_6_alignment_rname = " ++ - (show rname) ++ - " , sam_v1_6_alignment_pos = " ++ - (show pos) ++ - " , sam_v1_6_alignment_mapq = " ++ - (show mapq) ++ - " , sam_v1_6_alignment_cigar = " ++ - (show cigar) ++ - " , sam_v1_6_alignment_rnext = " ++ - (show rnext) ++ - " , sam_v1_6_alignment_pnext = " ++ - (show pnext) ++ - " , sam_v1_6_alignment_tlen = " ++ - (show tlen) ++ - " , sam_v1_6_alignment_seq = " ++ - (show seq) ++ - " , sam_v1_6_alignment_qual = " ++ - (show qual) ++ - " , sam_v1_6_alignment_aopt = " ++ - ( show aopt) ++ - " , sam_v1_6_alignment_iopt = " ++ - (show iopt) ++ - " , sam_v1_6_alignment_fopt = " ++ - (show fopt) ++ - " , sam_v1_6_alignment_zopt = " ++ - (show zopt) ++ - " , sam_v1_6_alignment_hopt = " ++ - (show hopt) ++ - " , sam_v1_6_alignment_bopt = " ++ - (show bopt) ++ + show (SAM_V1_6_Alignment qname + flag + rname + pos + mapq + cigar + rnext + pnext + tlen + seq + qual + optfields + ) = + "SAM_V1_6_Alignment { " ++ + "sam_v1_6_alignment_qname = " ++ + (show qname) ++ + " , sam_v1_6_alignment_flag = " ++ + (show flag) ++ + " , sam_v1_6_alignment_rname = " ++ + (show rname) ++ + " , sam_v1_6_alignment_pos = " ++ + (show pos) ++ + " , sam_v1_6_alignment_mapq = " ++ + (show mapq) ++ + " , sam_v1_6_alignment_cigar = " ++ + (show cigar) ++ + " , sam_v1_6_alignment_rnext = " ++ + (show rnext) ++ + " , sam_v1_6_alignment_pnext = " ++ + (show pnext) ++ + " , sam_v1_6_alignment_tlen = " ++ + (show tlen) ++ + " , sam_v1_6_alignment_seq = " ++ + (show seq) ++ + " , sam_v1_6_alignment_qual = " ++ + (show qual) ++ + " , sam_v1_6_alignment_optionalfields = " ++ + ( show optfields) ++ " }" diff --git a/src/Data/SAM/Version1_6/Alignment/FOPT.hs b/src/Data/SAM/Version1_6/Alignment/FOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Alignment/FOPT.hs +++ /dev/null @@ -1,68 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE TypeFamilies #-} - --- | --- Module : Data.SAM.Version1_6.Alignment.FOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Alignment.FOPT ( -- * SAM version 1.6 alignment optional fields data type - SAM_V1_6_Alignment_FOPT(..) - ) where - -import Data.ByteString (ByteString) -import Data.Data -import Generics.Deriving.Base - - --- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_FOPT"@ data type. --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_FOPT = SAM_V1_6_Alignment_FOPT { sam_v1_6_alignment_fopt_tag :: ByteString - , sam_v1_6_alignment_fopt_value :: Float - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_FOPT where - SAM_V1_6_Alignment_FOPT sam_v1_6_alignment_fopt_tag1 - sam_v1_6_alignment_fopt_value1 == SAM_V1_6_Alignment_FOPT sam_v1_6_alignment_fopt_tag2 - sam_v1_6_alignment_fopt_value2 = sam_v1_6_alignment_fopt_tag1 == sam_v1_6_alignment_fopt_tag2 && - sam_v1_6_alignment_fopt_value1 == sam_v1_6_alignment_fopt_value2 - -instance Show SAM_V1_6_Alignment_FOPT where - show (SAM_V1_6_Alignment_FOPT tag - value - ) = - "SAM_V1_6_Alignment_FOPT { " ++ - "sam_v1_6_alignment_fopt_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_fopt_value = " ++ - (show value) ++ - " }" diff --git a/src/Data/SAM/Version1_6/Alignment/HOPT.hs b/src/Data/SAM/Version1_6/Alignment/HOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Alignment/HOPT.hs +++ /dev/null @@ -1,68 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE TypeFamilies #-} - --- | --- Module : Data.SAM.Version1_6.Alignment.HOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Alignment.HOPT ( -- * SAM version 1.6 alignment optional fields data type - SAM_V1_6_Alignment_HOPT(..) - ) where - -import Data.ByteString (ByteString) -import Data.Data -import Generics.Deriving.Base - - --- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_HOPT"@ data type. --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_HOPT = SAM_V1_6_Alignment_HOPT { sam_v1_6_alignment_hopt_tag :: ByteString - , sam_v1_6_alignment_hopt_value :: ByteString - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_HOPT where - SAM_V1_6_Alignment_HOPT sam_v1_6_alignment_hopt_tag1 - sam_v1_6_alignment_hopt_value1 == SAM_V1_6_Alignment_HOPT sam_v1_6_alignment_hopt_tag2 - sam_v1_6_alignment_hopt_value2 = sam_v1_6_alignment_hopt_tag1 == sam_v1_6_alignment_hopt_tag2 && - sam_v1_6_alignment_hopt_value1 == sam_v1_6_alignment_hopt_value2 - -instance Show SAM_V1_6_Alignment_HOPT where - show (SAM_V1_6_Alignment_HOPT tag - value - ) = - "SAM_V1_6_Alignment_HOPT { " ++ - "sam_v1_6_alignment_hopt_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_hopt_value = " ++ - (show value) ++ - " }" diff --git a/src/Data/SAM/Version1_6/Alignment/IOPT.hs b/src/Data/SAM/Version1_6/Alignment/IOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Alignment/IOPT.hs +++ /dev/null @@ -1,68 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE TypeFamilies #-} - --- | --- Module : Data.SAM.Version1_6.Alignment.IOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Alignment.IOPT ( -- * SAM version 1.6 alignment optional fields data type - SAM_V1_6_Alignment_IOPT(..) - ) where - -import Data.ByteString (ByteString) -import Data.Data -import Generics.Deriving.Base - - --- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_IOPT"@ data type. --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_IOPT = SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag :: ByteString - , sam_v1_6_alignment_iopt_value :: Integer - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_IOPT where - SAM_V1_6_Alignment_IOPT sam_v1_6_alignment_iopt_tag1 - sam_v1_6_alignment_iopt_value1 == SAM_V1_6_Alignment_IOPT sam_v1_6_alignment_iopt_tag2 - sam_v1_6_alignment_iopt_value2 = sam_v1_6_alignment_iopt_tag1 == sam_v1_6_alignment_iopt_tag2 && - sam_v1_6_alignment_iopt_value1 == sam_v1_6_alignment_iopt_value2 - -instance Show SAM_V1_6_Alignment_IOPT where - show (SAM_V1_6_Alignment_IOPT tag - value - ) = - "SAM_V1_6_Alignment_IOPT { " ++ - "sam_v1_6_alignment_iopt_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_iopt_value = " ++ - (show value) ++ - " }" diff --git a/src/Data/SAM/Version1_6/Alignment/OptionalFields/AOPT.hs b/src/Data/SAM/Version1_6/Alignment/OptionalFields/AOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/OptionalFields/AOPT.hs @@ -0,0 +1,70 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.OptionalFields.AOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.OptionalFields.AOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_OptionalFields_AOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_AOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_AOPT = SAM_V1_6_Alignment_OptionalFields_AOPT + { sam_v1_6_alignment_optionalfields_aopt_tag :: ByteString + , sam_v1_6_alignment_optionalfields_aopt_value :: ByteString + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_AOPT where + SAM_V1_6_Alignment_OptionalFields_AOPT sam_v1_6_alignment_optionalfields_aopt_tag1 + sam_v1_6_alignment_optionalfields_aopt_value1 == + SAM_V1_6_Alignment_OptionalFields_AOPT sam_v1_6_alignment_optionalfields_aopt_tag2 + sam_v1_6_alignment_optionalfields_aopt_value2 = + sam_v1_6_alignment_optionalfields_aopt_tag1 == sam_v1_6_alignment_optionalfields_aopt_tag2 && + sam_v1_6_alignment_optionalfields_aopt_value1 == sam_v1_6_alignment_optionalfields_aopt_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_AOPT where + show (SAM_V1_6_Alignment_OptionalFields_AOPT tag + value + ) = + "SAM_V1_6_Alignment_OptionalFields_AOPT { " ++ + "sam_v1_6_alignment_optionalfields_aopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_aopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/OptionalFields/BOPT.hs b/src/Data/SAM/Version1_6/Alignment/OptionalFields/BOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/OptionalFields/BOPT.hs @@ -0,0 +1,352 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.OptionalFields.BOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.OptionalFields.BOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_OptionalFields_BOPT(..), + SAM_V1_6_Alignment_OptionalFields_BOPT_Int8(..), + SAM_V1_6_Alignment_OptionalFields_BOPT_Word8(..), + SAM_V1_6_Alignment_OptionalFields_BOPT_Int16(..), + SAM_V1_6_Alignment_OptionalFields_BOPT_Word16(..), + SAM_V1_6_Alignment_OptionalFields_BOPT_Int32(..), + SAM_V1_6_Alignment_OptionalFields_BOPT_Word32(..), + SAM_V1_6_Alignment_OptionalFields_BOPT_Float(..) + ) where + +import Data.Data +import Data.Int +import Data.Sequence +import Data.Word +import Generics.Deriving.Base + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_OptionalFields_BOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT = SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 + , sam_v1_6_alignment_optionalfields_bopt_word8 :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 + , sam_v1_6_alignment_optionalfields_bopt_int16 :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 + , sam_v1_6_alignment_optionalfields_bopt_word16 :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 + , sam_v1_6_alignment_optionalfields_bopt_int32 :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 + , sam_v1_6_alignment_optionalfields_bopt_word32 :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 + , sam_v1_6_alignment_optionalfields_bopt_float :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT_Float + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT where + SAM_V1_6_Alignment_OptionalFields_BOPT sam_v1_6_alignment_optionalfields_bopt_int81 + sam_v1_6_alignment_optionalfields_bopt_word81 + sam_v1_6_alignment_optionalfields_bopt_int161 + sam_v1_6_alignment_optionalfields_bopt_word161 + sam_v1_6_alignment_optionalfields_bopt_int321 + sam_v1_6_alignment_optionalfields_bopt_word321 + sam_v1_6_alignment_optionalfields_bopt_float1 == + SAM_V1_6_Alignment_OptionalFields_BOPT sam_v1_6_alignment_optionalfields_bopt_int82 + sam_v1_6_alignment_optionalfields_bopt_word82 + sam_v1_6_alignment_optionalfields_bopt_int162 + sam_v1_6_alignment_optionalfields_bopt_word162 + sam_v1_6_alignment_optionalfields_bopt_int322 + sam_v1_6_alignment_optionalfields_bopt_word322 + sam_v1_6_alignment_optionalfields_bopt_float2 = + sam_v1_6_alignment_optionalfields_bopt_int81 == sam_v1_6_alignment_optionalfields_bopt_int82 && + sam_v1_6_alignment_optionalfields_bopt_word81 == sam_v1_6_alignment_optionalfields_bopt_word82 && + sam_v1_6_alignment_optionalfields_bopt_int161 == sam_v1_6_alignment_optionalfields_bopt_int162 && + sam_v1_6_alignment_optionalfields_bopt_word161 == sam_v1_6_alignment_optionalfields_bopt_word162 && + sam_v1_6_alignment_optionalfields_bopt_int321 == sam_v1_6_alignment_optionalfields_bopt_int322 && + sam_v1_6_alignment_optionalfields_bopt_word321 == sam_v1_6_alignment_optionalfields_bopt_word322 && + sam_v1_6_alignment_optionalfields_bopt_float1 == sam_v1_6_alignment_optionalfields_bopt_float2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT where + show (SAM_V1_6_Alignment_OptionalFields_BOPT int8 + word8 + int16 + word16 + int32 + word32 + float + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT { " ++ + "sam_v1_6_alignment_optionalfields_bopt_int8 = " ++ + (show int8) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word8 = " ++ + (show word8) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int16 = " ++ + (show int16) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word16 = " ++ + (show word16) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int32 = " ++ + (show int32) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word32 = " ++ + (show word32) ++ + " , sam_v1_6_alignment_optionalfields_bopt_float = " ++ + (show float) ++ + " }" + +-- | __c__CsSiIf of the last optional field (type B). +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 = SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 + { sam_v1_6_alignment_optionalfields_bopt_int8_tag :: Seq Word8 + , sam_v1_6_alignment_optionalfields_bopt_int8_type :: Word8 + , sam_v1_6_alignment_optionalfields_bopt_int8_value :: Seq Int8 + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 where + SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 sam_v1_6_alignment_optionalfields_bopt_int8_tag1 + sam_v1_6_alignment_optionalfields_bopt_int8_type1 + sam_v1_6_alignment_optionalfields_bopt_int8_value1 == + SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 sam_v1_6_alignment_optionalfields_bopt_int8_tag2 + sam_v1_6_alignment_optionalfields_bopt_int8_type2 + sam_v1_6_alignment_optionalfields_bopt_int8_value2 = + sam_v1_6_alignment_optionalfields_bopt_int8_tag1 == sam_v1_6_alignment_optionalfields_bopt_int8_tag2 && + sam_v1_6_alignment_optionalfields_bopt_int8_type1 == sam_v1_6_alignment_optionalfields_bopt_int8_type2 && + sam_v1_6_alignment_optionalfields_bopt_int8_value1 == sam_v1_6_alignment_optionalfields_bopt_int8_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 where + show (SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 tag + bopttype + value + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 { " ++ + "sam_v1_6_alignment_optionalfields_bopt_int8_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int8_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int8_value = " ++ + (show value) ++ + " }" + +-- | c__C__sSiIf of the last optional field (type B). +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 = SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 + { sam_v1_6_alignment_optionalfields_bopt_word8_tag :: Seq Word8 + , sam_v1_6_alignment_optionalfields_bopt_word8_type :: Word8 + , sam_v1_6_alignment_optionalfields_bopt_word8_value :: Seq Word8 + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 where + SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 sam_v1_6_alignment_optionalfields_bopt_word8_tag1 + sam_v1_6_alignment_optionalfields_bopt_word8_type1 + sam_v1_6_alignment_optionalfields_bopt_word8_value1 == + SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 sam_v1_6_alignment_optionalfields_bopt_word8_tag2 + sam_v1_6_alignment_optionalfields_bopt_word8_type2 + sam_v1_6_alignment_optionalfields_bopt_word8_value2 = + sam_v1_6_alignment_optionalfields_bopt_word8_tag1 == sam_v1_6_alignment_optionalfields_bopt_word8_tag2 && + sam_v1_6_alignment_optionalfields_bopt_word8_type1 == sam_v1_6_alignment_optionalfields_bopt_word8_type2 && + sam_v1_6_alignment_optionalfields_bopt_word8_value1 == sam_v1_6_alignment_optionalfields_bopt_word8_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 where + show (SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 tag + bopttype + value + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 { " ++ + "sam_v1_6_alignment_optionalfields_bopt_word8_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word8_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word8_value = " ++ + (show value) ++ + " }" + +-- | cC__s__SiIf of the last optional field (type B). +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 = SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 + { sam_v1_6_alignment_optionalfields_bopt_int16_tag :: Seq Word8 + , sam_v1_6_alignment_optionalfields_bopt_int16_type :: Word8 + , sam_v1_6_alignment_optionalfields_bopt_int16_value :: Seq Int16 + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 where + SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 sam_v1_6_alignment_optionalfields_bopt_int16_tag1 + sam_v1_6_alignment_optionalfields_bopt_int16_type1 + sam_v1_6_alignment_optionalfields_bopt_int16_value1 == + SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 sam_v1_6_alignment_optionalfields_bopt_int16_tag2 + sam_v1_6_alignment_optionalfields_bopt_int16_type2 + sam_v1_6_alignment_optionalfields_bopt_int16_value2 = + sam_v1_6_alignment_optionalfields_bopt_int16_tag1 == sam_v1_6_alignment_optionalfields_bopt_int16_tag2 && + sam_v1_6_alignment_optionalfields_bopt_int16_type1 == sam_v1_6_alignment_optionalfields_bopt_int16_type2 && + sam_v1_6_alignment_optionalfields_bopt_int16_value1 == sam_v1_6_alignment_optionalfields_bopt_int16_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 where + show (SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 tag + bopttype + value + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 { " ++ + "sam_v1_6_alignment_optionalfields_bopt_int16_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int16_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int16_value = " ++ + (show value) ++ + " }" + +-- | cCs__S__iIf of the last optional field (type B). +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 = SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 + { sam_v1_6_alignment_optionalfields_bopt_word16_tag :: Seq Word8 + , sam_v1_6_alignment_optionalfields_bopt_word16_type :: Word8 + , sam_v1_6_alignment_optionalfields_bopt_word16_value :: Seq Word16 + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 where + SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 sam_v1_6_alignment_optionalfields_bopt_word16_tag1 + sam_v1_6_alignment_optionalfields_bopt_word16_type1 + sam_v1_6_alignment_optionalfields_bopt_word16_value1 == + SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 sam_v1_6_alignment_optionalfields_bopt_word16_tag2 + sam_v1_6_alignment_optionalfields_bopt_word16_type2 + sam_v1_6_alignment_optionalfields_bopt_word16_value2 = + sam_v1_6_alignment_optionalfields_bopt_word16_tag1 == sam_v1_6_alignment_optionalfields_bopt_word16_tag2 && + sam_v1_6_alignment_optionalfields_bopt_word16_type1 == sam_v1_6_alignment_optionalfields_bopt_word16_type2 && + sam_v1_6_alignment_optionalfields_bopt_word16_value1 == sam_v1_6_alignment_optionalfields_bopt_word16_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 where + show (SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 tag + bopttype + value + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 { " ++ + "sam_v1_6_alignment_optionalfields_bopt_word16_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word16_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word16_value = " ++ + (show value) ++ + " }" + +-- | cCsS__i__If of the last optional field (type B). +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 = SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 + { sam_v1_6_alignment_optionalfields_bopt_int32_tag :: Seq Word8 + , sam_v1_6_alignment_optionalfields_bopt_int32_type :: Word8 + , sam_v1_6_alignment_optionalfields_bopt_int32_value :: Seq Int32 + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 where + SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 sam_v1_6_alignment_optionalfields_bopt_int32_tag1 + sam_v1_6_alignment_optionalfields_bopt_int32_type1 + sam_v1_6_alignment_optionalfields_bopt_int32_value1 == + SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 sam_v1_6_alignment_optionalfields_bopt_int32_tag2 + sam_v1_6_alignment_optionalfields_bopt_int32_type2 + sam_v1_6_alignment_optionalfields_bopt_int32_value2 = + sam_v1_6_alignment_optionalfields_bopt_int32_tag1 == sam_v1_6_alignment_optionalfields_bopt_int32_tag2 && + sam_v1_6_alignment_optionalfields_bopt_int32_type1 == sam_v1_6_alignment_optionalfields_bopt_int32_type2 && + sam_v1_6_alignment_optionalfields_bopt_int32_value1 == sam_v1_6_alignment_optionalfields_bopt_int32_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 where + show (SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 tag + bopttype + value + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 { " ++ + "sam_v1_6_alignment_optionalfields_bopt_int32_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int32_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_optionalfields_bopt_int32_value = " ++ + (show value) ++ + " }" + +-- | cCsSi__I__f of the last optional field (type B). +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 = SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 + { sam_v1_6_alignment_optionalfields_bopt_word32_tag :: Seq Word8 + , sam_v1_6_alignment_optionalfields_bopt_word32_type :: Word8 + , sam_v1_6_alignment_optionalfields_bopt_word32_value :: Seq Word32 + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 where + SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 sam_v1_6_alignment_optionalfields_bopt_word32_tag1 + sam_v1_6_alignment_optionalfields_bopt_word32_type1 + sam_v1_6_alignment_optionalfields_bopt_word32_value1 == + SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 sam_v1_6_alignment_optionalfields_bopt_word32_tag2 + sam_v1_6_alignment_optionalfields_bopt_word32_type2 + sam_v1_6_alignment_optionalfields_bopt_word32_value2 = + sam_v1_6_alignment_optionalfields_bopt_word32_tag1 == sam_v1_6_alignment_optionalfields_bopt_word32_tag2 && + sam_v1_6_alignment_optionalfields_bopt_word32_type1 == sam_v1_6_alignment_optionalfields_bopt_word32_type2 && + sam_v1_6_alignment_optionalfields_bopt_word32_value1 == sam_v1_6_alignment_optionalfields_bopt_word32_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 where + show (SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 tag + bopttype + value + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 { " ++ + "sam_v1_6_alignment_optionalfields_bopt_word32_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word32_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_optionalfields_bopt_word32_value = " ++ + (show value) ++ + " }" + +-- | cCsSiI__f__ of the last optional field (type B). +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_BOPT_Float = SAM_V1_6_Alignment_OptionalFields_BOPT_Float + { sam_v1_6_alignment_optionalfields_bopt_float_tag :: Seq Word8 + , sam_v1_6_alignment_optionalfields_bopt_float_type :: Word8 + , sam_v1_6_alignment_optionalfields_bopt_float_value :: Seq Float + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_BOPT_Float where + SAM_V1_6_Alignment_OptionalFields_BOPT_Float sam_v1_6_alignment_optionalfields_bopt_float_tag1 + sam_v1_6_alignment_optionalfields_bopt_float_type1 + sam_v1_6_alignment_optionalfields_bopt_float_value1 == + SAM_V1_6_Alignment_OptionalFields_BOPT_Float sam_v1_6_alignment_optionalfields_bopt_float_tag2 + sam_v1_6_alignment_optionalfields_bopt_float_type2 + sam_v1_6_alignment_optionalfields_bopt_float_value2 = + sam_v1_6_alignment_optionalfields_bopt_float_tag1 == sam_v1_6_alignment_optionalfields_bopt_float_tag2 && + sam_v1_6_alignment_optionalfields_bopt_float_type1 == sam_v1_6_alignment_optionalfields_bopt_float_type2 && + sam_v1_6_alignment_optionalfields_bopt_float_value1 == sam_v1_6_alignment_optionalfields_bopt_float_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_BOPT_Float where + show (SAM_V1_6_Alignment_OptionalFields_BOPT_Float tag + bopttype + value + ) = + "SAM_V1_6_Alignment_OptionalFields_BOPT_Float { " ++ + "sam_v1_6_alignment_optionalfields_bopt_float_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_bopt_float_type = " ++ + (show bopttype) ++ + " , sam_v1_6_alignment_optionalfields_bopt_float_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/OptionalFields/Base.hs b/src/Data/SAM/Version1_6/Alignment/OptionalFields/Base.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/OptionalFields/Base.hs @@ -0,0 +1,89 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} +{-# OPTIONS_GHC -fno-warn-name-shadowing #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.OptionalFields.Base +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.OptionalFields.Base ( -- * SAM version 1.6 alignment optional data types + SAM_V1_6_Alignment_OptionalFields(..) + ) where + +import Data.SAM.Version1_6.Alignment.OptionalFields.AOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.IOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.FOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.ZOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.HOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.BOPT + +import Data.Data +import Generics.Deriving.Base + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_OptionalFields"@ data type. +-- +-- See section 1.4 and 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields = SAM_V1_6_Alignment_OptionalFields + { sam_v1_6_alignment_optionalfields_aopt :: Maybe SAM_V1_6_Alignment_OptionalFields_AOPT -- ^ A - [!-~] - Printable characters. + , sam_v1_6_alignment_optionalfields_iopt :: Maybe SAM_V1_6_Alignment_OptionalFields_IOPT -- ^ i - [-+]?[0-9]+ - Signed integer. + , sam_v1_6_alignment_optionalfields_fopt :: Maybe SAM_V1_6_Alignment_OptionalFields_FOPT -- ^ f - [-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)? - Single-precision floating number. + , sam_v1_6_alignment_optionalfields_zopt :: Maybe SAM_V1_6_Alignment_OptionalFields_ZOPT -- ^ Z - [ !-~]* - Printable string, including space. + , sam_v1_6_alignment_optionalfields_hopt :: Maybe SAM_V1_6_Alignment_OptionalFields_HOPT -- ^ H - ([0-9A-F][0-9A-F])* - Byte array in the Hex format. + , sam_v1_6_alignment_optionalfields_bopt :: Maybe SAM_V1_6_Alignment_OptionalFields_BOPT -- ^ B - [cCsSiIf]​(,[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)* - Integer or numeric array. + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields where + SAM_V1_6_Alignment_OptionalFields sam_v1_6_alignment_optionalfields_aopt1 + sam_v1_6_alignment_optionalfields_iopt1 + sam_v1_6_alignment_optionalfields_fopt1 + sam_v1_6_alignment_optionalfields_zopt1 + sam_v1_6_alignment_optionalfields_hopt1 + sam_v1_6_alignment_optionalfields_bopt1 == + SAM_V1_6_Alignment_OptionalFields sam_v1_6_alignment_optionalfields_aopt2 + sam_v1_6_alignment_optionalfields_iopt2 + sam_v1_6_alignment_optionalfields_fopt2 + sam_v1_6_alignment_optionalfields_zopt2 + sam_v1_6_alignment_optionalfields_hopt2 + sam_v1_6_alignment_optionalfields_bopt2 = + sam_v1_6_alignment_optionalfields_aopt1 == sam_v1_6_alignment_optionalfields_aopt2 && + sam_v1_6_alignment_optionalfields_iopt1 == sam_v1_6_alignment_optionalfields_iopt2 && + sam_v1_6_alignment_optionalfields_fopt1 == sam_v1_6_alignment_optionalfields_fopt2 && + sam_v1_6_alignment_optionalfields_zopt1 == sam_v1_6_alignment_optionalfields_zopt2 && + sam_v1_6_alignment_optionalfields_hopt1 == sam_v1_6_alignment_optionalfields_hopt2 && + sam_v1_6_alignment_optionalfields_bopt1 == sam_v1_6_alignment_optionalfields_bopt2 + +instance Show SAM_V1_6_Alignment_OptionalFields where + show (SAM_V1_6_Alignment_OptionalFields aopt + iopt + fopt + zopt + hopt + bopt + ) = + "SAM_V1_6_Alignment_OptionalFields { " ++ + "sam_v1_6_alignment_optionalfields_aopt = " ++ + ( show aopt) ++ + " , sam_v1_6_alignment_optionalfields_iopt = " ++ + (show iopt) ++ + " , sam_v1_6_alignment_optionalfields_fopt = " ++ + (show fopt) ++ + " , sam_v1_6_alignment_optionalfields_zopt = " ++ + (show zopt) ++ + " , sam_v1_6_alignment_optionalfields_hopt = " ++ + (show hopt) ++ + " , sam_v1_6_alignment_optionalfields_bopt = " ++ + (show bopt) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/OptionalFields/FOPT.hs b/src/Data/SAM/Version1_6/Alignment/OptionalFields/FOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/OptionalFields/FOPT.hs @@ -0,0 +1,70 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.OptionalFields.FOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.OptionalFields.FOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_OptionalFields_FOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_OptionalFields_FOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_FOPT = SAM_V1_6_Alignment_OptionalFields_FOPT + { sam_v1_6_alignment_optionalfields_fopt_tag :: ByteString + , sam_v1_6_alignment_optionalfields_fopt_value :: Float + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_FOPT where + SAM_V1_6_Alignment_OptionalFields_FOPT sam_v1_6_alignment_optionalfields_fopt_tag1 + sam_v1_6_alignment_optionalfields_fopt_value1 == + SAM_V1_6_Alignment_OptionalFields_FOPT sam_v1_6_alignment_optionalfields_fopt_tag2 + sam_v1_6_alignment_optionalfields_fopt_value2 = + sam_v1_6_alignment_optionalfields_fopt_tag1 == sam_v1_6_alignment_optionalfields_fopt_tag2 && + sam_v1_6_alignment_optionalfields_fopt_value1 == sam_v1_6_alignment_optionalfields_fopt_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_FOPT where + show (SAM_V1_6_Alignment_OptionalFields_FOPT tag + value + ) = + "SAM_V1_6_Alignment_OptionalFields_FOPT { " ++ + "sam_v1_6_alignment_optionalfields_fopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_fopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/OptionalFields/HOPT.hs b/src/Data/SAM/Version1_6/Alignment/OptionalFields/HOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/OptionalFields/HOPT.hs @@ -0,0 +1,70 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.OptionalFields.HOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.OptionalFields.HOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_OptionalFields_HOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_OptionalFields_HOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_HOPT = SAM_V1_6_Alignment_OptionalFields_HOPT + { sam_v1_6_alignment_optionalfields_hopt_tag :: ByteString + , sam_v1_6_alignment_optionalfields_hopt_value :: ByteString + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_HOPT where + SAM_V1_6_Alignment_OptionalFields_HOPT sam_v1_6_alignment_optionalfields_hopt_tag1 + sam_v1_6_alignment_optionalfields_hopt_value1 == + SAM_V1_6_Alignment_OptionalFields_HOPT sam_v1_6_alignment_optionalfields_hopt_tag2 + sam_v1_6_alignment_optionalfields_hopt_value2 = + sam_v1_6_alignment_optionalfields_hopt_tag1 == sam_v1_6_alignment_optionalfields_hopt_tag2 && + sam_v1_6_alignment_optionalfields_hopt_value1 == sam_v1_6_alignment_optionalfields_hopt_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_HOPT where + show (SAM_V1_6_Alignment_OptionalFields_HOPT tag + value + ) = + "SAM_V1_6_Alignment_OptionalFields_HOPT { " ++ + "sam_v1_6_alignment_optionalfields_hopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_hopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/OptionalFields/IOPT.hs b/src/Data/SAM/Version1_6/Alignment/OptionalFields/IOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/OptionalFields/IOPT.hs @@ -0,0 +1,70 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.OptionalFields.IOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.OptionalFields.IOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_OptionalFields_IOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_OptionalFields_IOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_IOPT = SAM_V1_6_Alignment_OptionalFields_IOPT + { sam_v1_6_alignment_optionalfields_iopt_tag :: ByteString + , sam_v1_6_alignment_optionalfields_iopt_value :: Integer + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_IOPT where + SAM_V1_6_Alignment_OptionalFields_IOPT sam_v1_6_alignment_optionalfields_iopt_tag1 + sam_v1_6_alignment_optionalfields_iopt_value1 == + SAM_V1_6_Alignment_OptionalFields_IOPT sam_v1_6_alignment_optionalfields_iopt_tag2 + sam_v1_6_alignment_optionalfields_iopt_value2 = + sam_v1_6_alignment_optionalfields_iopt_tag1 == sam_v1_6_alignment_optionalfields_iopt_tag2 && + sam_v1_6_alignment_optionalfields_iopt_value1 == sam_v1_6_alignment_optionalfields_iopt_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_IOPT where + show (SAM_V1_6_Alignment_OptionalFields_IOPT tag + value + ) = + "SAM_V1_6_Alignment_OptionalFields_IOPT { " ++ + "sam_v1_6_alignment_optionalfields_iopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_iopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/OptionalFields/ZOPT.hs b/src/Data/SAM/Version1_6/Alignment/OptionalFields/ZOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Alignment/OptionalFields/ZOPT.hs @@ -0,0 +1,70 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Alignment.OptionalFields.ZOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Alignment.OptionalFields.ZOPT ( -- * SAM version 1.6 alignment optional fields data type + SAM_V1_6_Alignment_OptionalFields_ZOPT(..) + ) where + +import Data.ByteString (ByteString) +import Data.Data +import Generics.Deriving.Base + +-- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_OptionalFields_ZOPT"@ data type. +-- +-- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +data SAM_V1_6_Alignment_OptionalFields_ZOPT = SAM_V1_6_Alignment_OptionalFields_ZOPT + { sam_v1_6_alignment_optionalfields_zopt_tag :: ByteString + , sam_v1_6_alignment_optionalfields_zopt_value :: ByteString + } deriving (Generic,Typeable) + +instance Eq SAM_V1_6_Alignment_OptionalFields_ZOPT where + SAM_V1_6_Alignment_OptionalFields_ZOPT sam_v1_6_alignment_optionalfields_zopt_tag1 + sam_v1_6_alignment_optionalfields_zopt_value1 == + SAM_V1_6_Alignment_OptionalFields_ZOPT sam_v1_6_alignment_optionalfields_zopt_tag2 + sam_v1_6_alignment_optionalfields_zopt_value2 = + sam_v1_6_alignment_optionalfields_zopt_tag1 == sam_v1_6_alignment_optionalfields_zopt_tag2 && + sam_v1_6_alignment_optionalfields_zopt_value1 == sam_v1_6_alignment_optionalfields_zopt_value2 + +instance Show SAM_V1_6_Alignment_OptionalFields_ZOPT where + show (SAM_V1_6_Alignment_OptionalFields_ZOPT tag + value + ) = + "SAM_V1_6_Alignment_OptionalFields_ZOPT { " ++ + "sam_v1_6_alignment_optionalfields_zopt_tag = " ++ + (show tag) ++ + " , sam_v1_6_alignment_optionalfields_zopt_value = " ++ + (show value) ++ + " }" diff --git a/src/Data/SAM/Version1_6/Alignment/ZOPT.hs b/src/Data/SAM/Version1_6/Alignment/ZOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Alignment/ZOPT.hs +++ /dev/null @@ -1,68 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE TypeFamilies #-} - --- | --- Module : Data.SAM.Version1_6.Alignment.ZOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Alignment.ZOPT ( -- * SAM version 1.6 alignment optional fields data type - SAM_V1_6_Alignment_ZOPT(..) - ) where - -import Data.ByteString (ByteString) -import Data.Data -import Generics.Deriving.Base - - --- | Custom SAM (version 1.6) @"SAM_V1_6_Alignment_ZOPT"@ data type. --- --- See section 1.5 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Alignment_ZOPT = SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag :: ByteString - , sam_v1_6_alignment_zopt_value :: ByteString - } - deriving (Generic,Typeable) - -instance Eq SAM_V1_6_Alignment_ZOPT where - SAM_V1_6_Alignment_ZOPT sam_v1_6_alignment_zopt_tag1 - sam_v1_6_alignment_zopt_value1 == SAM_V1_6_Alignment_ZOPT sam_v1_6_alignment_zopt_tag2 - sam_v1_6_alignment_zopt_value2 = sam_v1_6_alignment_zopt_tag1 == sam_v1_6_alignment_zopt_tag2 && - sam_v1_6_alignment_zopt_value1 == sam_v1_6_alignment_zopt_value2 - -instance Show SAM_V1_6_Alignment_ZOPT where - show (SAM_V1_6_Alignment_ZOPT tag - value - ) = - "SAM_V1_6_Alignment_ZOPT { " ++ - "sam_v1_6_alignment_zopt_tag = " ++ - (show tag) ++ - " , sam_v1_6_alignment_zopt_value = " ++ - (show value) ++ - " }" diff --git a/src/Data/SAM/Version1_6/Header.hs b/src/Data/SAM/Version1_6/Header.hs --- a/src/Data/SAM/Version1_6/Header.hs +++ b/src/Data/SAM/Version1_6/Header.hs @@ -5,7 +5,7 @@ -- | -- Module : Data.SAM.Version1_6.Header --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable diff --git a/src/Data/SAM/Version1_6/Header/CO.hs b/src/Data/SAM/Version1_6/Header/CO.hs --- a/src/Data/SAM/Version1_6/Header/CO.hs +++ b/src/Data/SAM/Version1_6/Header/CO.hs @@ -4,11 +4,12 @@ {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} {-# LANGUAGE TypeFamilies #-} -- | -- Module : Data.SAM.Version1_6.Header.CO --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -28,12 +29,14 @@ -- | Custom SAM (version 1.6) @"SAM_V1_6_One_Line_Comment"@ data type. -- -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -newtype SAM_V1_6_One_Line_Comment = SAM_V1_6_One_Line_Comment { sam_v1_6_one_line_comment_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_One_Line_Comment = SAM_V1_6_One_Line_Comment + { sam_v1_6_one_line_comment_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_One_Line_Comment where - SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value1 == SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value2 = sam_v1_6_one_line_comment_value1 == sam_v1_6_one_line_comment_value2 + SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value1 == + SAM_V1_6_One_Line_Comment sam_v1_6_one_line_comment_value2 = + sam_v1_6_one_line_comment_value1 == sam_v1_6_one_line_comment_value2 instance Show SAM_V1_6_One_Line_Comment where show (SAM_V1_6_One_Line_Comment value) = "SAM_V1_6_One_Line_Comment { " ++ diff --git a/src/Data/SAM/Version1_6/Header/HD.hs b/src/Data/SAM/Version1_6/Header/HD.hs --- a/src/Data/SAM/Version1_6/Header/HD.hs +++ b/src/Data/SAM/Version1_6/Header/HD.hs @@ -4,11 +4,12 @@ {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} {-# LANGUAGE TypeFamilies #-} -- | -- Module : Data.SAM.Version1_6.Header.HD --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -33,24 +34,26 @@ -- | Custom SAM (version 1.6) @"SAM_V1_6_File_Level_Metadata"@ data type. -- -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_File_Level_Metadata = SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version :: SAM_V1_6_File_Level_Metadata_Format_Version - , sam_v1_6_file_level_metadata_sorting_order :: Maybe SAM_V1_6_File_Level_Metadata_Sorting_Order - , sam_v1_6_file_level_metadata_alignment_grouping :: Maybe SAM_V1_6_File_Level_Metadata_Alignment_Grouping - , sam_v1_6_file_level_metadata_subsorting_order :: Maybe SAM_V1_6_File_Level_Metadata_SubSorting_Order - } - deriving (Generic,Typeable) +data SAM_V1_6_File_Level_Metadata = SAM_V1_6_File_Level_Metadata + { sam_v1_6_file_level_metadata_format_version :: SAM_V1_6_File_Level_Metadata_Format_Version + , sam_v1_6_file_level_metadata_sorting_order :: Maybe SAM_V1_6_File_Level_Metadata_Sorting_Order + , sam_v1_6_file_level_metadata_alignment_grouping :: Maybe SAM_V1_6_File_Level_Metadata_Alignment_Grouping + , sam_v1_6_file_level_metadata_subsorting_order :: Maybe SAM_V1_6_File_Level_Metadata_SubSorting_Order + } deriving (Generic,Typeable) instance Eq SAM_V1_6_File_Level_Metadata where SAM_V1_6_File_Level_Metadata sam_v1_6_file_level_metadata_format_version1 sam_v1_6_file_level_metadata_sorting_order1 sam_v1_6_file_level_metadata_alignment_grouping1 - sam_v1_6_file_level_metadata_subsorting_order1 == SAM_V1_6_File_Level_Metadata sam_v1_6_file_level_metadata_format_version2 - sam_v1_6_file_level_metadata_sorting_order2 - sam_v1_6_file_level_metadata_alignment_grouping2 - sam_v1_6_file_level_metadata_subsorting_order2 = sam_v1_6_file_level_metadata_format_version1 == sam_v1_6_file_level_metadata_format_version2 && - sam_v1_6_file_level_metadata_sorting_order1 == sam_v1_6_file_level_metadata_sorting_order2 && - sam_v1_6_file_level_metadata_alignment_grouping1 == sam_v1_6_file_level_metadata_alignment_grouping2 && - sam_v1_6_file_level_metadata_subsorting_order1 == sam_v1_6_file_level_metadata_subsorting_order2 + sam_v1_6_file_level_metadata_subsorting_order1 == + SAM_V1_6_File_Level_Metadata sam_v1_6_file_level_metadata_format_version2 + sam_v1_6_file_level_metadata_sorting_order2 + sam_v1_6_file_level_metadata_alignment_grouping2 + sam_v1_6_file_level_metadata_subsorting_order2 = + sam_v1_6_file_level_metadata_format_version1 == sam_v1_6_file_level_metadata_format_version2 && + sam_v1_6_file_level_metadata_sorting_order1 == sam_v1_6_file_level_metadata_sorting_order2 && + sam_v1_6_file_level_metadata_alignment_grouping1 == sam_v1_6_file_level_metadata_alignment_grouping2 && + sam_v1_6_file_level_metadata_subsorting_order1 == sam_v1_6_file_level_metadata_subsorting_order2 instance Show SAM_V1_6_File_Level_Metadata where show (SAM_V1_6_File_Level_Metadata version sorting_order alignment_grouping subsorting_order) = @@ -66,12 +69,14 @@ " }" -- | VN tag for @"SAM_V1_6_File_Level_Metadata"@. -newtype SAM_V1_6_File_Level_Metadata_Format_Version = SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_File_Level_Metadata_Format_Version = SAM_V1_6_File_Level_Metadata_Format_Version + { sam_v1_6_file_level_metadata_format_version_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_File_Level_Metadata_Format_Version where - SAM_V1_6_File_Level_Metadata_Format_Version sam_v1_6_file_level_metadata_format_version_value1 == SAM_V1_6_File_Level_Metadata_Format_Version sam_v1_6_file_level_metadata_format_version_value2 = sam_v1_6_file_level_metadata_format_version_value1 == sam_v1_6_file_level_metadata_format_version_value2 + SAM_V1_6_File_Level_Metadata_Format_Version sam_v1_6_file_level_metadata_format_version_value1 == + SAM_V1_6_File_Level_Metadata_Format_Version sam_v1_6_file_level_metadata_format_version_value2 = + sam_v1_6_file_level_metadata_format_version_value1 == sam_v1_6_file_level_metadata_format_version_value2 instance Show SAM_V1_6_File_Level_Metadata_Format_Version where show (SAM_V1_6_File_Level_Metadata_Format_Version value) = @@ -81,12 +86,14 @@ " }" -- | SO tag for @"SAM_V1_6_File_Level_Metadata"@. -newtype SAM_V1_6_File_Level_Metadata_Sorting_Order = SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_File_Level_Metadata_Sorting_Order = SAM_V1_6_File_Level_Metadata_Sorting_Order + { sam_v1_6_file_level_metadata_sorting_order_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_File_Level_Metadata_Sorting_Order where - SAM_V1_6_File_Level_Metadata_Sorting_Order sam_v1_6_file_level_metadata_sorting_order_value1 == SAM_V1_6_File_Level_Metadata_Sorting_Order sam_v1_6_file_level_metadata_sorting_order_value2 = sam_v1_6_file_level_metadata_sorting_order_value1 == sam_v1_6_file_level_metadata_sorting_order_value2 + SAM_V1_6_File_Level_Metadata_Sorting_Order sam_v1_6_file_level_metadata_sorting_order_value1 == + SAM_V1_6_File_Level_Metadata_Sorting_Order sam_v1_6_file_level_metadata_sorting_order_value2 = + sam_v1_6_file_level_metadata_sorting_order_value1 == sam_v1_6_file_level_metadata_sorting_order_value2 instance Show SAM_V1_6_File_Level_Metadata_Sorting_Order where show (SAM_V1_6_File_Level_Metadata_Sorting_Order value) = @@ -96,12 +103,14 @@ " }" -- | GO tag for @"SAM_V1_6_File_Level_Metadata"@. -newtype SAM_V1_6_File_Level_Metadata_Alignment_Grouping = SAM_V1_6_File_Level_Metadata_Alignment_Grouping { sam_v1_6_file_level_metadata_alignment_grouping_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_File_Level_Metadata_Alignment_Grouping = SAM_V1_6_File_Level_Metadata_Alignment_Grouping + { sam_v1_6_file_level_metadata_alignment_grouping_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_File_Level_Metadata_Alignment_Grouping where - SAM_V1_6_File_Level_Metadata_Alignment_Grouping sam_v1_6_file_level_metadata_alignment_grouping_value1 == SAM_V1_6_File_Level_Metadata_Alignment_Grouping sam_v1_6_file_level_metadata_alignment_grouping_value2 = sam_v1_6_file_level_metadata_alignment_grouping_value1 == sam_v1_6_file_level_metadata_alignment_grouping_value2 + SAM_V1_6_File_Level_Metadata_Alignment_Grouping sam_v1_6_file_level_metadata_alignment_grouping_value1 == + SAM_V1_6_File_Level_Metadata_Alignment_Grouping sam_v1_6_file_level_metadata_alignment_grouping_value2 = + sam_v1_6_file_level_metadata_alignment_grouping_value1 == sam_v1_6_file_level_metadata_alignment_grouping_value2 instance Show SAM_V1_6_File_Level_Metadata_Alignment_Grouping where show (SAM_V1_6_File_Level_Metadata_Alignment_Grouping value) = @@ -111,12 +120,14 @@ " }" -- | SS tag for @"SAM_V1_6_File_Level_Metadata"@. -newtype SAM_V1_6_File_Level_Metadata_SubSorting_Order = SAM_V1_6_File_Level_Metadata_SubSorting_Order { sam_v1_6_file_level_metadata_subsorting_order_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_File_Level_Metadata_SubSorting_Order = SAM_V1_6_File_Level_Metadata_SubSorting_Order + { sam_v1_6_file_level_metadata_subsorting_order_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_File_Level_Metadata_SubSorting_Order where - SAM_V1_6_File_Level_Metadata_SubSorting_Order sam_v1_6_file_level_metadata_subsorting_order_value1 == SAM_V1_6_File_Level_Metadata_SubSorting_Order sam_v1_6_file_level_metadata_subsorting_order_value2 = sam_v1_6_file_level_metadata_subsorting_order_value1 == sam_v1_6_file_level_metadata_subsorting_order_value2 + SAM_V1_6_File_Level_Metadata_SubSorting_Order sam_v1_6_file_level_metadata_subsorting_order_value1 == + SAM_V1_6_File_Level_Metadata_SubSorting_Order sam_v1_6_file_level_metadata_subsorting_order_value2 = + sam_v1_6_file_level_metadata_subsorting_order_value1 == sam_v1_6_file_level_metadata_subsorting_order_value2 instance Show SAM_V1_6_File_Level_Metadata_SubSorting_Order where show (SAM_V1_6_File_Level_Metadata_SubSorting_Order value) = diff --git a/src/Data/SAM/Version1_6/Header/PG.hs b/src/Data/SAM/Version1_6/Header/PG.hs --- a/src/Data/SAM/Version1_6/Header/PG.hs +++ b/src/Data/SAM/Version1_6/Header/PG.hs @@ -4,11 +4,12 @@ {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} {-# LANGUAGE TypeFamilies #-} -- | -- Module : Data.SAM.Version1_6.Header.PG --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -35,14 +36,14 @@ -- | Custom SAM (version 1.6) @"SAM_V1_6_Program"@ data type. -- -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Program = SAM_V1_6_Program { sam_v1_6_program_record_identifier :: SAM_V1_6_Program_Record_Identifier - , sam_v1_6_program_name :: Maybe SAM_V1_6_Program_Name - , sam_v1_6_program_command_line :: Maybe SAM_V1_6_Program_Command_Line - , sam_v1_6_program_previous_pg_id :: Maybe SAM_V1_6_Program_Previous_PG_ID - , sam_v1_6_program_description :: Maybe SAM_V1_6_Program_Description - , sam_v1_6_program_version :: Maybe SAM_V1_6_Program_Version - } - deriving (Generic,Typeable) +data SAM_V1_6_Program = SAM_V1_6_Program + { sam_v1_6_program_record_identifier :: SAM_V1_6_Program_Record_Identifier + , sam_v1_6_program_name :: Maybe SAM_V1_6_Program_Name + , sam_v1_6_program_command_line :: Maybe SAM_V1_6_Program_Command_Line + , sam_v1_6_program_previous_pg_id :: Maybe SAM_V1_6_Program_Previous_PG_ID + , sam_v1_6_program_description :: Maybe SAM_V1_6_Program_Description + , sam_v1_6_program_version :: Maybe SAM_V1_6_Program_Version + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Program where SAM_V1_6_Program sam_v1_6_program_record_identifier1 @@ -50,17 +51,19 @@ sam_v1_6_program_command_line1 sam_v1_6_program_previous_pg_id1 sam_v1_6_program_description1 - sam_v1_6_program_version1 == SAM_V1_6_Program sam_v1_6_program_record_identifier2 - sam_v1_6_program_name2 - sam_v1_6_program_command_line2 - sam_v1_6_program_previous_pg_id2 - sam_v1_6_program_description2 - sam_v1_6_program_version2 = sam_v1_6_program_record_identifier1 == sam_v1_6_program_record_identifier2 && - sam_v1_6_program_name1 == sam_v1_6_program_name2 && - sam_v1_6_program_command_line1 == sam_v1_6_program_command_line2 && - sam_v1_6_program_previous_pg_id1 == sam_v1_6_program_previous_pg_id2 && - sam_v1_6_program_description1 == sam_v1_6_program_description2 && - sam_v1_6_program_version1 == sam_v1_6_program_version2 + sam_v1_6_program_version1 == + SAM_V1_6_Program sam_v1_6_program_record_identifier2 + sam_v1_6_program_name2 + sam_v1_6_program_command_line2 + sam_v1_6_program_previous_pg_id2 + sam_v1_6_program_description2 + sam_v1_6_program_version2 = + sam_v1_6_program_record_identifier1 == sam_v1_6_program_record_identifier2 && + sam_v1_6_program_name1 == sam_v1_6_program_name2 && + sam_v1_6_program_command_line1 == sam_v1_6_program_command_line2 && + sam_v1_6_program_previous_pg_id1 == sam_v1_6_program_previous_pg_id2 && + sam_v1_6_program_description1 == sam_v1_6_program_description2 && + sam_v1_6_program_version1 == sam_v1_6_program_version2 instance Show SAM_V1_6_Program where show (SAM_V1_6_Program record_identifier name command_line previous_pg_id description version) = @@ -80,12 +83,14 @@ " }" -- | ID tag for @"SAM_V1_6_Program"@. -newtype SAM_V1_6_Program_Record_Identifier = SAM_V1_6_Program_Record_Identifier { sam_v1_6_program_record_identifier_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Program_Record_Identifier = SAM_V1_6_Program_Record_Identifier + { sam_v1_6_program_record_identifier_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Program_Record_Identifier where - SAM_V1_6_Program_Record_Identifier sam_v1_6_program_record_identifier_value1 == SAM_V1_6_Program_Record_Identifier sam_v1_6_program_record_identifier_value2 = sam_v1_6_program_record_identifier_value1 == sam_v1_6_program_record_identifier_value2 + SAM_V1_6_Program_Record_Identifier sam_v1_6_program_record_identifier_value1 == + SAM_V1_6_Program_Record_Identifier sam_v1_6_program_record_identifier_value2 = + sam_v1_6_program_record_identifier_value1 == sam_v1_6_program_record_identifier_value2 instance Show SAM_V1_6_Program_Record_Identifier where show (SAM_V1_6_Program_Record_Identifier value) = @@ -95,12 +100,14 @@ " }" -- | PN tag for @"SAM_V1_6_Program"@. -newtype SAM_V1_6_Program_Name = SAM_V1_6_Program_Name { sam_v1_6_program_name_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Program_Name = SAM_V1_6_Program_Name + { sam_v1_6_program_name_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Program_Name where - SAM_V1_6_Program_Name sam_v1_6_program_name_value1 == SAM_V1_6_Program_Name sam_v1_6_program_name_value2 = sam_v1_6_program_name_value1 == sam_v1_6_program_name_value2 + SAM_V1_6_Program_Name sam_v1_6_program_name_value1 == + SAM_V1_6_Program_Name sam_v1_6_program_name_value2 = + sam_v1_6_program_name_value1 == sam_v1_6_program_name_value2 instance Show SAM_V1_6_Program_Name where show (SAM_V1_6_Program_Name value) = @@ -110,12 +117,14 @@ " }" -- | CL tag for @"SAM_V1_6_Program"@. -newtype SAM_V1_6_Program_Command_Line = SAM_V1_6_Program_Command_Line { sam_v1_6_program_command_line_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Program_Command_Line = SAM_V1_6_Program_Command_Line + { sam_v1_6_program_command_line_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Program_Command_Line where - SAM_V1_6_Program_Command_Line sam_v1_6_program_command_line_value1 == SAM_V1_6_Program_Command_Line sam_v1_6_program_command_line_value2 = sam_v1_6_program_command_line_value1 == sam_v1_6_program_command_line_value2 + SAM_V1_6_Program_Command_Line sam_v1_6_program_command_line_value1 == + SAM_V1_6_Program_Command_Line sam_v1_6_program_command_line_value2 = + sam_v1_6_program_command_line_value1 == sam_v1_6_program_command_line_value2 instance Show SAM_V1_6_Program_Command_Line where show (SAM_V1_6_Program_Command_Line value) = @@ -125,12 +134,14 @@ " }" -- | PP tag for @"SAM_V1_6_Program"@. -newtype SAM_V1_6_Program_Previous_PG_ID = SAM_V1_6_Program_Previous_PG_ID { sam_v1_6_program_previous_pg_id_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Program_Previous_PG_ID = SAM_V1_6_Program_Previous_PG_ID + { sam_v1_6_program_previous_pg_id_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Program_Previous_PG_ID where - SAM_V1_6_Program_Previous_PG_ID sam_v1_6_program_previous_pg_id_value1 == SAM_V1_6_Program_Previous_PG_ID sam_v1_6_program_previous_pg_id_value2 = sam_v1_6_program_previous_pg_id_value1 == sam_v1_6_program_previous_pg_id_value2 + SAM_V1_6_Program_Previous_PG_ID sam_v1_6_program_previous_pg_id_value1 == + SAM_V1_6_Program_Previous_PG_ID sam_v1_6_program_previous_pg_id_value2 = + sam_v1_6_program_previous_pg_id_value1 == sam_v1_6_program_previous_pg_id_value2 instance Show SAM_V1_6_Program_Previous_PG_ID where show (SAM_V1_6_Program_Previous_PG_ID value) = @@ -140,12 +151,14 @@ " }" -- | DS tag for @"SAM_V1_6_Program"@. -newtype SAM_V1_6_Program_Description = SAM_V1_6_Program_Description { sam_v1_6_program_description_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Program_Description = SAM_V1_6_Program_Description + { sam_v1_6_program_description_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Program_Description where - SAM_V1_6_Program_Description sam_v1_6_program_description_value1 == SAM_V1_6_Program_Description sam_v1_6_program_description_value2 = sam_v1_6_program_description_value1 == sam_v1_6_program_description_value2 + SAM_V1_6_Program_Description sam_v1_6_program_description_value1 == + SAM_V1_6_Program_Description sam_v1_6_program_description_value2 = + sam_v1_6_program_description_value1 == sam_v1_6_program_description_value2 instance Show SAM_V1_6_Program_Description where show (SAM_V1_6_Program_Description value) = @@ -155,12 +168,14 @@ " }" -- | VN tag for @"SAM_V1_6_Program"@. -newtype SAM_V1_6_Program_Version = SAM_V1_6_Program_Version { sam_v1_6_program_version_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Program_Version = SAM_V1_6_Program_Version + { sam_v1_6_program_version_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Program_Version where - SAM_V1_6_Program_Version sam_v1_6_program_version_value1 == SAM_V1_6_Program_Version sam_v1_6_program_version_value2 = sam_v1_6_program_version_value1 == sam_v1_6_program_version_value2 + SAM_V1_6_Program_Version sam_v1_6_program_version_value1 == + SAM_V1_6_Program_Version sam_v1_6_program_version_value2 = + sam_v1_6_program_version_value1 == sam_v1_6_program_version_value2 instance Show SAM_V1_6_Program_Version where show (SAM_V1_6_Program_Version value) = diff --git a/src/Data/SAM/Version1_6/Header/RG.hs b/src/Data/SAM/Version1_6/Header/RG.hs --- a/src/Data/SAM/Version1_6/Header/RG.hs +++ b/src/Data/SAM/Version1_6/Header/RG.hs @@ -4,11 +4,12 @@ {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} {-# LANGUAGE TypeFamilies #-} -- | -- Module : Data.SAM.Version1_6.Header.RG --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -43,22 +44,22 @@ -- | Custom SAM (version 1.6) @"SAM_V1_6_Read_Group"@ data type. -- -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Read_Group = SAM_V1_6_Read_Group { sam_v1_6_read_group_identifier :: SAM_V1_6_Read_Group_Identifier - , sam_v1_6_read_group_barcode_sequence :: Maybe SAM_V1_6_Read_Group_Barcode_Sequence - , sam_v1_6_read_group_sequencing_center :: Maybe SAM_V1_6_Read_Group_Sequencing_Center - , sam_v1_6_read_group_description :: Maybe SAM_V1_6_Read_Group_Description - , sam_v1_6_read_group_run_date :: Maybe SAM_V1_6_Read_Group_Run_Date - , sam_v1_6_read_group_flow_order :: Maybe SAM_V1_6_Read_Group_Flow_Order - , sam_v1_6_read_group_key_sequence :: Maybe SAM_V1_6_Read_Group_Key_Sequence - , sam_v1_6_read_group_library :: Maybe SAM_V1_6_Read_Group_Library - , sam_v1_6_read_group_programs :: Maybe SAM_V1_6_Read_Group_Programs - , sam_v1_6_read_group_predicted_median_insert_size :: Maybe SAM_V1_6_Read_Group_Predicted_Median_Insert_Size - , sam_v1_6_read_group_platform :: Maybe SAM_V1_6_Read_Group_Platform - , sam_v1_6_read_group_platform_model :: Maybe SAM_V1_6_Read_Group_Platform_Model - , sam_v1_6_read_group_platform_unit :: Maybe SAM_V1_6_Read_Group_Platform_Unit - , sam_v1_6_read_group_sample :: Maybe SAM_V1_6_Read_Group_Sample - } - deriving (Generic,Typeable) +data SAM_V1_6_Read_Group = SAM_V1_6_Read_Group + { sam_v1_6_read_group_identifier :: SAM_V1_6_Read_Group_Identifier + , sam_v1_6_read_group_barcode_sequence :: Maybe SAM_V1_6_Read_Group_Barcode_Sequence + , sam_v1_6_read_group_sequencing_center :: Maybe SAM_V1_6_Read_Group_Sequencing_Center + , sam_v1_6_read_group_description :: Maybe SAM_V1_6_Read_Group_Description + , sam_v1_6_read_group_run_date :: Maybe SAM_V1_6_Read_Group_Run_Date + , sam_v1_6_read_group_flow_order :: Maybe SAM_V1_6_Read_Group_Flow_Order + , sam_v1_6_read_group_key_sequence :: Maybe SAM_V1_6_Read_Group_Key_Sequence + , sam_v1_6_read_group_library :: Maybe SAM_V1_6_Read_Group_Library + , sam_v1_6_read_group_programs :: Maybe SAM_V1_6_Read_Group_Programs + , sam_v1_6_read_group_predicted_median_insert_size :: Maybe SAM_V1_6_Read_Group_Predicted_Median_Insert_Size + , sam_v1_6_read_group_platform :: Maybe SAM_V1_6_Read_Group_Platform + , sam_v1_6_read_group_platform_model :: Maybe SAM_V1_6_Read_Group_Platform_Model + , sam_v1_6_read_group_platform_unit :: Maybe SAM_V1_6_Read_Group_Platform_Unit + , sam_v1_6_read_group_sample :: Maybe SAM_V1_6_Read_Group_Sample + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group where SAM_V1_6_Read_Group sam_v1_6_read_group_identifier1 @@ -74,33 +75,35 @@ sam_v1_6_read_group_platform1 sam_v1_6_read_group_platform_model1 sam_v1_6_read_group_platform_unit1 - sam_v1_6_read_group_sample1 == SAM_V1_6_Read_Group sam_v1_6_read_group_identifier2 - sam_v1_6_read_group_barcode_sequence2 - sam_v1_6_read_group_sequencing_center2 - sam_v1_6_read_group_description2 - sam_v1_6_read_group_run_date2 - sam_v1_6_read_group_flow_order2 - sam_v1_6_read_group_key_sequence2 - sam_v1_6_read_group_library2 - sam_v1_6_read_group_programs2 - sam_v1_6_read_group_predicted_median_insert_size2 - sam_v1_6_read_group_platform2 - sam_v1_6_read_group_platform_model2 - sam_v1_6_read_group_platform_unit2 - sam_v1_6_read_group_sample2 = sam_v1_6_read_group_identifier1 == sam_v1_6_read_group_identifier2 && - sam_v1_6_read_group_barcode_sequence1 == sam_v1_6_read_group_barcode_sequence2 && - sam_v1_6_read_group_sequencing_center1 == sam_v1_6_read_group_sequencing_center2 && - sam_v1_6_read_group_description1 == sam_v1_6_read_group_description2 && - sam_v1_6_read_group_run_date1 == sam_v1_6_read_group_run_date2 && - sam_v1_6_read_group_flow_order1 == sam_v1_6_read_group_flow_order2 && - sam_v1_6_read_group_key_sequence1 == sam_v1_6_read_group_key_sequence2 && - sam_v1_6_read_group_library1 == sam_v1_6_read_group_library2 && - sam_v1_6_read_group_programs1 == sam_v1_6_read_group_programs2 && - sam_v1_6_read_group_predicted_median_insert_size1 == sam_v1_6_read_group_predicted_median_insert_size2 && - sam_v1_6_read_group_platform1 == sam_v1_6_read_group_platform2 && - sam_v1_6_read_group_platform_model1 == sam_v1_6_read_group_platform_model2 && - sam_v1_6_read_group_platform_unit1 == sam_v1_6_read_group_platform_unit2 && - sam_v1_6_read_group_sample1 == sam_v1_6_read_group_sample2 + sam_v1_6_read_group_sample1 == + SAM_V1_6_Read_Group sam_v1_6_read_group_identifier2 + sam_v1_6_read_group_barcode_sequence2 + sam_v1_6_read_group_sequencing_center2 + sam_v1_6_read_group_description2 + sam_v1_6_read_group_run_date2 + sam_v1_6_read_group_flow_order2 + sam_v1_6_read_group_key_sequence2 + sam_v1_6_read_group_library2 + sam_v1_6_read_group_programs2 + sam_v1_6_read_group_predicted_median_insert_size2 + sam_v1_6_read_group_platform2 + sam_v1_6_read_group_platform_model2 + sam_v1_6_read_group_platform_unit2 + sam_v1_6_read_group_sample2 = + sam_v1_6_read_group_identifier1 == sam_v1_6_read_group_identifier2 && + sam_v1_6_read_group_barcode_sequence1 == sam_v1_6_read_group_barcode_sequence2 && + sam_v1_6_read_group_sequencing_center1 == sam_v1_6_read_group_sequencing_center2 && + sam_v1_6_read_group_description1 == sam_v1_6_read_group_description2 && + sam_v1_6_read_group_run_date1 == sam_v1_6_read_group_run_date2 && + sam_v1_6_read_group_flow_order1 == sam_v1_6_read_group_flow_order2 && + sam_v1_6_read_group_key_sequence1 == sam_v1_6_read_group_key_sequence2 && + sam_v1_6_read_group_library1 == sam_v1_6_read_group_library2 && + sam_v1_6_read_group_programs1 == sam_v1_6_read_group_programs2 && + sam_v1_6_read_group_predicted_median_insert_size1 == sam_v1_6_read_group_predicted_median_insert_size2 && + sam_v1_6_read_group_platform1 == sam_v1_6_read_group_platform2 && + sam_v1_6_read_group_platform_model1 == sam_v1_6_read_group_platform_model2 && + sam_v1_6_read_group_platform_unit1 == sam_v1_6_read_group_platform_unit2 && + sam_v1_6_read_group_sample1 == sam_v1_6_read_group_sample2 instance Show SAM_V1_6_Read_Group where show (SAM_V1_6_Read_Group group_identifier @@ -150,12 +153,14 @@ " }" -- | ID tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Identifier = SAM_V1_6_Read_Group_Identifier { sam_v1_6_read_group_identifier_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Identifier = SAM_V1_6_Read_Group_Identifier + { sam_v1_6_read_group_identifier_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Identifier where - SAM_V1_6_Read_Group_Identifier sam_v1_6_read_group_identifier_value1 == SAM_V1_6_Read_Group_Identifier sam_v1_6_read_group_identifier_value2 = sam_v1_6_read_group_identifier_value1 == sam_v1_6_read_group_identifier_value2 + SAM_V1_6_Read_Group_Identifier sam_v1_6_read_group_identifier_value1 == + SAM_V1_6_Read_Group_Identifier sam_v1_6_read_group_identifier_value2 = + sam_v1_6_read_group_identifier_value1 == sam_v1_6_read_group_identifier_value2 instance Show SAM_V1_6_Read_Group_Identifier where show (SAM_V1_6_Read_Group_Identifier value) = @@ -165,12 +170,14 @@ " }" -- | BC tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Barcode_Sequence = SAM_V1_6_Read_Group_Barcode_Sequence { sam_v1_6_read_group_barcode_sequence_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Barcode_Sequence = SAM_V1_6_Read_Group_Barcode_Sequence + { sam_v1_6_read_group_barcode_sequence_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Barcode_Sequence where - SAM_V1_6_Read_Group_Barcode_Sequence sam_v1_6_read_group_barcode_sequence_value1 == SAM_V1_6_Read_Group_Barcode_Sequence sam_v1_6_read_group_barcode_sequence_value2 = sam_v1_6_read_group_barcode_sequence_value1 == sam_v1_6_read_group_barcode_sequence_value2 + SAM_V1_6_Read_Group_Barcode_Sequence sam_v1_6_read_group_barcode_sequence_value1 == + SAM_V1_6_Read_Group_Barcode_Sequence sam_v1_6_read_group_barcode_sequence_value2 = + sam_v1_6_read_group_barcode_sequence_value1 == sam_v1_6_read_group_barcode_sequence_value2 instance Show SAM_V1_6_Read_Group_Barcode_Sequence where show (SAM_V1_6_Read_Group_Barcode_Sequence value) = @@ -180,12 +187,14 @@ " }" -- | CN tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Sequencing_Center = SAM_V1_6_Read_Group_Sequencing_Center { sam_v1_6_read_group_sequencing_center_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Sequencing_Center = SAM_V1_6_Read_Group_Sequencing_Center + { sam_v1_6_read_group_sequencing_center_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Sequencing_Center where - SAM_V1_6_Read_Group_Sequencing_Center sam_v1_6_read_group_sequencing_center_value1 == SAM_V1_6_Read_Group_Sequencing_Center sam_v1_6_read_group_sequencing_center_value2 = sam_v1_6_read_group_sequencing_center_value1 == sam_v1_6_read_group_sequencing_center_value2 + SAM_V1_6_Read_Group_Sequencing_Center sam_v1_6_read_group_sequencing_center_value1 == + SAM_V1_6_Read_Group_Sequencing_Center sam_v1_6_read_group_sequencing_center_value2 = + sam_v1_6_read_group_sequencing_center_value1 == sam_v1_6_read_group_sequencing_center_value2 instance Show SAM_V1_6_Read_Group_Sequencing_Center where show (SAM_V1_6_Read_Group_Sequencing_Center value) = @@ -195,12 +204,14 @@ " }" -- | DS tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Description = SAM_V1_6_Read_Group_Description { sam_v1_6_read_group_description_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Description = SAM_V1_6_Read_Group_Description + { sam_v1_6_read_group_description_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Description where - SAM_V1_6_Read_Group_Description sam_v1_6_read_group_description_value1 == SAM_V1_6_Read_Group_Description sam_v1_6_read_group_description_value2 = sam_v1_6_read_group_description_value1 == sam_v1_6_read_group_description_value2 + SAM_V1_6_Read_Group_Description sam_v1_6_read_group_description_value1 == + SAM_V1_6_Read_Group_Description sam_v1_6_read_group_description_value2 = + sam_v1_6_read_group_description_value1 == sam_v1_6_read_group_description_value2 instance Show SAM_V1_6_Read_Group_Description where show (SAM_V1_6_Read_Group_Description value) = @@ -210,12 +221,14 @@ " }" -- | DT tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Run_Date = SAM_V1_6_Read_Group_Run_Date { sam_v1_6_read_group_run_date_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Run_Date = SAM_V1_6_Read_Group_Run_Date + { sam_v1_6_read_group_run_date_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Run_Date where - SAM_V1_6_Read_Group_Run_Date sam_v1_6_read_group_run_date_value1 == SAM_V1_6_Read_Group_Run_Date sam_v1_6_read_group_run_date_value2 = sam_v1_6_read_group_run_date_value1 == sam_v1_6_read_group_run_date_value2 + SAM_V1_6_Read_Group_Run_Date sam_v1_6_read_group_run_date_value1 == + SAM_V1_6_Read_Group_Run_Date sam_v1_6_read_group_run_date_value2 = + sam_v1_6_read_group_run_date_value1 == sam_v1_6_read_group_run_date_value2 instance Show SAM_V1_6_Read_Group_Run_Date where show (SAM_V1_6_Read_Group_Run_Date value) = @@ -225,12 +238,14 @@ " }" -- | FO tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Flow_Order = SAM_V1_6_Read_Group_Flow_Order { sam_v1_6_read_group_flow_order_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Flow_Order = SAM_V1_6_Read_Group_Flow_Order + { sam_v1_6_read_group_flow_order_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Flow_Order where - SAM_V1_6_Read_Group_Flow_Order sam_v1_6_one_line_comment_value1 == SAM_V1_6_Read_Group_Flow_Order sam_v1_6_read_group_flow_order_value2 = sam_v1_6_one_line_comment_value1 == sam_v1_6_read_group_flow_order_value2 + SAM_V1_6_Read_Group_Flow_Order sam_v1_6_one_line_comment_value1 == + SAM_V1_6_Read_Group_Flow_Order sam_v1_6_read_group_flow_order_value2 = + sam_v1_6_one_line_comment_value1 == sam_v1_6_read_group_flow_order_value2 instance Show SAM_V1_6_Read_Group_Flow_Order where show (SAM_V1_6_Read_Group_Flow_Order value) = @@ -240,12 +255,14 @@ " }" -- | KS tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Key_Sequence = SAM_V1_6_Read_Group_Key_Sequence { sam_v1_6_read_group_key_sequence_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Key_Sequence = SAM_V1_6_Read_Group_Key_Sequence + { sam_v1_6_read_group_key_sequence_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Key_Sequence where - SAM_V1_6_Read_Group_Key_Sequence sam_v1_6_read_group_key_sequence_value1 == SAM_V1_6_Read_Group_Key_Sequence sam_v1_6_read_group_key_sequence_value2 = sam_v1_6_read_group_key_sequence_value1 == sam_v1_6_read_group_key_sequence_value2 + SAM_V1_6_Read_Group_Key_Sequence sam_v1_6_read_group_key_sequence_value1 == + SAM_V1_6_Read_Group_Key_Sequence sam_v1_6_read_group_key_sequence_value2 = + sam_v1_6_read_group_key_sequence_value1 == sam_v1_6_read_group_key_sequence_value2 instance Show SAM_V1_6_Read_Group_Key_Sequence where show (SAM_V1_6_Read_Group_Key_Sequence value) = @@ -255,12 +272,14 @@ " }" -- | LB tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Library = SAM_V1_6_Read_Group_Library { sam_v1_6_read_group_library_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Library = SAM_V1_6_Read_Group_Library + { sam_v1_6_read_group_library_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Library where - SAM_V1_6_Read_Group_Library sam_v1_6_read_group_library_value1 == SAM_V1_6_Read_Group_Library sam_v1_6_read_group_library_value2 = sam_v1_6_read_group_library_value1 == sam_v1_6_read_group_library_value2 + SAM_V1_6_Read_Group_Library sam_v1_6_read_group_library_value1 == + SAM_V1_6_Read_Group_Library sam_v1_6_read_group_library_value2 = + sam_v1_6_read_group_library_value1 == sam_v1_6_read_group_library_value2 instance Show SAM_V1_6_Read_Group_Library where show (SAM_V1_6_Read_Group_Library value) = @@ -270,12 +289,14 @@ " }" -- | PG tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Programs = SAM_V1_6_Read_Group_Programs { sam_v1_6_read_group_programs_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Programs = SAM_V1_6_Read_Group_Programs + { sam_v1_6_read_group_programs_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Programs where - SAM_V1_6_Read_Group_Programs sam_v1_6_read_group_programs_value1 == SAM_V1_6_Read_Group_Programs sam_v1_6_read_group_programs_value2 = sam_v1_6_read_group_programs_value1 == sam_v1_6_read_group_programs_value2 + SAM_V1_6_Read_Group_Programs sam_v1_6_read_group_programs_value1 == + SAM_V1_6_Read_Group_Programs sam_v1_6_read_group_programs_value2 = + sam_v1_6_read_group_programs_value1 == sam_v1_6_read_group_programs_value2 instance Show SAM_V1_6_Read_Group_Programs where show (SAM_V1_6_Read_Group_Programs value) = @@ -285,12 +306,14 @@ " }" -- | PI tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Predicted_Median_Insert_Size = SAM_V1_6_Read_Group_Predicted_Median_Insert_Size { sam_v1_6_read_group_predicted_median_insert_size_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Predicted_Median_Insert_Size = SAM_V1_6_Read_Group_Predicted_Median_Insert_Size + { sam_v1_6_read_group_predicted_median_insert_size_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Predicted_Median_Insert_Size where - SAM_V1_6_Read_Group_Predicted_Median_Insert_Size sam_v1_6_read_group_predicted_median_insert_size_value1 == SAM_V1_6_Read_Group_Predicted_Median_Insert_Size sam_v1_6_read_group_predicted_median_insert_size_value2 = sam_v1_6_read_group_predicted_median_insert_size_value1 == sam_v1_6_read_group_predicted_median_insert_size_value2 + SAM_V1_6_Read_Group_Predicted_Median_Insert_Size sam_v1_6_read_group_predicted_median_insert_size_value1 == + SAM_V1_6_Read_Group_Predicted_Median_Insert_Size sam_v1_6_read_group_predicted_median_insert_size_value2 = + sam_v1_6_read_group_predicted_median_insert_size_value1 == sam_v1_6_read_group_predicted_median_insert_size_value2 instance Show SAM_V1_6_Read_Group_Predicted_Median_Insert_Size where show (SAM_V1_6_Read_Group_Predicted_Median_Insert_Size value) = @@ -300,12 +323,14 @@ " }" -- | PL tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Platform = SAM_V1_6_Read_Group_Platform { sam_v1_6_read_group_platform_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Platform = SAM_V1_6_Read_Group_Platform + { sam_v1_6_read_group_platform_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Platform where - SAM_V1_6_Read_Group_Platform sam_v1_6_read_group_platform_value1 == SAM_V1_6_Read_Group_Platform sam_v1_6_read_group_platform_value2 = sam_v1_6_read_group_platform_value1 == sam_v1_6_read_group_platform_value2 + SAM_V1_6_Read_Group_Platform sam_v1_6_read_group_platform_value1 == + SAM_V1_6_Read_Group_Platform sam_v1_6_read_group_platform_value2 = + sam_v1_6_read_group_platform_value1 == sam_v1_6_read_group_platform_value2 instance Show SAM_V1_6_Read_Group_Platform where show (SAM_V1_6_Read_Group_Platform value) = @@ -315,12 +340,14 @@ " }" -- | PM tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Platform_Model = SAM_V1_6_Read_Group_Platform_Model { sam_v1_6_read_group_platform_model_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Platform_Model = SAM_V1_6_Read_Group_Platform_Model + { sam_v1_6_read_group_platform_model_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Platform_Model where - SAM_V1_6_Read_Group_Platform_Model sam_v1_6_read_group_platform_model_value1 == SAM_V1_6_Read_Group_Platform_Model sam_v1_6_read_group_platform_model_value2 = sam_v1_6_read_group_platform_model_value1 == sam_v1_6_read_group_platform_model_value2 + SAM_V1_6_Read_Group_Platform_Model sam_v1_6_read_group_platform_model_value1 == + SAM_V1_6_Read_Group_Platform_Model sam_v1_6_read_group_platform_model_value2 = + sam_v1_6_read_group_platform_model_value1 == sam_v1_6_read_group_platform_model_value2 instance Show SAM_V1_6_Read_Group_Platform_Model where show (SAM_V1_6_Read_Group_Platform_Model value) = @@ -330,12 +357,14 @@ " }" -- | PU tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Platform_Unit = SAM_V1_6_Read_Group_Platform_Unit { sam_v1_6_read_group_platform_unit_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Platform_Unit = SAM_V1_6_Read_Group_Platform_Unit + { sam_v1_6_read_group_platform_unit_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Platform_Unit where - SAM_V1_6_Read_Group_Platform_Unit sam_v1_6_read_group_platform_unit_value1 == SAM_V1_6_Read_Group_Platform_Unit sam_v1_6_read_group_platform_unit_value2 = sam_v1_6_read_group_platform_unit_value1 == sam_v1_6_read_group_platform_unit_value2 + SAM_V1_6_Read_Group_Platform_Unit sam_v1_6_read_group_platform_unit_value1 == + SAM_V1_6_Read_Group_Platform_Unit sam_v1_6_read_group_platform_unit_value2 = + sam_v1_6_read_group_platform_unit_value1 == sam_v1_6_read_group_platform_unit_value2 instance Show SAM_V1_6_Read_Group_Platform_Unit where show (SAM_V1_6_Read_Group_Platform_Unit value) = @@ -345,12 +374,14 @@ " }" -- | SM tag for @"SAM_V1_6_Read_Group"@. -newtype SAM_V1_6_Read_Group_Sample = SAM_V1_6_Read_Group_Sample { sam_v1_6_read_group_sample_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Read_Group_Sample = SAM_V1_6_Read_Group_Sample + { sam_v1_6_read_group_sample_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Read_Group_Sample where - SAM_V1_6_Read_Group_Sample sam_v1_6_read_group_sample_value1 == SAM_V1_6_Read_Group_Sample sam_v1_6_read_group_sample_value2 = sam_v1_6_read_group_sample_value1 == sam_v1_6_read_group_sample_value2 + SAM_V1_6_Read_Group_Sample sam_v1_6_read_group_sample_value1 == + SAM_V1_6_Read_Group_Sample sam_v1_6_read_group_sample_value2 = + sam_v1_6_read_group_sample_value1 == sam_v1_6_read_group_sample_value2 instance Show SAM_V1_6_Read_Group_Sample where show (SAM_V1_6_Read_Group_Sample value) = diff --git a/src/Data/SAM/Version1_6/Header/SQ.hs b/src/Data/SAM/Version1_6/Header/SQ.hs --- a/src/Data/SAM/Version1_6/Header/SQ.hs +++ b/src/Data/SAM/Version1_6/Header/SQ.hs @@ -4,11 +4,12 @@ {-# LANGUAGE FlexibleInstances #-} {-# LANGUAGE MultiParamTypeClasses #-} {-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE StrictData #-} {-# LANGUAGE TypeFamilies #-} -- | -- Module : Data.SAM.Version1_6.Header.SQ --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -39,18 +40,18 @@ -- | Custom SAM (version 1.6) @"SAM_V1_6_Reference_Sequence_Dictionary"@ data type. -- -- See section 1.3 of the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -data SAM_V1_6_Reference_Sequence_Dictionary = SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name - , sam_v1_6_reference_sequence_dictionary_reference_sequence_length :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length - , sam_v1_6_reference_sequence_dictionary_alternative_locus :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus - , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names - , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier - , sam_v1_6_reference_sequence_dictionary_description :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Description - , sam_v1_6_reference_sequence_dictionary_md5_checksum :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum - , sam_v1_6_reference_sequence_dictionary_species :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Species - , sam_v1_6_reference_sequence_dictionary_molecule_topology :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology - , sam_v1_6_reference_sequence_dictionary_uri :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_URI - } - deriving (Generic,Typeable) +data SAM_V1_6_Reference_Sequence_Dictionary = SAM_V1_6_Reference_Sequence_Dictionary + { sam_v1_6_reference_sequence_dictionary_reference_sequence_name :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name + , sam_v1_6_reference_sequence_dictionary_reference_sequence_length :: SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length + , sam_v1_6_reference_sequence_dictionary_alternative_locus :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus + , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names + , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier + , sam_v1_6_reference_sequence_dictionary_description :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Description + , sam_v1_6_reference_sequence_dictionary_md5_checksum :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum + , sam_v1_6_reference_sequence_dictionary_species :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Species + , sam_v1_6_reference_sequence_dictionary_molecule_topology :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology + , sam_v1_6_reference_sequence_dictionary_uri :: Maybe SAM_V1_6_Reference_Sequence_Dictionary_URI + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary where SAM_V1_6_Reference_Sequence_Dictionary sam_v1_6_reference_sequence_dictionary_reference_sequence_name1 @@ -62,25 +63,27 @@ sam_v1_6_reference_sequence_dictionary_md5_checksum1 sam_v1_6_reference_sequence_dictionary_species1 sam_v1_6_reference_sequence_dictionary_molecule_topology1 - sam_v1_6_reference_sequence_dictionary_uri1 == SAM_V1_6_Reference_Sequence_Dictionary sam_v1_6_reference_sequence_dictionary_reference_sequence_name2 - sam_v1_6_reference_sequence_dictionary_reference_sequence_length2 - sam_v1_6_reference_sequence_dictionary_reference_alternative_locus2 - sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2 - sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2 - sam_v1_6_reference_sequence_dictionary_description2 - sam_v1_6_reference_sequence_dictionary_md5_checksum2 - sam_v1_6_reference_sequence_dictionary_species2 - sam_v1_6_reference_sequence_dictionary_molecule_topology2 - sam_v1_6_reference_sequence_dictionary_uri2 = sam_v1_6_reference_sequence_dictionary_reference_sequence_name1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_name2 && - sam_v1_6_reference_sequence_dictionary_reference_sequence_length1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_length2 && - sam_v1_6_reference_sequence_dictionary_reference_alternative_locus1 == sam_v1_6_reference_sequence_dictionary_reference_alternative_locus2 && - sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names1 == sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2 && - sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier1 == sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2 && - sam_v1_6_reference_sequence_dictionary_description1 == sam_v1_6_reference_sequence_dictionary_description2 && - sam_v1_6_reference_sequence_dictionary_md5_checksum1 == sam_v1_6_reference_sequence_dictionary_md5_checksum2 && - sam_v1_6_reference_sequence_dictionary_species1 == sam_v1_6_reference_sequence_dictionary_species2 && - sam_v1_6_reference_sequence_dictionary_molecule_topology1 == sam_v1_6_reference_sequence_dictionary_molecule_topology2 && - sam_v1_6_reference_sequence_dictionary_uri1 == sam_v1_6_reference_sequence_dictionary_uri2 + sam_v1_6_reference_sequence_dictionary_uri1 == + SAM_V1_6_Reference_Sequence_Dictionary sam_v1_6_reference_sequence_dictionary_reference_sequence_name2 + sam_v1_6_reference_sequence_dictionary_reference_sequence_length2 + sam_v1_6_reference_sequence_dictionary_reference_alternative_locus2 + sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2 + sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2 + sam_v1_6_reference_sequence_dictionary_description2 + sam_v1_6_reference_sequence_dictionary_md5_checksum2 + sam_v1_6_reference_sequence_dictionary_species2 + sam_v1_6_reference_sequence_dictionary_molecule_topology2 + sam_v1_6_reference_sequence_dictionary_uri2 = + sam_v1_6_reference_sequence_dictionary_reference_sequence_name1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_name2 && + sam_v1_6_reference_sequence_dictionary_reference_sequence_length1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_length2 && + sam_v1_6_reference_sequence_dictionary_reference_alternative_locus1 == sam_v1_6_reference_sequence_dictionary_reference_alternative_locus2 && + sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names1 == sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2 && + sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier1 == sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2 && + sam_v1_6_reference_sequence_dictionary_description1 == sam_v1_6_reference_sequence_dictionary_description2 && + sam_v1_6_reference_sequence_dictionary_md5_checksum1 == sam_v1_6_reference_sequence_dictionary_md5_checksum2 && + sam_v1_6_reference_sequence_dictionary_species1 == sam_v1_6_reference_sequence_dictionary_species2 && + sam_v1_6_reference_sequence_dictionary_molecule_topology1 == sam_v1_6_reference_sequence_dictionary_molecule_topology2 && + sam_v1_6_reference_sequence_dictionary_uri1 == sam_v1_6_reference_sequence_dictionary_uri2 instance Show SAM_V1_6_Reference_Sequence_Dictionary where show (SAM_V1_6_Reference_Sequence_Dictionary reference_sequence_name @@ -118,12 +121,14 @@ " }" -- | SN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name + { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name where - SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value2 = sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value2 = + sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name where show (SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name value) = @@ -133,12 +138,14 @@ " }" -- | LN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length + { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length where - SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value2 = sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value2 = + sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value1 == sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length where show (SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length value) = @@ -148,12 +155,14 @@ " }" -- | AH tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus = SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { sam_v1_6_reference_sequence_dictionary_alternative_locus_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus = SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus + { sam_v1_6_reference_sequence_dictionary_alternative_locus_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus where - SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus sam_v1_6_reference_sequence_dictionary_alternative_locus_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus sam_v1_6_reference_sequence_dictionary_alternative_locus_value2 = sam_v1_6_reference_sequence_dictionary_alternative_locus_value1 == sam_v1_6_reference_sequence_dictionary_alternative_locus_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus sam_v1_6_reference_sequence_dictionary_alternative_locus_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus sam_v1_6_reference_sequence_dictionary_alternative_locus_value2 = + sam_v1_6_reference_sequence_dictionary_alternative_locus_value1 == sam_v1_6_reference_sequence_dictionary_alternative_locus_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus where show (SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus value) = @@ -163,12 +172,14 @@ " }" -- | AN tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names = SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names = SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names + { sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names where - SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value2 = sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value1 == sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value2 = + sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value1 == sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names where show (SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names value) = @@ -178,12 +189,14 @@ " }" -- | AS tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier = SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier = SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier + { sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier where - SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value2 = sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value1 == sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value2 = + sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value1 == sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier where show (SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier value) = @@ -193,12 +206,14 @@ " }" -- | DS tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Description = SAM_V1_6_Reference_Sequence_Dictionary_Description { sam_v1_6_reference_sequence_dictionary_description_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Description = SAM_V1_6_Reference_Sequence_Dictionary_Description + { sam_v1_6_reference_sequence_dictionary_description_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Description where - SAM_V1_6_Reference_Sequence_Dictionary_Description sam_v1_6_reference_sequence_dictionary_description_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Description sam_v1_6_reference_sequence_dictionary_description_value2 = sam_v1_6_reference_sequence_dictionary_description_value1 == sam_v1_6_reference_sequence_dictionary_description_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Description sam_v1_6_reference_sequence_dictionary_description_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Description sam_v1_6_reference_sequence_dictionary_description_value2 = + sam_v1_6_reference_sequence_dictionary_description_value1 == sam_v1_6_reference_sequence_dictionary_description_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Description where show (SAM_V1_6_Reference_Sequence_Dictionary_Description value) = @@ -208,12 +223,14 @@ " }" -- | M5 tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum = SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { sam_v1_6_reference_sequence_dictionary_md5_checksum_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum = SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum + { sam_v1_6_reference_sequence_dictionary_md5_checksum_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum where - SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum sam_v1_6_reference_sequence_dictionary_md5_checksum_value1 == SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum sam_v1_6_reference_sequence_dictionary_md5_checksum_value2 = sam_v1_6_reference_sequence_dictionary_md5_checksum_value1 == sam_v1_6_reference_sequence_dictionary_md5_checksum_value2 + SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum sam_v1_6_reference_sequence_dictionary_md5_checksum_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum sam_v1_6_reference_sequence_dictionary_md5_checksum_value2 = + sam_v1_6_reference_sequence_dictionary_md5_checksum_value1 == sam_v1_6_reference_sequence_dictionary_md5_checksum_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum where show (SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum value) = @@ -223,12 +240,14 @@ " }" -- | SP tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Species = SAM_V1_6_Reference_Sequence_Dictionary_Species { sam_v1_6_reference_sequence_dictionary_species_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Species = SAM_V1_6_Reference_Sequence_Dictionary_Species + { sam_v1_6_reference_sequence_dictionary_species_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Species where - SAM_V1_6_Reference_Sequence_Dictionary_Species sam_v1_6_reference_sequence_dictionary_species_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Species sam_v1_6_reference_sequence_dictionary_species_value2 = sam_v1_6_reference_sequence_dictionary_species_value1 == sam_v1_6_reference_sequence_dictionary_species_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Species sam_v1_6_reference_sequence_dictionary_species_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Species sam_v1_6_reference_sequence_dictionary_species_value2 = + sam_v1_6_reference_sequence_dictionary_species_value1 == sam_v1_6_reference_sequence_dictionary_species_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Species where show (SAM_V1_6_Reference_Sequence_Dictionary_Species value) = @@ -238,12 +257,14 @@ " }" -- | TP tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology = SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { sam_v1_6_reference_sequence_dictionary_molecule_topology_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology = SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology + { sam_v1_6_reference_sequence_dictionary_molecule_topology_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology where - SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology sam_v1_6_reference_sequence_dictionary_molecule_topology_value1 == SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology sam_v1_6_reference_sequence_dictionary_molecule_topology_value2 = sam_v1_6_reference_sequence_dictionary_molecule_topology_value1 == sam_v1_6_reference_sequence_dictionary_molecule_topology_value2 + SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology sam_v1_6_reference_sequence_dictionary_molecule_topology_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology sam_v1_6_reference_sequence_dictionary_molecule_topology_value2 = + sam_v1_6_reference_sequence_dictionary_molecule_topology_value1 == sam_v1_6_reference_sequence_dictionary_molecule_topology_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology where show (SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology value) = @@ -253,12 +274,14 @@ " }" -- | UR tag for @"SAM_V1_6_Reference_Sequence_Dictionary"@. -newtype SAM_V1_6_Reference_Sequence_Dictionary_URI = SAM_V1_6_Reference_Sequence_Dictionary_URI { sam_v1_6_reference_sequence_dictionary_uri_value :: ByteString - } - deriving (Generic,Typeable) +newtype SAM_V1_6_Reference_Sequence_Dictionary_URI = SAM_V1_6_Reference_Sequence_Dictionary_URI + { sam_v1_6_reference_sequence_dictionary_uri_value :: ByteString + } deriving (Generic,Typeable) instance Eq SAM_V1_6_Reference_Sequence_Dictionary_URI where - SAM_V1_6_Reference_Sequence_Dictionary_URI sam_v1_6_reference_sequence_dictionary_uri_value1 == SAM_V1_6_Reference_Sequence_Dictionary_URI sam_v1_6_reference_sequence_dictionary_uri_value2 = sam_v1_6_reference_sequence_dictionary_uri_value1 == sam_v1_6_reference_sequence_dictionary_uri_value2 + SAM_V1_6_Reference_Sequence_Dictionary_URI sam_v1_6_reference_sequence_dictionary_uri_value1 == + SAM_V1_6_Reference_Sequence_Dictionary_URI sam_v1_6_reference_sequence_dictionary_uri_value2 = + sam_v1_6_reference_sequence_dictionary_uri_value1 == sam_v1_6_reference_sequence_dictionary_uri_value2 instance Show SAM_V1_6_Reference_Sequence_Dictionary_URI where show (SAM_V1_6_Reference_Sequence_Dictionary_URI value) = diff --git a/src/Data/SAM/Version1_6/Internal.hs b/src/Data/SAM/Version1_6/Internal.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Internal.hs @@ -0,0 +1,27 @@ +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE TypeFamilies #-} + +-- | +-- Module : Data.SAM.Version1_6.Internal +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Internal ( -- * Parsing + maybeOption + ) where + +import Data.Attoparsec.ByteString.Lazy as DABL + +-- | Make a parser optional, return Nothing if there is no match. +maybeOption :: Parser a + -> Parser (Maybe a) +maybeOption p = option Nothing + (Just <$> p) diff --git a/src/Data/SAM/Version1_6/Read/Base.hs b/src/Data/SAM/Version1_6/Read/Base.hs --- a/src/Data/SAM/Version1_6/Read/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Base.hs @@ -5,7 +5,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -19,6 +19,7 @@ ) where import Data.SAM.Version1_6.Base +import Data.SAM.Version1_6.Internal import Data.SAM.Version1_6.Read.Parser.Header.HD.Base import Data.SAM.Version1_6.Read.Parser.Header.SQ.Base import Data.SAM.Version1_6.Read.Parser.Header.RG.Base @@ -26,87 +27,115 @@ import Data.SAM.Version1_6.Read.Parser.Header.CO.Base import Data.SAM.Version1_6.Read.Parser.Alignment.Base -import Control.Applicative.Permutations (intercalateEffect,toPermutationWithDefault) -import Data.Attoparsec.ByteString.Char8 as DABC8 (endOfLine) -import Data.Attoparsec.ByteString.Lazy as DABL -import Data.ByteString.Lazy as DBL -import Data.Sequence as DSeq -import qualified Streamly.Data.Stream as S -import Streamly.External.ByteString.Lazy as StreamlyLByteString (fromChunksIO) -import Streamly.Internal.FileSystem.File as StreamlyInternalFile (chunkReader) - --- | Make a parser optional, return Nothing if there is no match. -maybeOption :: Parser a - -> Parser (Maybe a) -maybeOption p = option Nothing (Just <$> p) +import Control.Applicative.Permutations (intercalateEffect,toPermutationWithDefault) +import Data.Attoparsec.ByteString.Char8 as DABC8 (endOfLine) +import Data.Attoparsec.ByteString.Lazy as DABL +import Data.ByteString.Lazy as DBL +import Data.Sequence as DSeq +import qualified Streamly.Data.Stream as S +import Streamly.External.ByteString.Lazy as StreamlyLByteString (fromChunksIO) +import Streamly.Internal.FileSystem.File as StreamlyInternalFile (chunkReader) -- | Define the @"SAM_V1_6"@ parser. parse_SAM_V1_6 :: Parser SAM_V1_6 parse_SAM_V1_6 = do - filelevelmetadata <- maybeOption parse_SAM_V1_6_File_Level_Metadata + filelevelmetadata <- + maybeOption parse_SAM_V1_6_File_Level_Metadata case filelevelmetadata of - Nothing -> do samwoalignment <- intercalateEffect endOfLine $ - (,,,) - <$> toPermutationWithDefault Nothing - (Just <$> DABL.many1' parse_SAM_V1_6_Reference_Sequence_Dictionary) - <*> toPermutationWithDefault Nothing - (Just <$> DABL.many1' parse_SAM_V1_6_Read_Group) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Program) - <*> toPermutationWithDefault Nothing - (Just <$> DABL.many1' parse_SAM_V1_6_One_Line_Comment) - alignment <- DABL.many1' parse_SAM_V1_6_Alignment - return SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing - , sam_v1_6_reference_sequence_dictionary = (\(a,_,_,_) -> case a of - Nothing -> Nothing - Just finala -> Just $ DSeq.fromList finala - ) samwoalignment - , sam_v1_6_read_group = (\(_,b,_,_) -> case b of - Nothing -> Nothing - Just finalb -> Just $ DSeq.fromList finalb - ) samwoalignment - , sam_v1_6_program = (\(_,_,c,_) -> c) samwoalignment - , sam_v1_6_one_line_comment = (\(_,_,_,d) -> case d of - Nothing -> Nothing - Just finald -> Just $ DSeq.fromList finald - ) samwoalignment - , sam_v1_6_alignment = DSeq.fromList alignment - } - Just flm -> do samwoalignment <- intercalateEffect endOfLine $ - (,,,) - <$> toPermutationWithDefault Nothing - (Just <$> DABL.many1' parse_SAM_V1_6_Reference_Sequence_Dictionary) - <*> toPermutationWithDefault Nothing - (Just <$> DABL.many1' parse_SAM_V1_6_Read_Group) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Program) - <*> toPermutationWithDefault Nothing - (Just <$> DABL.many1' parse_SAM_V1_6_One_Line_Comment) - alignment <- DABL.many1' parse_SAM_V1_6_Alignment - return SAM_V1_6 { sam_v1_6_file_level_metadata = Just flm - , sam_v1_6_reference_sequence_dictionary = (\(a,_,_,_) -> case a of - Nothing -> Nothing - Just finala -> Just $ DSeq.fromList finala - ) samwoalignment - , sam_v1_6_read_group = (\(_,b,_,_) -> case b of - Nothing -> Nothing - Just finalb -> Just $ DSeq.fromList finalb - ) samwoalignment - , sam_v1_6_program = (\(_,_,c,_) -> c) samwoalignment - , sam_v1_6_one_line_comment = (\(_,_,_,d) -> case d of - Nothing -> Nothing - Just finald -> Just $ DSeq.fromList finald - ) samwoalignment - , sam_v1_6_alignment = DSeq.fromList alignment - } + Nothing -> do + samwoalignment <- + intercalateEffect endOfLine $ + (,,,) + <$> toPermutationWithDefault Nothing + (Just <$> DABL.many1' parse_SAM_V1_6_Reference_Sequence_Dictionary) + <*> toPermutationWithDefault Nothing + (Just <$> DABL.many1' parse_SAM_V1_6_Read_Group) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Program) + <*> toPermutationWithDefault Nothing + (Just <$> DABL.many1' parse_SAM_V1_6_One_Line_Comment) + alignment <- + DABL.many1' parse_SAM_V1_6_Alignment + return SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing + , sam_v1_6_reference_sequence_dictionary = (\(a,_,_,_) -> + case a of + Nothing -> + Nothing + Just finala -> + Just $ + DSeq.fromList finala + ) samwoalignment + , sam_v1_6_read_group = (\(_,b,_,_) -> + case b of + Nothing -> + Nothing + Just finalb -> + Just $ + DSeq.fromList finalb + ) samwoalignment + , sam_v1_6_program = (\(_,_,c,_) -> c) samwoalignment + , sam_v1_6_one_line_comment = (\(_,_,_,d) -> + case d of + Nothing -> + Nothing + Just finald -> + Just $ + DSeq.fromList finald + ) samwoalignment + , sam_v1_6_alignment = DSeq.fromList alignment + } + Just flm -> do + samwoalignment <- + intercalateEffect endOfLine $ + (,,,) + <$> toPermutationWithDefault Nothing + (Just <$> DABL.many1' parse_SAM_V1_6_Reference_Sequence_Dictionary) + <*> toPermutationWithDefault Nothing + (Just <$> DABL.many1' parse_SAM_V1_6_Read_Group) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Program) + <*> toPermutationWithDefault Nothing + (Just <$> DABL.many1' parse_SAM_V1_6_One_Line_Comment) + alignment <- + DABL.many1' parse_SAM_V1_6_Alignment + return SAM_V1_6 { sam_v1_6_file_level_metadata = Just flm + , sam_v1_6_reference_sequence_dictionary = (\(a,_,_,_) -> + case a of + Nothing -> + Nothing + Just finala -> + Just $ + DSeq.fromList finala + ) samwoalignment + , sam_v1_6_read_group = (\(_,b,_,_) -> + case b of + Nothing -> + Nothing + Just finalb -> + Just $ + DSeq.fromList finalb + ) samwoalignment + , sam_v1_6_program = (\(_,_,c,_) -> c) samwoalignment + , sam_v1_6_one_line_comment = (\(_,_,_,d) -> + case d of + Nothing -> + Nothing + Just finald -> + Just $ + DSeq.fromList finald + ) samwoalignment + , sam_v1_6_alignment = DSeq.fromList alignment + } -- | Run the @"SAM_V1_6"@ parser. readSAM_V1_6_LBS :: DBL.ByteString -> IO SAM_V1_6 readSAM_V1_6_LBS lbs = case (DABL.parseOnly parse_SAM_V1_6 lbs) of - Left samparseerror -> error samparseerror - Right sam -> return sam + Left samparseerror -> + error samparseerror + Right sam -> + return sam -- | Read a @"SAM_V1_6"@ from a file. -- @@ -117,5 +146,6 @@ -> IO SAM_V1_6 readSAM_V1_6 fp = do let lazysamfile = S.unfold StreamlyInternalFile.chunkReader fp - lazysamfilef <- StreamlyLByteString.fromChunksIO lazysamfile + lazysamfilef <- + StreamlyLByteString.fromChunksIO lazysamfile readSAM_V1_6_LBS lazysamfilef diff --git a/src/Data/SAM/Version1_6/Read/Error.hs b/src/Data/SAM/Version1_6/Read/Error.hs --- a/src/Data/SAM/Version1_6/Read/Error.hs +++ b/src/Data/SAM/Version1_6/Read/Error.hs @@ -7,7 +7,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Error --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -232,4 +232,12 @@ | SAM_V1_6_Error_Alignment_BOPT_Value_Type_Incorrect_Format -- | BOPT value data of the alignment section not in accepted format. | SAM_V1_6_Error_Alignment_BOPT_Value_Data_Incorrect_Format + -- | Remaining bytes leftover from running a parser on optional fields. + | SAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- | Optional field is missing a type. + | SAM_V1_6_Read_Error_Alignment_OptionalFields_Missing_Type + -- | Optional field BOPT is missing a type. + | SAM_V1_6_Read_Error_Alignment_OptionalFields_BOPT_Missing_Type + -- | Optional field doesn't have a type. + | SAM_V1_6_Read_Error_Alignment_OptionalFields_Index_Missing deriving (Eq,Generic,Show,Typeable) diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs +++ /dev/null @@ -1,80 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE MultiWayIf #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE ScopedTypeVariables #-} -{-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} - --- | --- Module : Data.SAM.Version1_6.Read.Parser.Alignment.AOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Read.Parser.Alignment.AOPT ( -- * SAM_V1_6 parser - alignment section - aopt field - parse_SAM_V1_6_Alignment_AOPT - ) where - -import Data.SAM.Version1_6.Alignment.AOPT -import Data.SAM.Version1_6.Read.Error - -import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) -import Data.Attoparsec.ByteString.Lazy as DABL -import Text.Regex.PCRE.Heavy - --- | Defines a parser for the optional aopt field of alignment section of the SAM v1.6 file format. --- --- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_AOPT :: Parser SAM_V1_6_Alignment_AOPT -parse_SAM_V1_6_Alignment_AOPT = do - alignmentaoptfieldtag <- do alignmentaoptfieldtagp <- DABL.takeTill (== 58) - -- Parse AOPT tag of the alignment section. - case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Tag_Incorrect_Format - True -> -- AOPT tag is in the accepted format. - return alignmentaoptfieldtagp - _ <- word8 58 - _ <- do alignmentaoptfieldtypep <- DABL.takeTill (== 58) - -- Parse AOPT type of the alignment section. - case (alignmentaoptfieldtypep =~ [re|[A]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Type_Incorrect_Format - True -> -- AOPT type is in the accepted format. - return () - _ <- word8 58 - alignmentaoptfieldvalue <- do alignmentaoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse AOPT value of the alignment section. - case (alignmentaoptfieldvaluep =~ [re|[!-~]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Value_Incorrect_Format - True -> -- AOPT value is in the accepted format. - return alignmentaoptfieldvaluep - return SAM_V1_6_Alignment_AOPT { sam_v1_6_alignment_aopt_tag = alignmentaoptfieldtag - , sam_v1_6_alignment_aopt_value = alignmentaoptfieldvalue - } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/BOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/BOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/BOPT.hs +++ /dev/null @@ -1,173 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE MultiWayIf #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE ScopedTypeVariables #-} -{-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} - --- | --- Module : Data.SAM.Version1_6.Read.Parser.Alignment.BOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Read.Parser.Alignment.BOPT ( -- * SAM_V1_6 parser - alignment section - bopt field - parse_SAM_V1_6_Alignment_BOPT - ) where - -import Data.SAM.Version1_6.Alignment.BOPT -import Data.SAM.Version1_6.Read.Error - -import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) -import Data.Attoparsec.ByteString.Lazy as DABL -import qualified Data.ByteString as DB (head,unpack) -import qualified Data.ByteString.Char8 as DBC8 -import Data.Sequence as DSeq -import Text.Regex.PCRE.Heavy - --- | Defines a parser for the optional bopt field of alignment section of the SAM v1.6 file format. --- --- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_BOPT :: Parser SAM_V1_6_Alignment_BOPT -parse_SAM_V1_6_Alignment_BOPT = do - alignmentboptfieldtag <- do alignmentboptfieldtagp <- DABL.takeTill (== 58) - -- Parse BOPT tag of the alignment section. - case (alignmentboptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Tag_Incorrect_Format - True -> -- BOPT tag is in the accepted format. - return alignmentboptfieldtagp - _ <- word8 58 - _ <- do alignmentboptfieldtypep <- DABL.takeTill (== 58) - -- Parse BOPT type of the alignment section. - case (alignmentboptfieldtypep =~ [re|[B]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Type_Incorrect_Format - True -> -- BOPT type is in the accepted format. - return () - _ <- word8 58 - alignmentboptfieldvaluetype <- do alignmentboptfieldvaluetypep <- DABL.take 1 - -- Parse BOPT value type of the alignment section. - case (alignmentboptfieldvaluetypep =~ [re|[cCsSiIf]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Value_Type_Incorrect_Format - True -> -- BOPT value type is in the accepted format. - return alignmentboptfieldvaluetypep - _ <- word8 44 - alignmentboptfieldvaluedata <- do alignmentboptfieldvaluedatap <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse BOPT value data of the alignment section. - case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Value_Data_Incorrect_Format - True -> -- BOPT value data is in the accepted format. - return alignmentboptfieldvaluedatap - case (DBC8.unpack alignmentboptfieldvaluetype) of - "c" -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Just SAM_V1_6_Alignment_BOPT_Int8 { sam_v1_6_alignment_bopt_int8_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag - , sam_v1_6_alignment_bopt_int8_type = DB.head alignmentboptfieldvaluetype - , sam_v1_6_alignment_bopt_int8_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) - } - , sam_v1_6_alignment_bopt_word8 = Nothing - , sam_v1_6_alignment_bopt_int16 = Nothing - , sam_v1_6_alignment_bopt_word16 = Nothing - , sam_v1_6_alignment_bopt_int32 = Nothing - , sam_v1_6_alignment_bopt_word32 = Nothing - , sam_v1_6_alignment_bopt_float = Nothing - } - "C" -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing - , sam_v1_6_alignment_bopt_word8 = Just SAM_V1_6_Alignment_BOPT_Word8 { sam_v1_6_alignment_bopt_word8_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag - , sam_v1_6_alignment_bopt_word8_type = DB.head alignmentboptfieldvaluetype - , sam_v1_6_alignment_bopt_word8_value = DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata - } - , sam_v1_6_alignment_bopt_int16 = Nothing - , sam_v1_6_alignment_bopt_word16 = Nothing - , sam_v1_6_alignment_bopt_int32 = Nothing - , sam_v1_6_alignment_bopt_word32 = Nothing - , sam_v1_6_alignment_bopt_float = Nothing - } - "s" -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing - , sam_v1_6_alignment_bopt_word8 = Nothing - , sam_v1_6_alignment_bopt_int16 = Just SAM_V1_6_Alignment_BOPT_Int16 { sam_v1_6_alignment_bopt_int16_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag - , sam_v1_6_alignment_bopt_int16_type = DB.head alignmentboptfieldvaluetype - , sam_v1_6_alignment_bopt_int16_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) - } - , sam_v1_6_alignment_bopt_word16 = Nothing - , sam_v1_6_alignment_bopt_int32 = Nothing - , sam_v1_6_alignment_bopt_word32 = Nothing - , sam_v1_6_alignment_bopt_float = Nothing - } - "S" -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing - , sam_v1_6_alignment_bopt_word8 = Nothing - , sam_v1_6_alignment_bopt_int16 = Nothing - , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag - , sam_v1_6_alignment_bopt_word16_type = DB.head alignmentboptfieldvaluetype - , sam_v1_6_alignment_bopt_word16_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) - } - , sam_v1_6_alignment_bopt_int32 = Nothing - , sam_v1_6_alignment_bopt_word32 = Nothing - , sam_v1_6_alignment_bopt_float = Nothing - } - "i" -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing - , sam_v1_6_alignment_bopt_word8 = Nothing - , sam_v1_6_alignment_bopt_int16 = Nothing - , sam_v1_6_alignment_bopt_word16 = Nothing - , sam_v1_6_alignment_bopt_int32 = Just SAM_V1_6_Alignment_BOPT_Int32 { sam_v1_6_alignment_bopt_int32_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag - , sam_v1_6_alignment_bopt_int32_type = DB.head alignmentboptfieldvaluetype - , sam_v1_6_alignment_bopt_int32_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) - } - , sam_v1_6_alignment_bopt_word32 = Nothing - , sam_v1_6_alignment_bopt_float = Nothing - } - "I" -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing - , sam_v1_6_alignment_bopt_word8 = Nothing - , sam_v1_6_alignment_bopt_int16 = Nothing - , sam_v1_6_alignment_bopt_word16 = Nothing - , sam_v1_6_alignment_bopt_int32 = Nothing - , sam_v1_6_alignment_bopt_word32 = Just SAM_V1_6_Alignment_BOPT_Word32 { sam_v1_6_alignment_bopt_word32_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag - , sam_v1_6_alignment_bopt_word32_type = DB.head alignmentboptfieldvaluetype - , sam_v1_6_alignment_bopt_word32_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) - } - , sam_v1_6_alignment_bopt_float = Nothing - } - "f" -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing - , sam_v1_6_alignment_bopt_word8 = Nothing - , sam_v1_6_alignment_bopt_int16 = Nothing - , sam_v1_6_alignment_bopt_word16 = Nothing - , sam_v1_6_alignment_bopt_int32 = Nothing - , sam_v1_6_alignment_bopt_word32 = Nothing - , sam_v1_6_alignment_bopt_float = Just SAM_V1_6_Alignment_BOPT_Float { sam_v1_6_alignment_bopt_float_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag - , sam_v1_6_alignment_bopt_float_type = DB.head alignmentboptfieldvaluetype - , sam_v1_6_alignment_bopt_float_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) - } - } - _ -> return SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing - , sam_v1_6_alignment_bopt_word8 = Nothing - , sam_v1_6_alignment_bopt_int16 = Nothing - , sam_v1_6_alignment_bopt_word16 = Nothing - , sam_v1_6_alignment_bopt_int32 = Nothing - , sam_v1_6_alignment_bopt_word32 = Nothing - , sam_v1_6_alignment_bopt_float = Nothing - } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/Base.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/Base.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/Base.hs @@ -6,7 +6,6 @@ {-# LANGUAGE OverloadedLists #-} {-# LANGUAGE OverloadedStrings #-} {-# LANGUAGE MultiWayIf #-} -{-# LANGUAGE PackageImports #-} {-# LANGUAGE RecordWildCards #-} {-# LANGUAGE TypeFamilies #-} {-# Language QuasiQuotes #-} @@ -14,7 +13,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Alignment.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -45,17 +44,20 @@ import Data.SAM.Version1_6.Alignment import Data.SAM.Version1_6.Read.Error -import Data.SAM.Version1_6.Read.Parser.Alignment.AOPT -import Data.SAM.Version1_6.Read.Parser.Alignment.IOPT -import Data.SAM.Version1_6.Read.Parser.Alignment.FOPT -import Data.SAM.Version1_6.Read.Parser.Alignment.ZOPT -import Data.SAM.Version1_6.Read.Parser.Alignment.HOPT -import Data.SAM.Version1_6.Read.Parser.Alignment.BOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.Base +import Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.AOPT +import Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.IOPT +import Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.FOPT +import Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.ZOPT +import Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.HOPT +import Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.BOPT -import Control.Applicative.Permutations (intercalateEffect,toPermutationWithDefault) import Data.Attoparsec.ByteString.Char8 as DABC8 (endOfLine,isEndOfLine) import Data.Attoparsec.ByteString.Lazy as DABL +import qualified Data.ByteString as DB import qualified Data.ByteString.Char8 as DBC8 +import Data.List as DL (intercalate) +import Data.Sequence as DSeq (empty,Seq(..)) import Text.Regex.PCRE.Heavy -- | @"SAM_V1_6_Alignment"@ parser. @@ -65,159 +67,486 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Alignment :: Parser SAM_V1_6_Alignment parse_SAM_V1_6_Alignment = do - qname <- do qnamep <- DABL.takeTill (== 09) - -- Parse QNAME field of alignment section. - case (qnamep =~ [re|[!-?A-~]{1,254}|\*|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_QNAME_Incorrect_Format - True -> -- QNAME is in the accepted format. - return qnamep - _ <- word8 09 - flag <- do flagp <- DABL.takeTill (== 09) - -- Parse FLAG field of alignment section. - case (flagp =~ [re|[0-9]+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_FLAG_Incorrect_Format - True -> -- FLAG is in the accepted format. - return flagp - _ <- word8 09 - rname <- do rnamep <- DABL.takeTill (== 09) - -- Parse RNAME field of alignment section. - case (rnamep =~ [re|\*|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_RNAME_Incorrect_Format - True -> -- RNAME is in the accepted format. - return rnamep - _ <- word8 09 - pos <- do posp <- DABL.takeTill (== 09) - -- Parse POS field of the alignment section. - case (posp =~ [re|[0-9]+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_POS_Incorrect_Format - True -> -- POS is in the accepted format. - return posp - _ <- word8 09 - mapq <- do mapqp <- DABL.takeTill (== 09) - -- Parse MAPQ field of the alignment section. - case (mapqp =~ [re|[0-9]+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_MAPQ_Incorrect_Format - True -> -- MAPQ is in the accepted format. - return mapqp - _ <- word8 09 - cigar <- do cigarp <- DABL.takeTill (== 09) - -- Parse CIGAR field of alignment section. - case (cigarp =~ [re|\*|([0-9]+[MIDNSHPX=])+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_CIGAR_Incorrect_Format - True -> -- CIGAR is in the accepted format. - return cigarp - _ <- word8 09 - rnext <- do rnextp <- DABL.takeTill (== 09) - -- Parse RNEXT field of the alignment section. - case (rnextp =~ [re|\*|=|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_RNEXT_Incorrect_Format - True -> -- RNEXT is in the accepted format. - return rnextp - _ <- word8 09 - pnext <- do pnextp <- DABL.takeTill (== 09) - -- Parse PNEXT field of the alignment section. - case (pnextp =~ [re|[0-9]+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_PNEXT_Incorrect_Format - True -> -- PNEXT is in the accepted format. - return pnextp - _ <- word8 09 - tlen <- do tlenp <- DABL.takeTill (== 09) - -- Parse TLEN field of the alignment section. - case (tlenp =~ [re|[-]?[0-9]+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_TLEN_Incorrect_Format - True -> -- TLEN is in the accepted format. - return tlenp - _ <- word8 09 - seq <- do seqp <- DABL.takeTill (== 09) - -- Parse SEQ field of the alignment section. - case (seqp =~ [re|\*|[A-Za-z=.]+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_SEQ_Incorrect_Format - True -> -- SEQ is in the accepted format. - return seqp - _ <- word8 09 - qual <- do qualp <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse QUAL field of the alignment section. - case (qualp =~ [re|[!-~?]+|\*|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_QUAL_Incorrect_Format - True -> -- QUAL is in the accepted format. - return qualp - optfields <- peekWord8 + qname <- do + qnamep <- + DABL.takeTill (== 09) + -- Parse QNAME field of alignment section. + case (qnamep =~ [re|[!-?A-~]{1,254}|\*|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_QNAME_Incorrect_Format + True -> + -- QNAME is in the accepted format. + return qnamep + _ <- + word8 09 + flag <- do + flagp <- + DABL.takeTill (== 09) + -- Parse FLAG field of alignment section. + case (flagp =~ [re|[0-9]+|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_FLAG_Incorrect_Format + True -> + -- FLAG is in the accepted format. + return flagp + _ <- + word8 09 + rname <- do + rnamep <- + DABL.takeTill (== 09) + -- Parse RNAME field of alignment section. + case (rnamep =~ [re|\*|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_RNAME_Incorrect_Format + True -> + -- RNAME is in the accepted format. + return rnamep + _ <- + word8 09 + pos <- do + posp <- + DABL.takeTill (== 09) + -- Parse POS field of the alignment section. + case (posp =~ [re|[0-9]+|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_POS_Incorrect_Format + True -> + -- POS is in the accepted format. + return posp + _ <- + word8 09 + mapq <- do + mapqp <- + DABL.takeTill (== 09) + -- Parse MAPQ field of the alignment section. + case (mapqp =~ [re|[0-9]+|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_MAPQ_Incorrect_Format + True -> + -- MAPQ is in the accepted format. + return mapqp + _ <- + word8 09 + cigar <- do + cigarp <- + DABL.takeTill (== 09) + -- Parse CIGAR field of alignment section. + case (cigarp =~ [re|\*|([0-9]+[MIDNSHPX=])+|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_CIGAR_Incorrect_Format + True -> + -- CIGAR is in the accepted format. + return cigarp + _ <- + word8 09 + rnext <- do + rnextp <- + DABL.takeTill (== 09) + -- Parse RNEXT field of the alignment section. + case (rnextp =~ [re|\*|=|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_RNEXT_Incorrect_Format + True -> + -- RNEXT is in the accepted format. + return rnextp + _ <- + word8 09 + pnext <- do + pnextp <- + DABL.takeTill (== 09) + -- Parse PNEXT field of the alignment section. + case (pnextp =~ [re|[0-9]+|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_PNEXT_Incorrect_Format + True -> + -- PNEXT is in the accepted format. + return pnextp + _ <- + word8 09 + tlen <- do + tlenp <- + DABL.takeTill (== 09) + -- Parse TLEN field of the alignment section. + case (tlenp =~ [re|[-]?[0-9]+|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_TLEN_Incorrect_Format + True -> + -- TLEN is in the accepted format. + return tlenp + _ <- + word8 09 + seq <- do + seqp <- + DABL.takeTill (== 09) + -- Parse SEQ field of the alignment section. + case (seqp =~ [re|\*|[A-Za-z=.]+|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_SEQ_Incorrect_Format + True -> + -- SEQ is in the accepted format. + return seqp + _ <- + word8 09 + qual <- do + qualp <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse QUAL field of the alignment section. + case (qualp =~ [re|[!-~?]+|\*|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_QUAL_Incorrect_Format + True -> + -- QUAL is in the accepted format. + return qualp + optfields <- + peekWord8 case optfields of - Just 10 -> do -- Return the parsed SAM_V1_6. - _ <- endOfLine - return SAM_V1_6_Alignment { sam_v1_6_alignment_qname = qname - , sam_v1_6_alignment_flag = case (DBC8.readInt flag) of - Nothing -> (-1) - Just (flagint,_) -> flagint - , sam_v1_6_alignment_rname = rname - , sam_v1_6_alignment_pos = case (DBC8.readInteger pos) of - Nothing -> 0 - Just (posinteger,_) -> posinteger - , sam_v1_6_alignment_mapq = case (DBC8.readInt mapq) of - Nothing -> 255 - Just (mapqint,_) -> mapqint - , sam_v1_6_alignment_cigar = cigar - , sam_v1_6_alignment_rnext = rnext - , sam_v1_6_alignment_pnext = case (DBC8.readInteger pnext) of - Nothing -> 0 - Just (pnextinteger,_) -> pnextinteger - , sam_v1_6_alignment_tlen = case (DBC8.readInteger tlen) of - Nothing -> 0 - Just (tleninteger,_) -> tleninteger - , sam_v1_6_alignment_seq = seq - , sam_v1_6_alignment_qual = qual - , sam_v1_6_alignment_aopt = Nothing - , sam_v1_6_alignment_iopt = Nothing - , sam_v1_6_alignment_fopt = Nothing - , sam_v1_6_alignment_zopt = Nothing - , sam_v1_6_alignment_hopt = Nothing - , sam_v1_6_alignment_bopt = Nothing - } - _ -> do -- This parser assumes that - -- the AOPT, IOPT, FOPT, ZOPT, HOPT, and BOPT - -- tags can appear in any order. - _ <- word8 09 - optionalfields <- intercalateEffect (word8 09) $ - (,,,,,) - <$> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Alignment_AOPT) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Alignment_IOPT) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Alignment_FOPT) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Alignment_ZOPT) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Alignment_HOPT) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Alignment_BOPT) - _ <- endOfLine - -- Return the parsed SAM_V1_6. - return SAM_V1_6_Alignment { sam_v1_6_alignment_qname = qname - , sam_v1_6_alignment_flag = case (DBC8.readInt flag) of - Nothing -> (-1) - Just (flagint,_) -> flagint - , sam_v1_6_alignment_rname = rname - , sam_v1_6_alignment_pos = case (DBC8.readInteger pos) of - Nothing -> 0 - Just (posinteger,_) -> posinteger - , sam_v1_6_alignment_mapq = case (DBC8.readInt mapq) of - Nothing -> 255 - Just (mapqint,_) -> mapqint - , sam_v1_6_alignment_cigar = cigar - , sam_v1_6_alignment_rnext = rnext - , sam_v1_6_alignment_pnext = case (DBC8.readInteger pnext) of - Nothing -> 0 - Just (pnextinteger,_) -> pnextinteger - , sam_v1_6_alignment_tlen = case (DBC8.readInteger tlen) of - Nothing -> 0 - Just (tleninteger,_) -> tleninteger - , sam_v1_6_alignment_seq = seq - , sam_v1_6_alignment_qual = qual - , sam_v1_6_alignment_aopt = (\(a,_,_,_,_,_) -> a) optionalfields - , sam_v1_6_alignment_iopt = (\(_,i,_,_,_,_) -> i) optionalfields - , sam_v1_6_alignment_fopt = (\(_,_,f,_,_,_) -> f) optionalfields - , sam_v1_6_alignment_zopt = (\(_,_,_,z,_,_) -> z) optionalfields - , sam_v1_6_alignment_hopt = (\(_,_,_,_,h,_) -> h) optionalfields - , sam_v1_6_alignment_bopt = (\(_,_,_,_,_,b) -> b) optionalfields - } + Just 10 -> do + -- Return the parsed SAM_V1_6. + _ <- + endOfLine + return SAM_V1_6_Alignment { sam_v1_6_alignment_qname = qname + , sam_v1_6_alignment_flag = case (DBC8.readInt flag) of + Nothing -> + (-1) + Just (flagint,_) -> + flagint + , sam_v1_6_alignment_rname = rname + , sam_v1_6_alignment_pos = case (DBC8.readInteger pos) of + Nothing -> + 0 + Just (posinteger,_) -> + posinteger + , sam_v1_6_alignment_mapq = case (DBC8.readInt mapq) of + Nothing -> + 255 + Just (mapqint,_) -> + mapqint + , sam_v1_6_alignment_cigar = cigar + , sam_v1_6_alignment_rnext = rnext + , sam_v1_6_alignment_pnext = case (DBC8.readInteger pnext) of + Nothing -> + 0 + Just (pnextinteger,_) -> + pnextinteger + , sam_v1_6_alignment_tlen = case (DBC8.readInteger tlen) of + Nothing -> + 0 + Just (tleninteger,_) -> + tleninteger + , sam_v1_6_alignment_seq = seq + , sam_v1_6_alignment_qual = qual + , sam_v1_6_alignment_optionalfields = Nothing + } + _ -> do + -- This parser assumes that + -- the AOPT, IOPT, FOPT, ZOPT, HOPT, and BOPT + -- tags can appear in any order. + _ <- + word8 09 + optionalfieldsbytes <- + DABL.takeTill isEndOfLine + optionalfields <- + return $ + parse_OptionalFields optionalfieldsbytes + _ <- + endOfLine + -- Return the parsed SAM_V1_6. + return SAM_V1_6_Alignment { sam_v1_6_alignment_qname = qname + , sam_v1_6_alignment_flag = case (DBC8.readInt flag) of + Nothing -> + (-1) + Just (flagint,_) -> + flagint + , sam_v1_6_alignment_rname = rname + , sam_v1_6_alignment_pos = case (DBC8.readInteger pos) of + Nothing -> + 0 + Just (posinteger,_) -> + posinteger + , sam_v1_6_alignment_mapq = case (DBC8.readInt mapq) of + Nothing -> + 255 + Just (mapqint,_) -> + mapqint + , sam_v1_6_alignment_cigar = cigar + , sam_v1_6_alignment_rnext = rnext + , sam_v1_6_alignment_pnext = case (DBC8.readInteger pnext) of + Nothing -> + 0 + Just (pnextinteger,_) -> + pnextinteger + , sam_v1_6_alignment_tlen = case (DBC8.readInteger tlen) of + Nothing -> + 0 + Just (tleninteger,_) -> + tleninteger + , sam_v1_6_alignment_seq = seq + , sam_v1_6_alignment_qual = qual + , sam_v1_6_alignment_optionalfields = Just optionalfields + } + where + parse_OptionalFields :: DB.ByteString + -> Seq SAM_V1_6_Alignment_OptionalFields + parse_OptionalFields bs = do + case DB.null bs of + True -> + DSeq.empty + False -> + case DB.indexMaybe bs 3 of + Nothing -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_Index_Missing + -- AOPT <-> 'A' + Just 0x41 -> + case ( DABL.parse parse_SAM_V1_6_Alignment_OptionalFields_AOPT + ( DB.fromStrict $ + DB.takeWhile (/= 0x09) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing AOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + SAM_V1_6_Alignment_OptionalFields + { sam_v1_6_alignment_optionalfields_aopt = Just parsedbs + , sam_v1_6_alignment_optionalfields_iopt = Nothing + , sam_v1_6_alignment_optionalfields_fopt = Nothing + , sam_v1_6_alignment_optionalfields_zopt = Nothing + , sam_v1_6_alignment_optionalfields_hopt = Nothing + , sam_v1_6_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 1 $ + DB.dropWhile (/= 0x09) + bs + ) + False -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- IOPT <-> 'i' + Just 0x69 -> + case ( DABL.parse parse_SAM_V1_6_Alignment_OptionalFields_IOPT + ( DB.fromStrict $ + DB.takeWhile (/= 0x09) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing IOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + SAM_V1_6_Alignment_OptionalFields + { sam_v1_6_alignment_optionalfields_aopt = Nothing + , sam_v1_6_alignment_optionalfields_iopt = Just parsedbs + , sam_v1_6_alignment_optionalfields_fopt = Nothing + , sam_v1_6_alignment_optionalfields_zopt = Nothing + , sam_v1_6_alignment_optionalfields_hopt = Nothing + , sam_v1_6_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 1 $ + DB.dropWhile (/= 0x09) + bs + ) + False -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- FOPT <-> 'f' + Just 0x66 -> + case ( DABL.parse parse_SAM_V1_6_Alignment_OptionalFields_FOPT + ( DB.fromStrict $ + DB.takeWhile (/= 0x09) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing FOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + SAM_V1_6_Alignment_OptionalFields + { sam_v1_6_alignment_optionalfields_aopt = Nothing + , sam_v1_6_alignment_optionalfields_iopt = Nothing + , sam_v1_6_alignment_optionalfields_fopt = Just parsedbs + , sam_v1_6_alignment_optionalfields_zopt = Nothing + , sam_v1_6_alignment_optionalfields_hopt = Nothing + , sam_v1_6_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 1 $ + DB.dropWhile (/= 0x09) + bs + ) + False -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- ZOPT <-> 'Z' + Just 0x5A -> + case ( DABL.parse parse_SAM_V1_6_Alignment_OptionalFields_ZOPT + ( DB.fromStrict $ + DB.takeWhile (/= 0x09) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing ZOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + SAM_V1_6_Alignment_OptionalFields + { sam_v1_6_alignment_optionalfields_aopt = Nothing + , sam_v1_6_alignment_optionalfields_iopt = Nothing + , sam_v1_6_alignment_optionalfields_fopt = Nothing + , sam_v1_6_alignment_optionalfields_zopt = Just parsedbs + , sam_v1_6_alignment_optionalfields_hopt = Nothing + , sam_v1_6_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 1 $ + DB.dropWhile (/= 0x09) + bs + ) + False -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- HOPT <-> 'H' + Just 0x48 -> + case ( DABL.parse parse_SAM_V1_6_Alignment_OptionalFields_HOPT + ( DB.fromStrict $ + DB.takeWhile (/= 0x09) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing HOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + SAM_V1_6_Alignment_OptionalFields + { sam_v1_6_alignment_optionalfields_aopt = Nothing + , sam_v1_6_alignment_optionalfields_iopt = Nothing + , sam_v1_6_alignment_optionalfields_fopt = Nothing + , sam_v1_6_alignment_optionalfields_zopt = Nothing + , sam_v1_6_alignment_optionalfields_hopt = Just parsedbs + , sam_v1_6_alignment_optionalfields_bopt = Nothing + } + DSeq.:<| + parse_OptionalFields ( DB.drop 1 $ + DB.dropWhile (/= 0x09) + bs + ) + False -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + -- BOPT <-> 'B' + Just 0x42 -> + case ( DABL.parse parse_SAM_V1_6_Alignment_OptionalFields_BOPT + ( DB.fromStrict $ + DB.takeWhile (/= 0x09) + bs + ) + ) of + Fail _ + ctxs + err -> + error $ + show $ "Error while parsing BOPT field." ++ + "\n" ++ + "Parsing contexts: " ++ + (intercalate ", " ctxs) ++ + "\n" ++ + "Error message: " ++ + err + Done remainingbytes + parsedbs -> do + let strictremainingbytes = DB.toStrict remainingbytes + case DB.null strictremainingbytes of + True -> + SAM_V1_6_Alignment_OptionalFields + { sam_v1_6_alignment_optionalfields_aopt = Nothing + , sam_v1_6_alignment_optionalfields_iopt = Nothing + , sam_v1_6_alignment_optionalfields_fopt = Nothing + , sam_v1_6_alignment_optionalfields_zopt = Nothing + , sam_v1_6_alignment_optionalfields_hopt = Nothing + , sam_v1_6_alignment_optionalfields_bopt = Just parsedbs + } + DSeq.:<| + parse_OptionalFields ( DB.drop 1 $ + DB.dropWhile (/= 0x09) + bs + ) + False -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_Remaining_Bytes + _ -> + error $ + show SAM_V1_6_Read_Error_Alignment_OptionalFields_BOPT_Missing_Type diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs +++ /dev/null @@ -1,83 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE MultiWayIf #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE ScopedTypeVariables #-} -{-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} - --- | --- Module : Data.SAM.Version1_6.Read.Parser.Alignment.FOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Read.Parser.Alignment.FOPT ( -- * SAM_V1_6 parser - alignment section - fopt field - parse_SAM_V1_6_Alignment_FOPT - ) where - -import Data.SAM.Version1_6.Alignment.FOPT -import Data.SAM.Version1_6.Read.Error - -import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) -import Data.Attoparsec.ByteString.Lazy as DABL -import qualified Data.ByteString.Char8 as DBC8 -import Text.Regex.PCRE.Heavy - --- | Defines a parser for the optional fopt field of alignment section of the SAM v1.6 file format. --- --- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_FOPT :: Parser SAM_V1_6_Alignment_FOPT -parse_SAM_V1_6_Alignment_FOPT = do - alignmentfoptfieldtag <- do alignmentfoptfieldtagp <- DABL.takeTill (== 58) - -- Parse FOPT tag of the alignment section. - case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Tag_Incorrect_Format - True -> -- FOPT tag is in the accepted format. - return alignmentfoptfieldtagp - _ <- word8 58 - _ <- do alignmentfoptfieldtypep <- DABL.takeTill (== 58) - -- Parse FOPT type of the alignment section. - case (alignmentfoptfieldtypep =~ [re|[f]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Type_Incorrect_Format - True -> -- FOPT type is in the accepted format. - return () - _ <- word8 58 - alignmentfoptfieldvalue <- do alignmentfoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse FOPT value of the alignment section. - case (alignmentfoptfieldvaluep =~ [re|[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Value_Incorrect_Format - True -> -- FOPT value is in the accepted format. - case (DBC8.readInteger alignmentfoptfieldvaluep) of - Nothing -> return (-1) - Just (alignmentfoptfieldvalueinteger,_) -> return $ (fromInteger alignmentfoptfieldvalueinteger :: Float) - return SAM_V1_6_Alignment_FOPT { sam_v1_6_alignment_fopt_tag = alignmentfoptfieldtag - , sam_v1_6_alignment_fopt_value = alignmentfoptfieldvalue - } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs +++ /dev/null @@ -1,80 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE MultiWayIf #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE ScopedTypeVariables #-} -{-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} - --- | --- Module : Data.SAM.Version1_6.Read.Parser.Alignment.HOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Read.Parser.Alignment.HOPT ( -- * SAM_V1_6 parser - alignment section - hopt field - parse_SAM_V1_6_Alignment_HOPT - ) where - -import Data.SAM.Version1_6.Alignment.HOPT -import Data.SAM.Version1_6.Read.Error - -import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) -import Data.Attoparsec.ByteString.Lazy as DABL -import Text.Regex.PCRE.Heavy - --- | Defines a parser for the optional hopt field of alignment section of the SAM v1.6 file format. --- --- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_HOPT :: Parser SAM_V1_6_Alignment_HOPT -parse_SAM_V1_6_Alignment_HOPT = do - alignmenthoptfieldtag <- do alignmenthoptfieldtagp <- DABL.takeTill (== 58) - -- Parse HOPT tag of the alignment section. - case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Tag_Incorrect_Format - True -> -- HOPT tag is in the accepted format. - return alignmenthoptfieldtagp - _ <- word8 58 - _ <- do alignmenthoptfieldtypep <- DABL.takeTill (== 58) - -- Parse HOPT type of the alignment section. - case (alignmenthoptfieldtypep =~ [re|[H]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Type_Incorrect_Format - True -> -- HOPT type is in the accepted format. - return () - _ <- word8 58 - alignmenthoptfieldvalue <- do alignmenthoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse HOPT value of the alignment section. - case (alignmenthoptfieldvaluep =~ [re|([0-9A-F][0-9A-F])*|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Value_Incorrect_Format - True -> -- HOPT value is in the accepted format. - return alignmenthoptfieldvaluep - return SAM_V1_6_Alignment_HOPT { sam_v1_6_alignment_hopt_tag = alignmenthoptfieldtag - , sam_v1_6_alignment_hopt_value = alignmenthoptfieldvalue - } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs +++ /dev/null @@ -1,83 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE MultiWayIf #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE ScopedTypeVariables #-} -{-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} - --- | --- Module : Data.SAM.Version1_6.Read.Parser.Alignment.IOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Read.Parser.Alignment.IOPT ( -- * SAM_V1_6 parser - alignment section - iopt field - parse_SAM_V1_6_Alignment_IOPT - ) where - -import Data.SAM.Version1_6.Alignment.IOPT -import Data.SAM.Version1_6.Read.Error - -import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) -import Data.Attoparsec.ByteString.Lazy as DABL -import qualified Data.ByteString.Char8 as DBC8 -import Text.Regex.PCRE.Heavy - --- | Defines a parser for the optional iopt field of alignment section of the SAM v1.6 file format. --- --- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_IOPT :: Parser SAM_V1_6_Alignment_IOPT -parse_SAM_V1_6_Alignment_IOPT = do - alignmentioptfieldtag <- do alignmentioptfieldtagp <- DABL.takeTill (== 58) - -- Parse IOPT tag of the alignment section. - case (alignmentioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Tag_Incorrect_Format - True -> -- IOPT tag is in the accepted format. - return alignmentioptfieldtagp - _ <- word8 58 - _ <- do alignmentioptfieldtypep <- DABL.takeTill (== 58) - -- Parse IOPT type of the alignment section. - case (alignmentioptfieldtypep =~ [re|[i]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Type_Incorrect_Format - True -> -- IOPT type is in the accepted format. - return () - _ <- word8 58 - alignmentioptfieldvalue <- do alignmentioptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse IOPT value of the alignment section. - case (alignmentioptfieldvaluep =~ [re|[-+]?[0-9]+|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Value_Incorrect_Format - True -> -- IOPT value is in the accepted format. - case (DBC8.readInteger alignmentioptfieldvaluep) of - Nothing -> return (-1) - Just (alignmentioptfieldvalueinteger,_) -> return alignmentioptfieldvalueinteger - return SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag = alignmentioptfieldtag - , sam_v1_6_alignment_iopt_value = alignmentioptfieldvalue - } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/AOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/AOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/AOPT.hs @@ -0,0 +1,94 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.AOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.AOPT ( -- * SAM_V1_6 parser - alignment section - aopt field + parse_SAM_V1_6_Alignment_OptionalFields_AOPT + ) where + +import Data.SAM.Version1_6.Alignment.OptionalFields.AOPT +import Data.SAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional aopt field of alignment section of the SAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_SAM_V1_6_Alignment_OptionalFields_AOPT :: Parser SAM_V1_6_Alignment_OptionalFields_AOPT +parse_SAM_V1_6_Alignment_OptionalFields_AOPT = do + alignmentaoptfieldtag <- do + alignmentaoptfieldtagp <- + DABL.takeTill (== 58) + -- Parse AOPT tag of the alignment section. + case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_AOPT_Tag_Incorrect_Format + True -> + -- AOPT tag is in the accepted format. + return alignmentaoptfieldtagp + _ <- + word8 58 + _ <- do + alignmentaoptfieldtypep <- + DABL.takeTill (== 58) + -- Parse AOPT type of the alignment section. + case (alignmentaoptfieldtypep =~ [re|[A]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_AOPT_Type_Incorrect_Format + True -> + -- AOPT type is in the accepted format. + return () + _ <- + word8 58 + alignmentaoptfieldvalue <- do + alignmentaoptfieldvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse AOPT value of the alignment section. + case (alignmentaoptfieldvaluep =~ [re|[!-~]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_AOPT_Value_Incorrect_Format + True -> + -- AOPT value is in the accepted format. + return alignmentaoptfieldvaluep + return SAM_V1_6_Alignment_OptionalFields_AOPT + { sam_v1_6_alignment_optionalfields_aopt_tag = alignmentaoptfieldtag + , sam_v1_6_alignment_optionalfields_aopt_value = alignmentaoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/BOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/BOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/BOPT.hs @@ -0,0 +1,216 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.BOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.BOPT ( -- * SAM_V1_6 parser - alignment section - bopt field + parse_SAM_V1_6_Alignment_OptionalFields_BOPT + ) where + +import Data.SAM.Version1_6.Alignment.OptionalFields.BOPT +import Data.SAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) +import Data.Attoparsec.ByteString.Lazy as DABL +import qualified Data.ByteString as DB (head,unpack) +import qualified Data.ByteString.Char8 as DBC8 +import Data.Sequence as DSeq +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional bopt field of alignment section of the SAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_SAM_V1_6_Alignment_OptionalFields_BOPT :: Parser SAM_V1_6_Alignment_OptionalFields_BOPT +parse_SAM_V1_6_Alignment_OptionalFields_BOPT = do + alignmentboptfieldtag <- do + alignmentboptfieldtagp <- + DABL.takeTill (== 58) + -- Parse BOPT tag of the alignment section. + case (alignmentboptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_BOPT_Tag_Incorrect_Format + True -> + -- BOPT tag is in the accepted format. + return alignmentboptfieldtagp + _ <- + word8 58 + _ <- do + alignmentboptfieldtypep <- + DABL.takeTill (== 58) + -- Parse BOPT type of the alignment section. + case (alignmentboptfieldtypep =~ [re|[B]|]) of + False -> + fail $ + show SAM_V1_6_Error_Alignment_BOPT_Type_Incorrect_Format + True -> + -- BOPT type is in the accepted format. + return () + _ <- + word8 58 + alignmentboptfieldvaluetype <- do + alignmentboptfieldvaluetypep <- + DABL.take 1 + -- Parse BOPT value type of the alignment section. + case (alignmentboptfieldvaluetypep =~ [re|[cCsSiIf]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_BOPT_Value_Type_Incorrect_Format + True -> + -- BOPT value type is in the accepted format. + return alignmentboptfieldvaluetypep + _ <- + word8 44 + alignmentboptfieldvaluedata <- do + alignmentboptfieldvaluedatap <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse BOPT value data of the alignment section. + case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_BOPT_Value_Data_Incorrect_Format + True -> + -- BOPT value data is in the accepted format. + return alignmentboptfieldvaluedatap + case (DBC8.unpack alignmentboptfieldvaluetype) of + "c" -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Just SAM_V1_6_Alignment_OptionalFields_BOPT_Int8 + { sam_v1_6_alignment_optionalfields_bopt_int8_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag + , sam_v1_6_alignment_optionalfields_bopt_int8_type = DB.head alignmentboptfieldvaluetype + , sam_v1_6_alignment_optionalfields_bopt_int8_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) + } + , sam_v1_6_alignment_optionalfields_bopt_word8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_float = Nothing + } + "C" -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word8 = Just SAM_V1_6_Alignment_OptionalFields_BOPT_Word8 + { sam_v1_6_alignment_optionalfields_bopt_word8_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag + , sam_v1_6_alignment_optionalfields_bopt_word8_type = DB.head alignmentboptfieldvaluetype + , sam_v1_6_alignment_optionalfields_bopt_word8_value = DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata + } + , sam_v1_6_alignment_optionalfields_bopt_int16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_float = Nothing + } + "s" -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int16 = Just SAM_V1_6_Alignment_OptionalFields_BOPT_Int16 + { sam_v1_6_alignment_optionalfields_bopt_int16_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag + , sam_v1_6_alignment_optionalfields_bopt_int16_type = DB.head alignmentboptfieldvaluetype + , sam_v1_6_alignment_optionalfields_bopt_int16_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) + } + , sam_v1_6_alignment_optionalfields_bopt_word16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_float = Nothing + } + "S" -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word16 = Just SAM_V1_6_Alignment_OptionalFields_BOPT_Word16 + { sam_v1_6_alignment_optionalfields_bopt_word16_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag + , sam_v1_6_alignment_optionalfields_bopt_word16_type = DB.head alignmentboptfieldvaluetype + , sam_v1_6_alignment_optionalfields_bopt_word16_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) + } + , sam_v1_6_alignment_optionalfields_bopt_int32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_float = Nothing + } + "i" -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int32 = Just SAM_V1_6_Alignment_OptionalFields_BOPT_Int32 + { sam_v1_6_alignment_optionalfields_bopt_int32_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag + , sam_v1_6_alignment_optionalfields_bopt_int32_type = DB.head alignmentboptfieldvaluetype + , sam_v1_6_alignment_optionalfields_bopt_int32_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) + } + , sam_v1_6_alignment_optionalfields_bopt_word32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_float = Nothing + } + "I" -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word32 = Just SAM_V1_6_Alignment_OptionalFields_BOPT_Word32 + { sam_v1_6_alignment_optionalfields_bopt_word32_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag + , sam_v1_6_alignment_optionalfields_bopt_word32_type = DB.head alignmentboptfieldvaluetype + , sam_v1_6_alignment_optionalfields_bopt_word32_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) + } + , sam_v1_6_alignment_optionalfields_bopt_float = Nothing + } + "f" -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_float = Just SAM_V1_6_Alignment_OptionalFields_BOPT_Float + { sam_v1_6_alignment_optionalfields_bopt_float_tag = DSeq.fromList $ DB.unpack alignmentboptfieldtag + , sam_v1_6_alignment_optionalfields_bopt_float_type = DB.head alignmentboptfieldvaluetype + , sam_v1_6_alignment_optionalfields_bopt_float_value = fmap fromIntegral (DSeq.fromList $ DB.unpack alignmentboptfieldvaluedata) + } + } + _ -> + return SAM_V1_6_Alignment_OptionalFields_BOPT + { sam_v1_6_alignment_optionalfields_bopt_int8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word8 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word16 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_int32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_word32 = Nothing + , sam_v1_6_alignment_optionalfields_bopt_float = Nothing + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/FOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/FOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/FOPT.hs @@ -0,0 +1,97 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.FOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.FOPT ( -- * SAM_V1_6 parser - alignment section - fopt field + parse_SAM_V1_6_Alignment_OptionalFields_FOPT + ) where + +import Data.SAM.Version1_6.Alignment.OptionalFields.FOPT +import Data.SAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) +import Data.Attoparsec.ByteString.Lazy as DABL +import qualified Data.ByteString.Char8 as DBC8 +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional fopt field of alignment section of the SAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_SAM_V1_6_Alignment_OptionalFields_FOPT :: Parser SAM_V1_6_Alignment_OptionalFields_FOPT +parse_SAM_V1_6_Alignment_OptionalFields_FOPT = do + alignmentfoptfieldtag <- do + alignmentfoptfieldtagp <- + DABL.takeTill (== 58) + -- Parse FOPT tag of the alignment section. + case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_FOPT_Tag_Incorrect_Format + True -> + -- FOPT tag is in the accepted format. + return alignmentfoptfieldtagp + _ <- + word8 58 + _ <- do + alignmentfoptfieldtypep <- + DABL.takeTill (== 58) + -- Parse FOPT type of the alignment section. + case (alignmentfoptfieldtypep =~ [re|[f]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_FOPT_Type_Incorrect_Format + True -> + -- FOPT type is in the accepted format. + return () + _ <- + word8 58 + alignmentfoptfieldvalue <- do + alignmentfoptfieldvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse FOPT value of the alignment section. + case (alignmentfoptfieldvaluep =~ [re|[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_FOPT_Value_Incorrect_Format + True -> + -- FOPT value is in the accepted format. + case (DBC8.readInteger alignmentfoptfieldvaluep) of + Nothing -> return (-1) + Just (alignmentfoptfieldvalueinteger,_) -> return $ (fromInteger alignmentfoptfieldvalueinteger :: Float) + return SAM_V1_6_Alignment_OptionalFields_FOPT + { sam_v1_6_alignment_optionalfields_fopt_tag = alignmentfoptfieldtag + , sam_v1_6_alignment_optionalfields_fopt_value = alignmentfoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/HOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/HOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/HOPT.hs @@ -0,0 +1,94 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.HOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.HOPT ( -- * SAM_V1_6 parser - alignment section - hopt field + parse_SAM_V1_6_Alignment_OptionalFields_HOPT + ) where + +import Data.SAM.Version1_6.Alignment.OptionalFields.HOPT +import Data.SAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional hopt field of alignment section of the SAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_SAM_V1_6_Alignment_OptionalFields_HOPT :: Parser SAM_V1_6_Alignment_OptionalFields_HOPT +parse_SAM_V1_6_Alignment_OptionalFields_HOPT = do + alignmenthoptfieldtag <- do + alignmenthoptfieldtagp <- + DABL.takeTill (== 58) + -- Parse HOPT tag of the alignment section. + case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_HOPT_Tag_Incorrect_Format + True -> + -- HOPT tag is in the accepted format. + return alignmenthoptfieldtagp + _ <- + word8 58 + _ <- do + alignmenthoptfieldtypep <- + DABL.takeTill (== 58) + -- Parse HOPT type of the alignment section. + case (alignmenthoptfieldtypep =~ [re|[H]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_HOPT_Type_Incorrect_Format + True -> + -- HOPT type is in the accepted format. + return () + _ <- + word8 58 + alignmenthoptfieldvalue <- do + alignmenthoptfieldvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse HOPT value of the alignment section. + case (alignmenthoptfieldvaluep =~ [re|([0-9A-F][0-9A-F])*|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_HOPT_Value_Incorrect_Format + True -> + -- HOPT value is in the accepted format. + return alignmenthoptfieldvaluep + return SAM_V1_6_Alignment_OptionalFields_HOPT + { sam_v1_6_alignment_optionalfields_hopt_tag = alignmenthoptfieldtag + , sam_v1_6_alignment_optionalfields_hopt_value = alignmenthoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/IOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/IOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/IOPT.hs @@ -0,0 +1,97 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.IOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.IOPT ( -- * SAM_V1_6 parser - alignment section - iopt field + parse_SAM_V1_6_Alignment_OptionalFields_IOPT + ) where + +import Data.SAM.Version1_6.Alignment.OptionalFields.IOPT +import Data.SAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) +import Data.Attoparsec.ByteString.Lazy as DABL +import qualified Data.ByteString.Char8 as DBC8 +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional iopt field of alignment section of the SAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_SAM_V1_6_Alignment_OptionalFields_IOPT :: Parser SAM_V1_6_Alignment_OptionalFields_IOPT +parse_SAM_V1_6_Alignment_OptionalFields_IOPT = do + alignmentioptfieldtag <- do + alignmentioptfieldtagp <- + DABL.takeTill (== 58) + -- Parse IOPT tag of the alignment section. + case (alignmentioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_IOPT_Tag_Incorrect_Format + True -> + -- IOPT tag is in the accepted format. + return alignmentioptfieldtagp + _ <- + word8 58 + _ <- do + alignmentioptfieldtypep <- + DABL.takeTill (== 58) + -- Parse IOPT type of the alignment section. + case (alignmentioptfieldtypep =~ [re|[i]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_IOPT_Type_Incorrect_Format + True -> + -- IOPT type is in the accepted format. + return () + _ <- + word8 58 + alignmentioptfieldvalue <- do + alignmentioptfieldvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse IOPT value of the alignment section. + case (alignmentioptfieldvaluep =~ [re|[-+]?[0-9]+|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_IOPT_Value_Incorrect_Format + True -> + -- IOPT value is in the accepted format. + case (DBC8.readInteger alignmentioptfieldvaluep) of + Nothing -> return (-1) + Just (alignmentioptfieldvalueinteger,_) -> return alignmentioptfieldvalueinteger + return SAM_V1_6_Alignment_OptionalFields_IOPT + { sam_v1_6_alignment_optionalfields_iopt_tag = alignmentioptfieldtag + , sam_v1_6_alignment_optionalfields_iopt_value = alignmentioptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/ZOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/ZOPT.hs new file mode 100644 --- /dev/null +++ b/src/Data/SAM/Version1_6/Read/Parser/Alignment/OptionalFields/ZOPT.hs @@ -0,0 +1,94 @@ +{-# LANGUAGE DeriveDataTypeable #-} +{-# LANGUAGE DeriveGeneric #-} +{-# LANGUAGE FlexibleContexts #-} +{-# LANGUAGE FlexibleInstances #-} +{-# LANGUAGE MultiParamTypeClasses #-} +{-# LANGUAGE OverloadedLists #-} +{-# LANGUAGE OverloadedStrings #-} +{-# LANGUAGE MultiWayIf #-} +{-# LANGUAGE RecordWildCards #-} +{-# LANGUAGE ScopedTypeVariables #-} +{-# LANGUAGE TypeFamilies #-} +{-# Language QuasiQuotes #-} + +-- | +-- Module : Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.ZOPT +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = WARNING +-- +-- This module is considered __internal__. +-- +-- The Package Versioning Policy __does not apply__. +-- +-- The contents of this module may change __in any way whatsoever__ +-- and __without any warning__ between minor versions of this package. +-- +-- Authors importing this library are expected to track development +-- closely. +-- +-- All credit goes to the author(s)/maintainer(s) of the +-- [containers](https://hackage.haskell.org/package/containers) library +-- for the above warning text. +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Read.Parser.Alignment.OptionalFields.ZOPT ( -- * SAM_V1_6 parser - alignment section - zopt field + parse_SAM_V1_6_Alignment_OptionalFields_ZOPT + ) where + +import Data.SAM.Version1_6.Alignment.OptionalFields.ZOPT +import Data.SAM.Version1_6.Read.Error + +import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) +import Data.Attoparsec.ByteString.Lazy as DABL +import Text.Regex.PCRE.Heavy + +-- | Defines a parser for the optional zopt field of alignment section of the SAM v1.6 file format. +-- +-- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. +parse_SAM_V1_6_Alignment_OptionalFields_ZOPT :: Parser SAM_V1_6_Alignment_OptionalFields_ZOPT +parse_SAM_V1_6_Alignment_OptionalFields_ZOPT = do + alignmentzoptfieldtag <- do + alignmentzoptfieldtagp <- + DABL.takeTill (== 58) + -- Parse ZOPT tag of the alignment section. + case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_ZOPT_Tag_Incorrect_Format + True -> + -- ZOPT tag is in the accepted format. + return alignmentzoptfieldtagp + _ <- + word8 58 + _ <- do + alignmentzoptfieldtypep <- + DABL.takeTill (== 58) + -- Parse ZOPT type of the alignment section. + case (alignmentzoptfieldtypep =~ [re|[Z]|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_ZOPT_Type_Incorrect_Format + True -> + -- ZOPT type is in the accepted format. + return () + _ <- + word8 58 + alignmentzoptfieldvalue <- do + alignmentzoptfieldvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse ZOPT value of the alignment section. + case (alignmentzoptfieldvaluep =~ [re|[ !-~]*|]) of + False -> + fail $ show SAM_V1_6_Error_Alignment_ZOPT_Value_Incorrect_Format + True -> + -- ZOPT value is in the accepted format. + return alignmentzoptfieldvaluep + return SAM_V1_6_Alignment_OptionalFields_ZOPT + { sam_v1_6_alignment_optionalfields_zopt_tag = alignmentzoptfieldtag + , sam_v1_6_alignment_optionalfields_zopt_value = alignmentzoptfieldvalue + } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs b/src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs deleted file mode 100644 --- a/src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs +++ /dev/null @@ -1,80 +0,0 @@ -{-# LANGUAGE DeriveDataTypeable #-} -{-# LANGUAGE DeriveGeneric #-} -{-# LANGUAGE FlexibleContexts #-} -{-# LANGUAGE FlexibleInstances #-} -{-# LANGUAGE MultiParamTypeClasses #-} -{-# LANGUAGE OverloadedLists #-} -{-# LANGUAGE OverloadedStrings #-} -{-# LANGUAGE MultiWayIf #-} -{-# LANGUAGE PackageImports #-} -{-# LANGUAGE RecordWildCards #-} -{-# LANGUAGE ScopedTypeVariables #-} -{-# LANGUAGE TypeFamilies #-} -{-# Language QuasiQuotes #-} - --- | --- Module : Data.SAM.Version1_6.Read.Parser.Alignment.ZOPT --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = WARNING --- --- This module is considered __internal__. --- --- The Package Versioning Policy __does not apply__. --- --- The contents of this module may change __in any way whatsoever__ --- and __without any warning__ between minor versions of this package. --- --- Authors importing this library are expected to track development --- closely. --- --- All credit goes to the author(s)/maintainer(s) of the --- [containers](https://hackage.haskell.org/package/containers) library --- for the above warning text. --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Read.Parser.Alignment.ZOPT ( -- * SAM_V1_6 parser - alignment section - zopt field - parse_SAM_V1_6_Alignment_ZOPT - ) where - -import Data.SAM.Version1_6.Alignment.ZOPT -import Data.SAM.Version1_6.Read.Error - -import Data.Attoparsec.ByteString.Char8 as DABC8 (isEndOfLine) -import Data.Attoparsec.ByteString.Lazy as DABL -import Text.Regex.PCRE.Heavy - --- | Defines a parser for the optional zopt field of alignment section of the SAM v1.6 file format. --- --- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. -parse_SAM_V1_6_Alignment_ZOPT :: Parser SAM_V1_6_Alignment_ZOPT -parse_SAM_V1_6_Alignment_ZOPT = do - alignmentzoptfieldtag <- do alignmentzoptfieldtagp <- DABL.takeTill (== 58) - -- Parse ZOPT tag of the alignment section. - case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Tag_Incorrect_Format - True -> -- ZOPT tag is in the accepted format. - return alignmentzoptfieldtagp - _ <- word8 58 - _ <- do alignmentzoptfieldtypep <- DABL.takeTill (== 58) - -- Parse ZOPT type of the alignment section. - case (alignmentzoptfieldtypep =~ [re|[Z]|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Type_Incorrect_Format - True -> -- ZOPT type is in the accepted format. - return () - _ <- word8 58 - alignmentzoptfieldvalue <- do alignmentzoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse ZOPT value of the alignment section. - case (alignmentzoptfieldvaluep =~ [re|[ !-~]*|]) of - False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Value_Incorrect_Format - True -> -- ZOPT value is in the accepted format. - return alignmentzoptfieldvaluep - return SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = alignmentzoptfieldtag - , sam_v1_6_alignment_zopt_value = alignmentzoptfieldvalue - } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/CO/Base.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/CO/Base.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/CO/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/CO/Base.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.CO.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -58,14 +58,21 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_One_Line_Comment :: Parser SAM_V1_6_One_Line_Comment parse_SAM_V1_6_One_Line_Comment = do - _ <- do coheaderp <- DABL.takeTill (== 09) - -- Parse @PG tag of the header section. - case (coheaderp =~ [re|[@][C][O]|]) of - False -> fail $ show SAM_V1_6_Error_One_Line_Comment_Tag_Incorrect_Format - True -> -- @CO tag is in the accepted format. - return () - _ <- word8 09 - value <- DABL.takeTill isEndOfLine - _ <- endOfLine + _ <- do + coheaderp <- + DABL.takeTill (== 09) + -- Parse @PG tag of the header section. + case (coheaderp =~ [re|[@][C][O]|]) of + False -> + fail $ show SAM_V1_6_Error_One_Line_Comment_Tag_Incorrect_Format + True -> + -- @CO tag is in the accepted format. + return () + _ <- + word8 09 + value <- + DABL.takeTill isEndOfLine + _ <- + endOfLine return SAM_V1_6_One_Line_Comment { sam_v1_6_one_line_comment_value = value } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/Base.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/Base.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/Base.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.HD.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -62,23 +62,30 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_File_Level_Metadata :: Parser SAM_V1_6_File_Level_Metadata parse_SAM_V1_6_File_Level_Metadata = do - _ <- do hdheaderp <- DABL.takeTill (== 09) - -- Parse @HD tag of the header section. - case (hdheaderp =~ [re|[@][H][D]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Tag_Incorrect_Format - True -> -- @HD tag is in the accepted format. - return () - _ <- word8 09 + _ <- do + hdheaderp <- + DABL.takeTill (== 09) + -- Parse @HD tag of the header section. + case (hdheaderp =~ [re|[@][H][D]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Tag_Incorrect_Format + True -> + -- @HD tag is in the accepted format. + return () + _ <- + word8 09 -- This parser assumes that the -- VN, SO, GO and SS tags can appear in any order. - hd <- intercalateEffect (word8 09) $ - SAM_V1_6_File_Level_Metadata - <$> toPermutation parse_SAM_V1_6_File_Level_Metadata_VN - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_File_Level_Metadata_SO) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_File_Level_Metadata_GO) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_File_Level_Metadata_SS) - _ <- endOfLine + hd <- + intercalateEffect (word8 09) $ + SAM_V1_6_File_Level_Metadata + <$> toPermutation parse_SAM_V1_6_File_Level_Metadata_VN + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_File_Level_Metadata_SO) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_File_Level_Metadata_GO) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_File_Level_Metadata_SS) + _ <- + endOfLine return hd diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/GO.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/GO.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/GO.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/GO.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.HD.GO --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -56,18 +56,26 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_File_Level_Metadata_GO :: Parser SAM_V1_6_File_Level_Metadata_Alignment_Grouping parse_SAM_V1_6_File_Level_Metadata_GO = do - _ <- do hdheaderalignmentgroupingtagp <- DABL.takeTill (== 58) - -- Parse GO tag of the header section. - case (hdheaderalignmentgroupingtagp =~ [re|[G][O]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Grouping_Of_Alignments_Tag_Incorrect_Format - True -> -- GO tag is in the accepted format. - return () - _ <- word8 58 - hdheaderalignmentgroupingvalue <- do hdheaderalignmentgroupingvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse GO value of the header section. - case (hdheaderalignmentgroupingvaluep =~ [re|[n][o][n][e]|[q][u][e][r][y]|[r][e][f][e][r][e][n][c][e]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Grouping_Of_Alignments_Invalid_Value - True -> -- GO value is in the accepted format. - return hdheaderalignmentgroupingvaluep + _ <- do + hdheaderalignmentgroupingtagp <- + DABL.takeTill (== 58) + -- Parse GO tag of the header section. + case (hdheaderalignmentgroupingtagp =~ [re|[G][O]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Grouping_Of_Alignments_Tag_Incorrect_Format + True -> + -- GO tag is in the accepted format. + return () + _ <- + word8 58 + hdheaderalignmentgroupingvalue <- do + hdheaderalignmentgroupingvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse GO value of the header section. + case (hdheaderalignmentgroupingvaluep =~ [re|[n][o][n][e]|[q][u][e][r][y]|[r][e][f][e][r][e][n][c][e]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Grouping_Of_Alignments_Invalid_Value + True -> + -- GO value is in the accepted format. + return hdheaderalignmentgroupingvaluep return SAM_V1_6_File_Level_Metadata_Alignment_Grouping { sam_v1_6_file_level_metadata_alignment_grouping_value = hdheaderalignmentgroupingvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SO.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SO.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SO.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SO.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.HD.SO --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -56,18 +56,26 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_File_Level_Metadata_SO :: Parser SAM_V1_6_File_Level_Metadata_Sorting_Order parse_SAM_V1_6_File_Level_Metadata_SO = do - _ <- do hdheadersortingordertagp <- DABL.takeTill (== 58) - -- Parse SO tag of the header section. - case (hdheadersortingordertagp =~ [re|[S][O]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Sorting_Order_Tag_Incorrect_Format - True -> -- SO tag is in the accepted format. - return () - _ <- word8 58 - hdheadersortingordervalue <- do hdheadersortingordervaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse SO value of the header section. - case (hdheadersortingordervaluep =~ [re|[u][n][k][n][o][w][n]|[u][n][s][o][r][t][e][d]|[q][u][e][r][y][n][a][m][e]|[c][o][o][r][d][i][n][a][t][e]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Sorting_Order_Invalid_Value - True -> -- SO value is in the accepted format. - return hdheadersortingordervaluep + _ <- do + hdheadersortingordertagp <- + DABL.takeTill (== 58) + -- Parse SO tag of the header section. + case (hdheadersortingordertagp =~ [re|[S][O]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Sorting_Order_Tag_Incorrect_Format + True -> + -- SO tag is in the accepted format. + return () + _ <- + word8 58 + hdheadersortingordervalue <- do + hdheadersortingordervaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse SO value of the header section. + case (hdheadersortingordervaluep =~ [re|[u][n][k][n][o][w][n]|[u][n][s][o][r][t][e][d]|[q][u][e][r][y][n][a][m][e]|[c][o][o][r][d][i][n][a][t][e]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Sorting_Order_Invalid_Value + True -> + -- SO value is in the accepted format. + return hdheadersortingordervaluep return SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value = hdheadersortingordervalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SS.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SS.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SS.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/SS.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.HD.SS --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -56,18 +56,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_File_Level_Metadata_SS :: Parser SAM_V1_6_File_Level_Metadata_SubSorting_Order parse_SAM_V1_6_File_Level_Metadata_SS = do - _ <- do hdheadersubsortingordertagp <- DABL.takeTill (== 58) - -- Parse SS tag of the header section. - case (hdheadersubsortingordertagp =~ [re|[S][S]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Subsorting_Order_Tag_Incorrect_Format - True -> -- SS tag is in the accepted format. - return () - _ <- word8 58 - hdheadersubsortingordervalue <- do hdheadersubsortingordervaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse SS value of the header section. - case (hdheadersubsortingordervaluep =~ [re|(coordinate|queryname|unsorted)(:[A-Za-z0-9_-]+)+|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Subsorting_Order_Incorrect_Format - True -> -- SS value is in the accepted format. - return hdheadersubsortingordervaluep + _ <- do + hdheadersubsortingordertagp <- + DABL.takeTill (== 58) + -- Parse SS tag of the header section. + case (hdheadersubsortingordertagp =~ [re|[S][S]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Subsorting_Order_Tag_Incorrect_Format + True -> + -- SS tag is in the accepted format. + return () + _ <- + word8 58 + hdheadersubsortingordervalue <- do + hdheadersubsortingordervaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse SS value of the header section. + case (hdheadersubsortingordervaluep =~ [re|(coordinate|queryname|unsorted)(:[A-Za-z0-9_-]+)+|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Subsorting_Order_Incorrect_Format + True -> + -- SS value is in the accepted format. + return hdheadersubsortingordervaluep return SAM_V1_6_File_Level_Metadata_SubSorting_Order { sam_v1_6_file_level_metadata_subsorting_order_value = hdheadersubsortingordervalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/VN.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/VN.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/HD/VN.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/HD/VN.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.HD.VN --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -56,18 +56,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_File_Level_Metadata_VN :: Parser SAM_V1_6_File_Level_Metadata_Format_Version parse_SAM_V1_6_File_Level_Metadata_VN = do - _ <- do hdheaderversiontagp <- DABL.takeTill (== 58) - -- Parse VN tag of the header section. - case (hdheaderversiontagp =~ [re|[V][N]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Format_Version_Tag_Incorrect_Format - True -> -- VN tag is in the accepted format. - return () - _ <- word8 58 - hdheaderversionvalue <- do hdheaderversionvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse VN value of the header section. - case (hdheaderversionvaluep =~ [re|^[0-9]+\.[0-9]+$|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Format_Version_Value_Incorrect_Format - True -> -- VN value is in the accepted format. - return hdheaderversionvaluep + _ <- do + hdheaderversiontagp <- + DABL.takeTill (== 58) + -- Parse VN tag of the header section. + case (hdheaderversiontagp =~ [re|[V][N]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Format_Version_Tag_Incorrect_Format + True -> + -- VN tag is in the accepted format. + return () + _ <- + word8 58 + hdheaderversionvalue <- do + hdheaderversionvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse VN value of the header section. + case (hdheaderversionvaluep =~ [re|^[0-9]+\.[0-9]+$|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Format_Version_Value_Incorrect_Format + True -> + -- VN value is in the accepted format. + return hdheaderversionvaluep return SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value = hdheaderversionvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/Base.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/Base.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/Base.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.PG.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -65,27 +65,34 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Program :: Parser SAM_V1_6_Program parse_SAM_V1_6_Program = do - _ <- do pgheaderp <- DABL.takeTill (== 09) - -- Parse @PG tag of the header section. - case (pgheaderp =~ [re|[@][P][G]|]) of - False -> fail $ show SAM_V1_6_Error_Program_Tag_Incorrect_Format - True -> -- @PG tag is in the accepted format. - return () - _ <- word8 09 + _ <- do + pgheaderp <- + DABL.takeTill (== 09) + -- Parse @PG tag of the header section. + case (pgheaderp =~ [re|[@][P][G]|]) of + False -> + fail $ show SAM_V1_6_Error_Program_Tag_Incorrect_Format + True -> + -- @PG tag is in the accepted format. + return () + _ <- + word8 09 -- This parser assumes that the -- ID, PN, CL, PP, DS, and VN tags can appear in any order. - pg <- intercalateEffect (word8 09) $ - SAM_V1_6_Program - <$> toPermutation parse_SAM_V1_6_Program_ID - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Program_PN) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Program_CL) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Program_PP) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Program_DS) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Program_VN) - _ <- endOfLine + pg <- + intercalateEffect (word8 09) $ + SAM_V1_6_Program + <$> toPermutation parse_SAM_V1_6_Program_ID + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Program_PN) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Program_CL) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Program_PP) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Program_DS) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Program_VN) + _ <- + endOfLine return pg diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/CL.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/CL.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/CL.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/CL.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.PG.CL --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Program_CL :: Parser SAM_V1_6_Program_Command_Line parse_SAM_V1_6_Program_CL = do - _ <- do pgheadercommandlinetagp <- DABL.takeTill (== 58) - -- Parse CL tag of the header section. - case (pgheadercommandlinetagp =~ [re|[C][L]|]) of - False -> fail $ show SAM_V1_6_Error_Program_Command_Line_Incorrect_Format - True -> -- CL tag is in the accepted format. - return () - _ <- word8 58 - pgheadercommandlinevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + pgheadercommandlinetagp <- + DABL.takeTill (== 58) + -- Parse CL tag of the header section. + case (pgheadercommandlinetagp =~ [re|[C][L]|]) of + False -> + fail $ show SAM_V1_6_Error_Program_Command_Line_Incorrect_Format + True -> + -- CL tag is in the accepted format. + return () + _ <- + word8 58 + pgheadercommandlinevalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Program_Command_Line { sam_v1_6_program_command_line_value = pgheadercommandlinevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/DS.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/DS.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/DS.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/DS.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.PG.DS --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Program_DS :: Parser SAM_V1_6_Program_Description parse_SAM_V1_6_Program_DS = do - _ <- do pgheaderdescriptiontagp <- DABL.takeTill (== 58) - -- Parse DS tag of the header section. - case (pgheaderdescriptiontagp =~ [re|[D][S]|]) of - False -> fail $ show SAM_V1_6_Error_Program_Description_Incorrect_Format - True -> -- DS tag is in the accepted format. - return () - _ <- word8 58 - pgheaderdescriptionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + pgheaderdescriptiontagp <- + DABL.takeTill (== 58) + -- Parse DS tag of the header section. + case (pgheaderdescriptiontagp =~ [re|[D][S]|]) of + False -> + fail $ show SAM_V1_6_Error_Program_Description_Incorrect_Format + True -> + -- DS tag is in the accepted format. + return () + _ <- + word8 58 + pgheaderdescriptionvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Program_Description { sam_v1_6_program_description_value = pgheaderdescriptionvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/ID.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/ID.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/ID.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/ID.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.PG.ID --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Program_ID :: Parser SAM_V1_6_Program_Record_Identifier parse_SAM_V1_6_Program_ID = do - _ <- do pgheaderidentifiertagp <- DABL.takeTill (== 58) - -- Parse ID tag of the header section. - case (pgheaderidentifiertagp =~ [re|[I][D]|]) of - False -> fail $ show SAM_V1_6_Error_Program_Identifier_Incorrect_Format - True -> -- ID tag is in the accepted format. - return () - _ <- word8 58 - pgheaderidentifiervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + pgheaderidentifiertagp <- + DABL.takeTill (== 58) + -- Parse ID tag of the header section. + case (pgheaderidentifiertagp =~ [re|[I][D]|]) of + False -> + fail $ show SAM_V1_6_Error_Program_Identifier_Incorrect_Format + True -> + -- ID tag is in the accepted format. + return () + _ <- + word8 58 + pgheaderidentifiervalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Program_Record_Identifier { sam_v1_6_program_record_identifier_value = pgheaderidentifiervalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PN.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PN.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PN.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PN.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.PG.PN --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Program_PN :: Parser SAM_V1_6_Program_Name parse_SAM_V1_6_Program_PN = do - _ <- do pgheadernametagp <- DABL.takeTill (== 58) - -- Parse PN tag of the header section. - case (pgheadernametagp =~ [re|[P][N]|]) of - False -> fail $ show SAM_V1_6_Error_Program_Name_Incorrect_Format - True -> -- PN tag is in the accepted format. - return () - _ <- word8 58 - pgheadernamevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + pgheadernametagp <- + DABL.takeTill (== 58) + -- Parse PN tag of the header section. + case (pgheadernametagp =~ [re|[P][N]|]) of + False -> + fail $ show SAM_V1_6_Error_Program_Name_Incorrect_Format + True -> + -- PN tag is in the accepted format. + return () + _ <- + word8 58 + pgheadernamevalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Program_Name { sam_v1_6_program_name_value = pgheadernamevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PP.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PP.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PP.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/PP.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.PG.PP --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Program_PP :: Parser SAM_V1_6_Program_Previous_PG_ID parse_SAM_V1_6_Program_PP = do - _ <- do pgheaderpreviouspgidtagp <- DABL.takeTill (== 58) - -- Parse PP tag of the header section. - case (pgheaderpreviouspgidtagp =~ [re|[P][P]|]) of - False -> fail $ show SAM_V1_6_Error_Program_Previous_PG_ID_Incorrect_Format - True -> -- PP tag is in the accepted format. - return () - _ <- word8 58 - pgheaderpreviouspgidvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + pgheaderpreviouspgidtagp <- + DABL.takeTill (== 58) + -- Parse PP tag of the header section. + case (pgheaderpreviouspgidtagp =~ [re|[P][P]|]) of + False -> + fail $ show SAM_V1_6_Error_Program_Previous_PG_ID_Incorrect_Format + True -> + -- PP tag is in the accepted format. + return () + _ <- + word8 58 + pgheaderpreviouspgidvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Program_Previous_PG_ID { sam_v1_6_program_previous_pg_id_value = pgheaderpreviouspgidvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/VN.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/VN.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/PG/VN.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/PG/VN.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.PG.VN --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Program_VN :: Parser SAM_V1_6_Program_Version parse_SAM_V1_6_Program_VN = do - _ <- do pgheaderversiontagp <- DABL.takeTill (== 58) - -- Parse VN tag of the header section. - case (pgheaderversiontagp =~ [re|[V][N]|]) of - False -> fail $ show SAM_V1_6_Error_Program_Version_Incorrect_Format - True -> -- VN tag is in the accepted format. - return () - _ <- word8 58 - pgheaderversionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + pgheaderversiontagp <- + DABL.takeTill (== 58) + -- Parse VN tag of the header section. + case (pgheaderversiontagp =~ [re|[V][N]|]) of + False -> + fail $ show SAM_V1_6_Error_Program_Version_Incorrect_Format + True -> + -- VN tag is in the accepted format. + return () + _ <- + word8 58 + pgheaderversionvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Program_Version { sam_v1_6_program_version_value = pgheaderversionvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/BC.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/BC.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/BC.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/BC.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.BC --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_BC :: Parser SAM_V1_6_Read_Group_Barcode_Sequence parse_SAM_V1_6_Read_Group_BC = do - _ <- do rgheaderbarcodesequencetagp <- DABL.takeTill (== 58) - -- Parse BC tag of the header section. - case (rgheaderbarcodesequencetagp =~ [re|[B][C]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Barcode_Sequence_Incorrect_Format - True -> -- BC tag is in the accepted format. - return () - _ <- word8 58 - rgheaderbarcodesequencevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderbarcodesequencetagp <- + DABL.takeTill (== 58) + -- Parse BC tag of the header section. + case (rgheaderbarcodesequencetagp =~ [re|[B][C]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Barcode_Sequence_Incorrect_Format + True -> + -- BC tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderbarcodesequencevalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Barcode_Sequence { sam_v1_6_read_group_barcode_sequence_value = rgheaderbarcodesequencevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/Base.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/Base.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/Base.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -73,44 +73,51 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group :: Parser SAM_V1_6_Read_Group parse_SAM_V1_6_Read_Group = do - _ <- do rgheaderp <- DABL.takeTill (== 09) - -- Parse @RG tag of the header section. - case (rgheaderp =~ [re|[@][R][G]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Tag_Incorrect_Format - True -> -- @RG tag is in the accepted format. - return () - _ <- word8 09 + _ <- do + rgheaderp <- + DABL.takeTill (== 09) + -- Parse @RG tag of the header section. + case (rgheaderp =~ [re|[@][R][G]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Tag_Incorrect_Format + True -> + -- @RG tag is in the accepted format. + return () + _ <- + word8 09 -- This parser assumes that the -- ID, BC, CN, DS, DT, FO, KS, LB, PG, PI, PL, -- PM, PU and SM tags can appear in any order. - rg <- intercalateEffect (word8 09) $ - SAM_V1_6_Read_Group - <$> toPermutation parse_SAM_V1_6_Read_Group_ID - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_BC) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_CN) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_DS) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_DT) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_FO) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_KS) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_LB) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_PG) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_PI) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_PL) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_PM) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_PU) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Read_Group_SM) - _ <- endOfLine + rg <- + intercalateEffect (word8 09) $ + SAM_V1_6_Read_Group + <$> toPermutation parse_SAM_V1_6_Read_Group_ID + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_BC) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_CN) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_DS) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_DT) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_FO) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_KS) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_LB) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_PG) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_PI) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_PL) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_PM) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_PU) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Read_Group_SM) + _ <- + endOfLine return rg diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/CN.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/CN.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/CN.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/CN.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.CN --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_CN :: Parser SAM_V1_6_Read_Group_Sequencing_Center parse_SAM_V1_6_Read_Group_CN = do - _ <- do rgheadersequencingcentertagp <- DABL.takeTill (== 58) - -- Parse CN tag of the header section. - case (rgheadersequencingcentertagp =~ [re|[C][N]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Sequencing_Center_Incorrect_Format - True -> -- CN tag is in the accepted format. - return () - _ <- word8 58 - rgheadersequencingcentervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheadersequencingcentertagp <- + DABL.takeTill (== 58) + -- Parse CN tag of the header section. + case (rgheadersequencingcentertagp =~ [re|[C][N]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Sequencing_Center_Incorrect_Format + True -> + -- CN tag is in the accepted format. + return () + _ <- + word8 58 + rgheadersequencingcentervalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Sequencing_Center { sam_v1_6_read_group_sequencing_center_value = rgheadersequencingcentervalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DS.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DS.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DS.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DS.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.DS --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_DS :: Parser SAM_V1_6_Read_Group_Description parse_SAM_V1_6_Read_Group_DS = do - _ <- do rgheaderdescriptiontagp <- DABL.takeTill (== 58) - -- Parse DS tag of the header section. - case (rgheaderdescriptiontagp =~ [re|[D][S]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Description_Incorrect_Format - True -> -- DS tag is in the accepted format. - return () - _ <- word8 58 - rgheaderdescriptionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderdescriptiontagp <- + DABL.takeTill (== 58) + -- Parse DS tag of the header section. + case (rgheaderdescriptiontagp =~ [re|[D][S]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Description_Incorrect_Format + True -> + -- DS tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderdescriptionvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Description { sam_v1_6_read_group_description_value = rgheaderdescriptionvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DT.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DT.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DT.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/DT.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.DT --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_DT :: Parser SAM_V1_6_Read_Group_Run_Date parse_SAM_V1_6_Read_Group_DT = do - _ <- do rgheaderrundatetagp <- DABL.takeTill (== 58) - -- Parse DT tag of the header section. - case (rgheaderrundatetagp =~ [re|[D][T]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Date_Run_Produced_Incorrect_Format - True -> -- DT tag is in the accepted format. - return () - _ <- word8 58 - rgheaderrundatevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderrundatetagp <- + DABL.takeTill (== 58) + -- Parse DT tag of the header section. + case (rgheaderrundatetagp =~ [re|[D][T]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Date_Run_Produced_Incorrect_Format + True -> + -- DT tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderrundatevalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Run_Date { sam_v1_6_read_group_run_date_value = rgheaderrundatevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/FO.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/FO.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/FO.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/FO.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.FO --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,18 +55,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_FO :: Parser SAM_V1_6_Read_Group_Flow_Order parse_SAM_V1_6_Read_Group_FO = do - _ <- do rgheaderflowordertagp <- DABL.takeTill (== 58) - -- Parse FO tag of the header section. - case (rgheaderflowordertagp =~ [re|[F][O]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Flow_Order_Incorrect_Format - True -> -- FO tag is in the accepted format. - return () - _ <- word8 58 - rgheaderflowordervalue <- do rgheaderflowordervaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse FO value of the header section. - case (rgheaderflowordervaluep =~ [re|\*|[ACMGRSVTWYHKDBN]+|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Flow_Order_Incorrect_Format - True -> -- FO value is in the accepted format. - return rgheaderflowordervaluep + _ <- do + rgheaderflowordertagp <- + DABL.takeTill (== 58) + -- Parse FO tag of the header section. + case (rgheaderflowordertagp =~ [re|[F][O]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Flow_Order_Incorrect_Format + True -> + -- FO tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderflowordervalue <- do + rgheaderflowordervaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse FO value of the header section. + case (rgheaderflowordervaluep =~ [re|\*|[ACMGRSVTWYHKDBN]+|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Flow_Order_Incorrect_Format + True -> + -- FO value is in the accepted format. + return rgheaderflowordervaluep return SAM_V1_6_Read_Group_Flow_Order { sam_v1_6_read_group_flow_order_value = rgheaderflowordervalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/ID.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/ID.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/ID.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/ID.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.ID --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_ID :: Parser SAM_V1_6_Read_Group_Identifier parse_SAM_V1_6_Read_Group_ID = do - _ <- do rgheaderreadgroupidentifiertagp <- DABL.takeTill (== 58) - -- Parse ID tag of the header section. - case (rgheaderreadgroupidentifiertagp =~ [re|[I][D]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Read_Group_Identifier_Incorrect_Format - True -> -- ID tag is in the accepted format. - return () - _ <- word8 58 - rgheaderreadgroupidentifiervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderreadgroupidentifiertagp <- + DABL.takeTill (== 58) + -- Parse ID tag of the header section. + case (rgheaderreadgroupidentifiertagp =~ [re|[I][D]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Read_Group_Identifier_Incorrect_Format + True -> + -- ID tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderreadgroupidentifiervalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Identifier { sam_v1_6_read_group_identifier_value = rgheaderreadgroupidentifiervalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/KS.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/KS.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/KS.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/KS.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.KS --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_KS :: Parser SAM_V1_6_Read_Group_Key_Sequence parse_SAM_V1_6_Read_Group_KS = do - _ <- do rgheaderkeysequencetagp <- DABL.takeTill (== 58) - -- Parse KS tag of the header section. - case (rgheaderkeysequencetagp =~ [re|[K][S]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Key_Sequence_Incorrect_Format - True -> -- KS tag is in the accepted format. - return () - _ <- word8 58 - rgheaderkeysequencevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderkeysequencetagp <- + DABL.takeTill (== 58) + -- Parse KS tag of the header section. + case (rgheaderkeysequencetagp =~ [re|[K][S]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Key_Sequence_Incorrect_Format + True -> + -- KS tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderkeysequencevalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Key_Sequence { sam_v1_6_read_group_key_sequence_value = rgheaderkeysequencevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/LB.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/LB.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/LB.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/LB.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.LB --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_LB :: Parser SAM_V1_6_Read_Group_Library parse_SAM_V1_6_Read_Group_LB = do - _ <- do rgheaderlibrarytagp <- DABL.takeTill (== 58) - -- Parse LB tag of the header section. - case (rgheaderlibrarytagp =~ [re|[L][B]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Library_Incorrect_Format - True -> -- LB tag is in the accepted format. - return () - _ <- word8 58 - rgheaderlibraryvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderlibrarytagp <- + DABL.takeTill (== 58) + -- Parse LB tag of the header section. + case (rgheaderlibrarytagp =~ [re|[L][B]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Library_Incorrect_Format + True -> + -- LB tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderlibraryvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Library { sam_v1_6_read_group_library_value = rgheaderlibraryvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PG.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PG.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PG.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PG.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.PG --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_PG :: Parser SAM_V1_6_Read_Group_Programs parse_SAM_V1_6_Read_Group_PG = do - _ <- do rgheaderprogramstagp <- DABL.takeTill (== 58) - -- Parse PG tag of the header section. - case (rgheaderprogramstagp =~ [re|[P][G]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Programs_Incorrect_Format - True -> -- PG tag is in the accepted format. - return () - _ <- word8 58 - rgheaderprogramsvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderprogramstagp <- + DABL.takeTill (== 58) + -- Parse PG tag of the header section. + case (rgheaderprogramstagp =~ [re|[P][G]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Programs_Incorrect_Format + True -> + -- PG tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderprogramsvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Programs { sam_v1_6_read_group_programs_value = rgheaderprogramsvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PI.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PI.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PI.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PI.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.PI --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_PI :: Parser SAM_V1_6_Read_Group_Predicted_Median_Insert_Size parse_SAM_V1_6_Read_Group_PI = do - _ <- do rgheaderpredictedmedianinsertsizetagp <- DABL.takeTill (== 58) - -- Parse PI tag of the header section. - case (rgheaderpredictedmedianinsertsizetagp =~ [re|[P][I]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Predicted_Median_Insert_Size_Incorrect_Format - True -> -- PI tag is in the accepted format. - return () - _ <- word8 58 - rgheaderpredictedmedianinsertsizevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderpredictedmedianinsertsizetagp <- + DABL.takeTill (== 58) + -- Parse PI tag of the header section. + case (rgheaderpredictedmedianinsertsizetagp =~ [re|[P][I]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Predicted_Median_Insert_Size_Incorrect_Format + True -> + -- PI tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderpredictedmedianinsertsizevalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Predicted_Median_Insert_Size { sam_v1_6_read_group_predicted_median_insert_size_value = rgheaderpredictedmedianinsertsizevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PL.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PL.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PL.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PL.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.PL --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,18 +55,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_PL :: Parser SAM_V1_6_Read_Group_Platform parse_SAM_V1_6_Read_Group_PL = do - _ <- do rgheaderplatformtagp <- DABL.takeTill (== 58) - -- Parse PL tag of the header section. - case (rgheaderplatformtagp =~ [re|[P][L]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Incorrect_Format - True -> -- PL tag is in the accepted format. - return () - _ <- word8 58 - rgheaderplatformvalue <- do rgheaderplatformvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse PL value of the header section. - case (rgheaderplatformvaluep =~ [re|[C][A][P][I][L][L][A][R][Y]|[D][N][B][S][E][Q]|[E][L][E][M][E][N][T]|[H][E][L][I][C][O][S]|[I][L][L][U][M][I][N][A]|[I][O][N][T][O][R][R][E][N][T]|[L][S][4][5][4]|[O][N][T]|[P][A][C][B][I][O]|[S][O][L][I][D]|[U][L][T][I][M][A]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Incorrect_Format - True -> -- PL value is in the accepted format. - return rgheaderplatformvaluep + _ <- do + rgheaderplatformtagp <- + DABL.takeTill (== 58) + -- Parse PL tag of the header section. + case (rgheaderplatformtagp =~ [re|[P][L]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Platform_Incorrect_Format + True -> + -- PL tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderplatformvalue <- do + rgheaderplatformvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse PL value of the header section. + case (rgheaderplatformvaluep =~ [re|[C][A][P][I][L][L][A][R][Y]|[D][N][B][S][E][Q]|[E][L][E][M][E][N][T]|[H][E][L][I][C][O][S]|[I][L][L][U][M][I][N][A]|[I][O][N][T][O][R][R][E][N][T]|[L][S][4][5][4]|[O][N][T]|[P][A][C][B][I][O]|[S][O][L][I][D]|[U][L][T][I][M][A]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Platform_Incorrect_Format + True -> + -- PL value is in the accepted format. + return rgheaderplatformvaluep return SAM_V1_6_Read_Group_Platform { sam_v1_6_read_group_platform_value = rgheaderplatformvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PM.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PM.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PM.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PM.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.PM --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_PM :: Parser SAM_V1_6_Read_Group_Platform_Model parse_SAM_V1_6_Read_Group_PM = do - _ <- do rgheaderplatformmodeltagp <- DABL.takeTill (== 58) - -- Parse PM tag of the header section. - case (rgheaderplatformmodeltagp =~ [re|[P][M]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Model_Incorrect_Format - True -> -- PM tag is in the accepted format. - return () - _ <- word8 58 - rgheaderplatformmodelvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderplatformmodeltagp <- + DABL.takeTill (== 58) + -- Parse PM tag of the header section. + case (rgheaderplatformmodeltagp =~ [re|[P][M]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Platform_Model_Incorrect_Format + True -> + -- PM tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderplatformmodelvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Platform_Model { sam_v1_6_read_group_platform_model_value = rgheaderplatformmodelvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PU.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PU.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PU.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/PU.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.PU --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_PU :: Parser SAM_V1_6_Read_Group_Platform_Unit parse_SAM_V1_6_Read_Group_PU = do - _ <- do rgheaderplatformunittagp <- DABL.takeTill (== 58) - -- Parse PU tag of the header section. - case (rgheaderplatformunittagp =~ [re|[P][U]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Unit_Incorrect_Format - True -> -- PU tag is in the accepted format. - return () - _ <- word8 58 - rgheaderplatformunitvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheaderplatformunittagp <- + DABL.takeTill (== 58) + -- Parse PU tag of the header section. + case (rgheaderplatformunittagp =~ [re|[P][U]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Platform_Unit_Incorrect_Format + True -> + -- PU tag is in the accepted format. + return () + _ <- + word8 58 + rgheaderplatformunitvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Platform_Unit { sam_v1_6_read_group_platform_unit_value = rgheaderplatformunitvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/SM.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/SM.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/RG/SM.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/RG/SM.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.RG.SM --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Read_Group_SM :: Parser SAM_V1_6_Read_Group_Sample parse_SAM_V1_6_Read_Group_SM = do - _ <- do rgheadersampletagp <- DABL.takeTill (== 58) - -- Parse SM tag of the header section. - case (rgheadersampletagp =~ [re|[S][M]|]) of - False -> fail $ show SAM_V1_6_Error_Read_Group_Sample_Incorrect_Format - True -> -- SM tag is in the accepted format. - return () - _ <- word8 58 - rgheadersamplevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + rgheadersampletagp <- + DABL.takeTill (== 58) + -- Parse SM tag of the header section. + case (rgheadersampletagp =~ [re|[S][M]|]) of + False -> + fail $ show SAM_V1_6_Error_Read_Group_Sample_Incorrect_Format + True -> + -- SM tag is in the accepted format. + return () + _ <- + word8 58 + rgheadersamplevalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Read_Group_Sample { sam_v1_6_read_group_sample_value = rgheadersamplevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AH.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AH.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AH.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AH.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.AH --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_AH :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus parse_SAM_V1_6_Reference_Sequence_Dictionary_AH = do - _ <- do sqheaderalternativelocustagp <- DABL.takeTill (== 58) - -- Parse AH tag of the header section. - case (sqheaderalternativelocustagp =~ [re|[A][H]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Locus_Incorrect_Format - True -> -- AH tag is in the accepted format. - return () - _ <- word8 58 - sqheaderalternativelocusvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + sqheaderalternativelocustagp <- + DABL.takeTill (== 58) + -- Parse AH tag of the header section. + case (sqheaderalternativelocustagp =~ [re|[A][H]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Locus_Incorrect_Format + True -> + -- AH tag is in the accepted format. + return () + _ <- + word8 58 + sqheaderalternativelocusvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { sam_v1_6_reference_sequence_dictionary_alternative_locus_value = sqheaderalternativelocusvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AN.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AN.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AN.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AN.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.AN --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,18 +55,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_AN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names parse_SAM_V1_6_Reference_Sequence_Dictionary_AN = do - _ <- do sqheaderalternativereferencesequencenamestagp <- DABL.takeTill (== 58) - -- Parse AN tag of the header section. - case (sqheaderalternativereferencesequencenamestagp =~ [re|[A][N]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Incorrect_Format - True -> -- AN tag is in the accepted format. - return () - _ <- word8 58 - sqheaderalternativereferencesequencenamesvalue <- do sqheaderalternativereferencesequencenamesvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse AN value of the header section. - case (sqheaderalternativereferencesequencenamesvaluep =~ [re|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*(,[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*)*|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Invalid_Value - True -> -- AN value is in the accepted format. - return sqheaderalternativereferencesequencenamesvaluep + _ <- do + sqheaderalternativereferencesequencenamestagp <- + DABL.takeTill (== 58) + -- Parse AN tag of the header section. + case (sqheaderalternativereferencesequencenamestagp =~ [re|[A][N]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Incorrect_Format + True -> + -- AN tag is in the accepted format. + return () + _ <- + word8 58 + sqheaderalternativereferencesequencenamesvalue <- do + sqheaderalternativereferencesequencenamesvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse AN value of the header section. + case (sqheaderalternativereferencesequencenamesvaluep =~ [re|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*(,[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*)*|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Invalid_Value + True -> + -- AN value is in the accepted format. + return sqheaderalternativereferencesequencenamesvaluep return SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names { sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value = sqheaderalternativereferencesequencenamesvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AS.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AS.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AS.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AS.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.AS --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_AS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier parse_SAM_V1_6_Reference_Sequence_Dictionary_AS = do - _ <- do sqheadergenomeassemblyidentifiertagp <- DABL.takeTill (== 58) - -- Parse AS tag of the header section. - case (sqheadergenomeassemblyidentifiertagp =~ [re|[A][S]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Genome_Assembly_Identifier_Incorrect_Format - True -> -- AS tag is in the accepted format. - return () - _ <- word8 58 - sqheadergenomeassemblyidentifiervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + sqheadergenomeassemblyidentifiertagp <- + DABL.takeTill (== 58) + -- Parse AS tag of the header section. + case (sqheadergenomeassemblyidentifiertagp =~ [re|[A][S]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Genome_Assembly_Identifier_Incorrect_Format + True -> + -- AS tag is in the accepted format. + return () + _ <- + word8 58 + sqheadergenomeassemblyidentifiervalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value = sqheadergenomeassemblyidentifiervalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/Base.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/Base.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/Base.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/Base.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.Base --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -68,35 +68,42 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary :: Parser SAM_V1_6_Reference_Sequence_Dictionary parse_SAM_V1_6_Reference_Sequence_Dictionary = do - _ <- do sqheaderp <- DABL.takeTill (== 09) - -- Parse @SQ tag of the header section. - case (sqheaderp =~ [re|[@][S][Q]|]) of - False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Tag_Incorrect_Format - True -> -- @SQ tag is in the accepted format. - return () - _ <- word8 09 + _ <- do + sqheaderp <- + DABL.takeTill (== 09) + -- Parse @SQ tag of the header section. + case (sqheaderp =~ [re|[@][S][Q]|]) of + False -> + fail $ show SAM_V1_6_Error_File_Level_Metadata_Tag_Incorrect_Format + True -> + -- @SQ tag is in the accepted format. + return () + _ <- + word8 09 -- This parser assumes that the -- SN, LN, AH, AN, AS, DS, M5, -- SP, TP and UR tags can appear in any order. - sq <- intercalateEffect (word8 09) $ - SAM_V1_6_Reference_Sequence_Dictionary - <$> toPermutation parse_SAM_V1_6_Reference_Sequence_Dictionary_SN - <*> toPermutation parse_SAM_V1_6_Reference_Sequence_Dictionary_LN - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AH) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AN) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AS) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_DS) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_M5) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_SP) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_TP) - <*> toPermutationWithDefault Nothing - (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_UR) - _ <- endOfLine + sq <- + intercalateEffect (word8 09) $ + SAM_V1_6_Reference_Sequence_Dictionary + <$> toPermutation parse_SAM_V1_6_Reference_Sequence_Dictionary_SN + <*> toPermutation parse_SAM_V1_6_Reference_Sequence_Dictionary_LN + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AH) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AN) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AS) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_DS) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_M5) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_SP) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_TP) + <*> toPermutationWithDefault Nothing + (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_UR) + _ <- + endOfLine return sq diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/DS.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/DS.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/DS.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/DS.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.DS --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_DS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Description parse_SAM_V1_6_Reference_Sequence_Dictionary_DS = do - _ <- do sqheaderdescriptiontagp <- DABL.takeTill (== 58) - -- Parse DS tag of the header section. - case (sqheaderdescriptiontagp =~ [re|[D][S]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Description_Incorrect_Format - True -> -- DS tag is in the accepted format. - return () - _ <- word8 58 - sqheaderdescriptionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + sqheaderdescriptiontagp <- + DABL.takeTill (== 58) + -- Parse DS tag of the header section. + case (sqheaderdescriptiontagp =~ [re|[D][S]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Description_Incorrect_Format + True -> + -- DS tag is in the accepted format. + return () + _ <- + word8 58 + sqheaderdescriptionvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Reference_Sequence_Dictionary_Description { sam_v1_6_reference_sequence_dictionary_description_value = sqheaderdescriptionvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/LN.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/LN.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/LN.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/LN.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.LN --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,18 +55,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_LN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length parse_SAM_V1_6_Reference_Sequence_Dictionary_LN = do - _ <- do sqheadersequencelengthtagp <- DABL.takeTill (== 58) - -- Parse LN tag of the header section. - case (sqheadersequencelengthtagp =~ [re|[L][N]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Incorrect_Format - True -> -- LN tag is in the accepted format. - return () - _ <- word8 58 - sqheadersequencelengthvalue <- do sqheadersequencelengthvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse LN value of the header section. - case (sqheadersequencelengthvaluep =~ [re|[0-9]*|]) of -- Make this regex actually check the range of [1,2^31 - 1]? - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Invalid_Value - True -> -- LN value is in the accepted format. - return sqheadersequencelengthvaluep + _ <- do + sqheadersequencelengthtagp <- + DABL.takeTill (== 58) + -- Parse LN tag of the header section. + case (sqheadersequencelengthtagp =~ [re|[L][N]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Incorrect_Format + True -> + -- LN tag is in the accepted format. + return () + _ <- + word8 58 + sqheadersequencelengthvalue <- do + sqheadersequencelengthvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse LN value of the header section. + case (sqheadersequencelengthvaluep =~ [re|[0-9]*|]) of -- Make this regex actually check the range of [1,2^31 - 1]? + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Invalid_Value + True -> + -- LN value is in the accepted format. + return sqheadersequencelengthvaluep return SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = sqheadersequencelengthvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/M5.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/M5.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/M5.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/M5.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.M5 --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_M5 :: Parser SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum parse_SAM_V1_6_Reference_Sequence_Dictionary_M5 = do - _ <- do sqheadermd5checksumtagp <- DABL.takeTill (== 58) - -- Parse M5 tag of the header section. - case (sqheadermd5checksumtagp =~ [re|[M][5]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_MD5_Checksum_Incorrect_Format - True -> -- M5 tag is in the accepted format. - return () - _ <- word8 58 - sqheadermd5checksumvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + sqheadermd5checksumtagp <- + DABL.takeTill (== 58) + -- Parse M5 tag of the header section. + case (sqheadermd5checksumtagp =~ [re|[M][5]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_MD5_Checksum_Incorrect_Format + True -> + -- M5 tag is in the accepted format. + return () + _ <- + word8 58 + sqheadermd5checksumvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { sam_v1_6_reference_sequence_dictionary_md5_checksum_value = sqheadermd5checksumvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SN.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SN.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SN.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SN.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.SN --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,18 +55,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_SN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name parse_SAM_V1_6_Reference_Sequence_Dictionary_SN = do - _ <- do sqheadersequencenametagp <- DABL.takeTill (== 58) - -- Parse SN tag of the header section. - case (sqheadersequencenametagp =~ [re|[S][N]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Incorrect_Format - True -> -- SN tag is in the accepted format. - return () - _ <- word8 58 - sqheadersequencenamevalue <- do sqheadersequencenamevaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse SN value of the header section. - case (sqheadersequencenamevaluep =~ [re|[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Invalid_Value - True -> -- SN value is in the accepted format. - return sqheadersequencenamevaluep + _ <- do + sqheadersequencenametagp <- + DABL.takeTill (== 58) + -- Parse SN tag of the header section. + case (sqheadersequencenametagp =~ [re|[S][N]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Incorrect_Format + True -> + -- SN tag is in the accepted format. + return () + _ <- + word8 58 + sqheadersequencenamevalue <- do + sqheadersequencenamevaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse SN value of the header section. + case (sqheadersequencenamevaluep =~ [re|[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Invalid_Value + True -> + -- SN value is in the accepted format. + return sqheadersequencenamevaluep return SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = sqheadersequencenamevalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SP.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SP.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SP.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SP.hs @@ -15,7 +15,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.SP --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -56,13 +56,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_SP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Species parse_SAM_V1_6_Reference_Sequence_Dictionary_SP = do - _ <- do sqheaderspeciestagp <- DABL.takeTill (== 58) - -- Parse SP tag of the header section. - case (sqheaderspeciestagp =~ [re|[S][P]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Species_Incorrect_Format - True -> -- SP tag is in the accepted format. - return () - _ <- word8 58 - sqheaderspeciesvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + sqheaderspeciestagp <- + DABL.takeTill (== 58) + -- Parse SP tag of the header section. + case (sqheaderspeciestagp =~ [re|[S][P]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Species_Incorrect_Format + True -> + -- SP tag is in the accepted format. + return () + _ <- + word8 58 + sqheaderspeciesvalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Reference_Sequence_Dictionary_Species { sam_v1_6_reference_sequence_dictionary_species_value = sqheaderspeciesvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/TP.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/TP.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/TP.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/TP.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.TP --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,18 +55,27 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_TP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology parse_SAM_V1_6_Reference_Sequence_Dictionary_TP = do - _ <- do sqheadermoleculetopologytagp <- DABL.takeTill (== 58) - -- Parse TP tag of the header section. - case (sqheadermoleculetopologytagp =~ [re|[T][P]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Molecule_Topology_Incorrect_Format - True -> -- TP tag is in the accepted format. - return () - _ <- word8 58 - sqheadermoleculetopologyvalue <- do sqheadermoleculetopologyvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) - -- Parse TP value of the header section. - case (sqheadermoleculetopologyvaluep =~ [re|[l][i][n][e][a][r]|[c][i][r][c][u][l][a][r]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Molecule_Topology_Invalid_Value - True -> -- TP value is in the accepted format. - return sqheadermoleculetopologyvaluep + _ <- do + sqheadermoleculetopologytagp <- + DABL.takeTill (== 58) + -- Parse TP tag of the header section. + case (sqheadermoleculetopologytagp =~ [re|[T][P]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Molecule_Topology_Incorrect_Format + True -> + -- TP tag is in the accepted format. + return () + _ <- + word8 58 + sqheadermoleculetopologyvalue <- do + sqheadermoleculetopologyvaluep <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) + -- Parse TP value of the header section. + case (sqheadermoleculetopologyvaluep =~ [re|[l][i][n][e][a][r]|[c][i][r][c][u][l][a][r]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Molecule_Topology_Invalid_Value + True -> + -- TP value is in the accepted format. + return sqheadermoleculetopologyvaluep return SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { sam_v1_6_reference_sequence_dictionary_molecule_topology_value = sqheadermoleculetopologyvalue } diff --git a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/UR.hs b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/UR.hs --- a/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/UR.hs +++ b/src/Data/SAM/Version1_6/Read/Parser/Header/SQ/UR.hs @@ -14,7 +14,7 @@ -- | -- Module : Data.SAM.Version1_6.Read.Parser.Header.SQ.UR --- Copyright : (c) Matthew Mosior 2023 +-- Copyright : (c) Matthew Mosior 2024 -- License : BSD-style -- Maintainer : mattm.github@gmail.com -- Portability : portable @@ -55,13 +55,19 @@ -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation. parse_SAM_V1_6_Reference_Sequence_Dictionary_UR :: Parser SAM_V1_6_Reference_Sequence_Dictionary_URI parse_SAM_V1_6_Reference_Sequence_Dictionary_UR = do - _ <- do sqheaderuritagp <- DABL.takeTill (== 58) - -- Parse UR tag of the header section. - case (sqheaderuritagp =~ [re|[U][R]|]) of - False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_URI_Incorrect_Format - True -> -- UR tag is in the accepted format. - return () - _ <- word8 58 - sqheaderurivalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x) + _ <- do + sqheaderuritagp <- + DABL.takeTill (== 58) + -- Parse UR tag of the header section. + case (sqheaderuritagp =~ [re|[U][R]|]) of + False -> + fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_URI_Incorrect_Format + True -> + -- UR tag is in the accepted format. + return () + _ <- + word8 58 + sqheaderurivalue <- + DABL.takeTill (\x -> x == 09 || isEndOfLine x) return SAM_V1_6_Reference_Sequence_Dictionary_URI { sam_v1_6_reference_sequence_dictionary_uri_value = sqheaderurivalue } diff --git a/src/Data/SAM/Version1_6/Write/Base.hs b/src/Data/SAM/Version1_6/Write/Base.hs --- a/src/Data/SAM/Version1_6/Write/Base.hs +++ b/src/Data/SAM/Version1_6/Write/Base.hs @@ -5,537 +5,994 @@ -- | -- Module : Data.SAM.Version1_6.Write.Base --- Copyright : (c) Matthew Mosior 2023 --- License : BSD-style --- Maintainer : mattm.github@gmail.com --- Portability : portable --- --- = Description --- --- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. - -module Data.SAM.Version1_6.Write.Base ( -- * Writing - writeSAM_V1_6 - ) where - -import Data.SAM.Version1_6.Base -import Data.SAM.Version1_6.Header.HD -import Data.SAM.Version1_6.Header.SQ -import Data.SAM.Version1_6.Header.RG -import Data.SAM.Version1_6.Header.PG -import Data.SAM.Version1_6.Header.CO -import Data.SAM.Version1_6.Alignment.Base -import Data.SAM.Version1_6.Alignment.AOPT -import Data.SAM.Version1_6.Alignment.IOPT -import Data.SAM.Version1_6.Alignment.FOPT -import Data.SAM.Version1_6.Alignment.ZOPT -import Data.SAM.Version1_6.Alignment.HOPT -import Data.SAM.Version1_6.Alignment.BOPT - -import Data.ByteString as DB (pack,singleton) -import Data.ByteString.Lazy as DBL (filter) -import Data.ByteString.Lazy.Char8 as DBLC8 (fromStrict,unpack) -import Data.Foldable (toList) -import Data.List (intercalate) -import Data.Word -import Data.ByteString.Builder (toLazyByteString,word16LE,word32LE) -import System.IO (hFlush,hClose,hPutStr,IOMode(..),openFile, Handle) - - --- | Deconstruct a @"SAM_V1_6"@ to a `String`. -deconstructSAM_V1_6 :: SAM_V1_6 - -> String -deconstructSAM_V1_6 samv16 = - ( intercalate "\n" $ - Prelude.filter (not . Prelude.null) - [ sam_v1_6_file_level_metadata_tos - , sam_v1_6_reference_sequence_dictionary_tos - , sam_v1_6_read_group_tos - , sam_v1_6_program_tos - , sam_v1_6_one_line_comment_tos - , sam_v1_6_alignment_tos - ] - ) - ++ "\n" - where - sam_v1_6_file_level_metadata_format_version_tos x = "VN:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_file_level_metadata_format_version_value $ - sam_v1_6_file_level_metadata_format_version x - ) - sam_v1_6_file_level_metadata_sorting_order_tos x = case (sam_v1_6_file_level_metadata_sorting_order x) of - Nothing -> "" - Just rgf -> "SO:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_file_level_metadata_sorting_order_value rgf - ) - sam_v1_6_file_level_metadata_alignment_grouping_tos x = case (sam_v1_6_file_level_metadata_alignment_grouping x) of - Nothing -> "" - Just rgf -> "GO:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_file_level_metadata_alignment_grouping_value rgf - ) - sam_v1_6_file_level_metadata_subsorting_order_tos x = case (sam_v1_6_file_level_metadata_subsorting_order x) of - Nothing -> "" - Just rgf -> "SS:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_file_level_metadata_subsorting_order_value rgf - ) - sam_v1_6_file_level_metadata_tos = case (sam_v1_6_file_level_metadata samv16) of - Nothing -> "" - Just hdf -> intercalate "\t" $ - Prelude.filter (not . Prelude.null) $ - [ "@HD" - , sam_v1_6_file_level_metadata_format_version_tos hdf - , sam_v1_6_file_level_metadata_sorting_order_tos hdf - , sam_v1_6_file_level_metadata_alignment_grouping_tos hdf - , sam_v1_6_file_level_metadata_subsorting_order_tos hdf - ] - sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x = "SN:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value $ - sam_v1_6_reference_sequence_dictionary_reference_sequence_name x - ) - sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x = "LN:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value $ - sam_v1_6_reference_sequence_dictionary_reference_sequence_length x - ) - sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_locus x) of - Nothing -> "" - Just sqf -> "AH:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_alternative_locus_value sqf - ) - sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names x) of - Nothing -> "" - Just sqf -> "AN:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value sqf - ) - sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x = case (sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier x) of - Nothing -> "" - Just sqf -> "AS:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value sqf - ) - sam_v1_6_reference_sequence_dictionary_description_tos x = case (sam_v1_6_reference_sequence_dictionary_description x) of - Nothing -> "" - Just sqf -> "DS:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_description_value sqf - ) - sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x = case (sam_v1_6_reference_sequence_dictionary_md5_checksum x) of - Nothing -> "" - Just sqf -> "M5:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_md5_checksum_value sqf - ) - sam_v1_6_reference_sequence_dictionary_species_tos x = case (sam_v1_6_reference_sequence_dictionary_species x) of - Nothing -> "" - Just sqf -> "SP:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_species_value sqf - ) - sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x = case (sam_v1_6_reference_sequence_dictionary_molecule_topology x) of - Nothing -> "" - Just sqf -> "TP:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_molecule_topology_value sqf - ) - sam_v1_6_reference_sequence_dictionary_uri_tos x = case (sam_v1_6_reference_sequence_dictionary_uri x) of - Nothing -> "" - Just sqf -> "UR:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_reference_sequence_dictionary_uri_value sqf - ) - sam_v1_6_reference_sequence_dictionary_tos = case (sam_v1_6_reference_sequence_dictionary samv16) of - Nothing -> "" - Just sqf -> intercalate "\n" $ - map (\x -> intercalate "\t" $ - Prelude.filter (not . Prelude.null) $ - [ "@SQ" - , sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x - , sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x - , sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x - , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x - , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x - , sam_v1_6_reference_sequence_dictionary_description_tos x - , sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x - , sam_v1_6_reference_sequence_dictionary_species_tos x - , sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x - , sam_v1_6_reference_sequence_dictionary_uri_tos x - ] - ) (toList sqf) - sam_v1_6_read_group_identifer_tos x = "ID:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_identifier_value $ - sam_v1_6_read_group_identifier x - ) - sam_v1_6_read_group_barcode_sequence_tos x = case (sam_v1_6_read_group_barcode_sequence x) of - Nothing -> "" - Just rgf -> "BC:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_barcode_sequence_value rgf - ) - sam_v1_6_read_group_sequencing_center_tos x = case (sam_v1_6_read_group_sequencing_center x) of - Nothing -> "" - Just rgf -> "CN:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_sequencing_center_value rgf - ) - sam_v1_6_read_group_description_tos x = case (sam_v1_6_read_group_description x) of - Nothing -> "" - Just rgf -> "DS:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_description_value rgf - ) - sam_v1_6_read_group_run_date_tos x = case (sam_v1_6_read_group_run_date x) of - Nothing -> "" - Just rgf -> "DT:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_run_date_value rgf - ) - sam_v1_6_read_group_flow_order_tos x = case (sam_v1_6_read_group_flow_order x) of - Nothing -> "" - Just rgf -> "FO:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_flow_order_value rgf - ) - sam_v1_6_read_group_key_sequence_tos x = case (sam_v1_6_read_group_key_sequence x) of - Nothing -> "" - Just rgf -> "KS:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_key_sequence_value rgf - ) - sam_v1_6_read_group_library_tos x = case (sam_v1_6_read_group_library x) of - Nothing -> "" - Just rgf -> "LB:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_library_value rgf - ) - sam_v1_6_read_group_programs_tos x = case (sam_v1_6_read_group_programs x) of - Nothing -> "" - Just rgf -> "PG:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_programs_value rgf - ) - sam_v1_6_read_group_predicted_median_insert_size_tos x = case (sam_v1_6_read_group_predicted_median_insert_size x) of - Nothing -> "" - Just rgf -> "PI:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_predicted_median_insert_size_value rgf - ) - sam_v1_6_read_group_platform_tos x = case (sam_v1_6_read_group_platform x) of - Nothing -> "" - Just rgf -> "PL:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_platform_value rgf - ) - sam_v1_6_read_group_platform_model_tos x = case (sam_v1_6_read_group_platform_model x) of - Nothing -> "" - Just rgf -> "PM:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_platform_model_value rgf - ) - sam_v1_6_read_group_platform_unit_tos x = case (sam_v1_6_read_group_platform_unit x) of - Nothing -> "" - Just rgf -> "PU:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_platform_unit_value rgf - ) - sam_v1_6_read_group_sample_tos x = case (sam_v1_6_read_group_sample x) of - Nothing -> "" - Just rgf -> "SM:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_read_group_sample_value rgf - ) - sam_v1_6_read_group_tos = case (sam_v1_6_read_group samv16) of - Nothing -> "" - Just rgf -> intercalate "\n" $ - map (\x -> intercalate "\t" $ - Prelude.filter (not . Prelude.null) $ - [ "@RG" - , sam_v1_6_read_group_identifer_tos x - , sam_v1_6_read_group_barcode_sequence_tos x - , sam_v1_6_read_group_sequencing_center_tos x - , sam_v1_6_read_group_description_tos x - , sam_v1_6_read_group_run_date_tos x - , sam_v1_6_read_group_flow_order_tos x - , sam_v1_6_read_group_key_sequence_tos x - , sam_v1_6_read_group_library_tos x - , sam_v1_6_read_group_programs_tos x - , sam_v1_6_read_group_predicted_median_insert_size_tos x - , sam_v1_6_read_group_platform_tos x - , sam_v1_6_read_group_platform_model_tos x - , sam_v1_6_read_group_platform_unit_tos x - , sam_v1_6_read_group_sample_tos x - ] - ) (toList rgf) - sam_v1_6_program_record_identifier_tos x = "ID:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_program_record_identifier_value $ - sam_v1_6_program_record_identifier x - ) - sam_v1_6_program_name_tos x = case (sam_v1_6_program_name x) of - Nothing -> "" - Just rgf -> "PN:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_program_name_value rgf - ) - sam_v1_6_program_command_line_tos x = case (sam_v1_6_program_command_line x) of - Nothing -> "" - Just rgf -> "CL:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_program_command_line_value rgf - ) - sam_v1_6_program_previous_pg_id_tos x = case (sam_v1_6_program_previous_pg_id x) of - Nothing -> "" - Just rgf -> "PP:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_program_previous_pg_id_value rgf - ) - sam_v1_6_program_description_tos x = case (sam_v1_6_program_description x) of - Nothing -> "" - Just rgf -> "DS:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_program_description_value rgf - ) - sam_v1_6_program_version_tos x = case (sam_v1_6_program_version x) of - Nothing -> "" - Just rgf -> "VN:" ++ - ( unpack $ - fromStrict $ - sam_v1_6_program_version_value rgf - ) - sam_v1_6_program_tos = case (sam_v1_6_program samv16) of - Nothing -> "" - Just pgf -> intercalate "\t" $ - Prelude.filter (not . Prelude.null) $ - [ "@PG" - , sam_v1_6_program_record_identifier_tos pgf - , sam_v1_6_program_name_tos pgf - , sam_v1_6_program_command_line_tos pgf - , sam_v1_6_program_previous_pg_id_tos pgf - , sam_v1_6_program_description_tos pgf - , sam_v1_6_program_version_tos pgf - ] - sam_v1_6_one_line_comment_tos = case (sam_v1_6_one_line_comment samv16) of - Nothing -> "" - Just cof -> intercalate "\n" $ - map (\x -> intercalate "\t" $ - Prelude.filter (not . Prelude.null) - [ "@CO" - , unpack $ - fromStrict $ - sam_v1_6_one_line_comment_value x - ] - ) (toList cof) - sam_v1_6_alignment_tos = intercalate "\n" $ - map (\x -> case (Prelude.null $ sam_v1_6_alignment_opts x) of - True -> sam_v1_6_alignment_mand x - False -> intercalate "\t" - [ sam_v1_6_alignment_mand x - , sam_v1_6_alignment_opts x - ] ) (toList $ sam_v1_6_alignment samv16) - sam_v1_6_alignment_mand x = intercalate "\t" $ - Prelude.filter (not . Prelude.null) - [ unpack $ fromStrict $ sam_v1_6_alignment_qname x - , show $ sam_v1_6_alignment_flag x - , unpack $ fromStrict $ sam_v1_6_alignment_rname x - , show $ sam_v1_6_alignment_pos x - , show $ sam_v1_6_alignment_mapq x - , unpack $ fromStrict $ sam_v1_6_alignment_cigar x - , unpack $ fromStrict $ sam_v1_6_alignment_rnext x - , show $ sam_v1_6_alignment_pnext x - , show $ sam_v1_6_alignment_tlen x - , unpack $ fromStrict $ sam_v1_6_alignment_seq x - , unpack $ fromStrict $ sam_v1_6_alignment_qual x - ] - sam_v1_6_alignment_opts x = intercalate "\t" $ - Prelude.filter (not . Prelude.null) - [ sam_v1_6_alignment_aopt_d x - , sam_v1_6_alignment_iopt_d x - , sam_v1_6_alignment_fopt_d x - , sam_v1_6_alignment_zopt_d x - , sam_v1_6_alignment_hopt_d x - , sam_v1_6_alignment_bopt_d x - ] - sam_v1_6_alignment_aopt_d x = case (sam_v1_6_alignment_aopt x) of - Nothing -> "" - Just aopt -> ( unpack $ - fromStrict $ - sam_v1_6_alignment_aopt_tag aopt - ) - ++ - ":A:" - ++ - ( unpack $ - fromStrict $ - sam_v1_6_alignment_aopt_value aopt - ) - sam_v1_6_alignment_iopt_d x = case (sam_v1_6_alignment_iopt x) of - Nothing -> "" - Just iopt -> ( unpack $ - fromStrict $ - sam_v1_6_alignment_iopt_tag iopt - ) - ++ - ":i:" - ++ - ( show $ - sam_v1_6_alignment_iopt_value iopt - ) - sam_v1_6_alignment_fopt_d x = case (sam_v1_6_alignment_fopt x) of - Nothing -> "" - Just fopt -> ( unpack $ - fromStrict $ - sam_v1_6_alignment_fopt_tag fopt - ) - ++ - ":f:" - ++ - ( show $ - sam_v1_6_alignment_fopt_value fopt - ) - sam_v1_6_alignment_zopt_d x = case (sam_v1_6_alignment_zopt x) of - Nothing -> "" - Just zopt -> ( unpack $ - fromStrict $ - sam_v1_6_alignment_zopt_tag zopt - ) - ++ - ":Z:" - ++ - ( unpack $ - fromStrict $ - sam_v1_6_alignment_zopt_value zopt - ) - sam_v1_6_alignment_hopt_d x = case (sam_v1_6_alignment_hopt x) of - Nothing -> "" - Just hopt -> ( unpack $ - fromStrict $ - sam_v1_6_alignment_hopt_tag hopt - ) - ++ - ":H:" - ++ - ( unpack $ - fromStrict $ - sam_v1_6_alignment_hopt_value hopt - ) - sam_v1_6_alignment_bopt_d x = case (sam_v1_6_alignment_bopt x) of - Nothing -> "" - Just bopt -> concat $ - Prelude.filter (not . Prelude.null) - [ sam_v1_6_alignment_bopt_int8_d bopt - , sam_v1_6_alignment_bopt_word8_d bopt - , sam_v1_6_alignment_bopt_int16_d bopt - , sam_v1_6_alignment_bopt_word16_d bopt - , sam_v1_6_alignment_bopt_int32_d bopt - , sam_v1_6_alignment_bopt_word32_d bopt - , sam_v1_6_alignment_bopt_float_d bopt - ] - sam_v1_6_alignment_bopt_int8_d x = case (sam_v1_6_alignment_bopt_int8 x) of - Nothing -> "" - Just bopt_int8 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int8_tag bopt_int8) ++ - ":" ++ - "B" ++ - ":" ++ - (unpack $ fromStrict $ DB.singleton $ sam_v1_6_alignment_bopt_int8_type bopt_int8) ++ - "," ++ - (concat $ map show $ toList $ sam_v1_6_alignment_bopt_int8_value bopt_int8) - sam_v1_6_alignment_bopt_word8_d x = case (sam_v1_6_alignment_bopt_word8 x) of - Nothing -> "" - Just bopt_word8 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word8_tag bopt_word8) ++ - ":" ++ - "B" ++ - ":" ++ - (unpack $ fromStrict $ DB.singleton $ sam_v1_6_alignment_bopt_word8_type bopt_word8) ++ - "," ++ - (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word8_value bopt_word8) - sam_v1_6_alignment_bopt_int16_d x = case (sam_v1_6_alignment_bopt_int16 x) of - Nothing -> "" - Just bopt_int16 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int16_tag bopt_int16) ++ - ":" ++ - "B" ++ - ":" ++ - (unpack $ fromStrict $ DB.singleton $ sam_v1_6_alignment_bopt_int16_type bopt_int16) ++ - "," ++ - (concat $ map show $ toList $ sam_v1_6_alignment_bopt_int16_value bopt_int16) - sam_v1_6_alignment_bopt_word16_d x = case (sam_v1_6_alignment_bopt_word16 x) of - Nothing -> "" - Just bopt_word16 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word16_tag bopt_word16) ++ - ":" ++ - "B" ++ - ":" ++ - (unpack $ fromStrict $ DB.singleton $ sam_v1_6_alignment_bopt_word16_type bopt_word16) ++ - "," ++ - (concat $ map encodeWord16 $ toList $ sam_v1_6_alignment_bopt_word16_value bopt_word16) - sam_v1_6_alignment_bopt_int32_d x = case (sam_v1_6_alignment_bopt_int32 x) of - Nothing -> "" - Just bopt_int32 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_int32_tag bopt_int32) ++ - ":" ++ - "B" ++ - ":" ++ - (unpack $ fromStrict $ DB.singleton $ sam_v1_6_alignment_bopt_int32_type bopt_int32) ++ - "," ++ - (concat $ map show $ toList $ sam_v1_6_alignment_bopt_int32_value bopt_int32) - sam_v1_6_alignment_bopt_word32_d x = case (sam_v1_6_alignment_bopt_word32 x) of - Nothing -> "" - Just bopt_word32 -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_word32_tag bopt_word32) ++ - ":" ++ - "B" ++ - ":" ++ - (unpack $ fromStrict $ DB.singleton $ sam_v1_6_alignment_bopt_word32_type bopt_word32) ++ - "," ++ - (concat $ map encodeWord32 $ toList $ sam_v1_6_alignment_bopt_word32_value bopt_word32) - sam_v1_6_alignment_bopt_float_d x = case (sam_v1_6_alignment_bopt_float x) of - Nothing -> "" - Just bopt_float -> (unpack $ fromStrict $ pack $ toList $ sam_v1_6_alignment_bopt_float_tag bopt_float) ++ - ":" ++ - "B" ++ - ":" ++ - (unpack $ fromStrict $ DB.singleton $ sam_v1_6_alignment_bopt_float_type bopt_float) ++ - "," ++ - (concat $ map show $ toList $ sam_v1_6_alignment_bopt_float_value bopt_float) - encodeWord16 :: Word16 -> [Char] - encodeWord16 = unpack . DBL.filter (\x -> x /= 0) . toLazyByteString . word16LE - encodeWord32 :: Word32 -> [Char] - encodeWord32 = unpack . DBL.filter (\x -> x /= 0) . toLazyByteString . word32LE +-- Copyright : (c) Matthew Mosior 2024 +-- License : BSD-style +-- Maintainer : mattm.github@gmail.com +-- Portability : portable +-- +-- = Description +-- +-- This library enables the decoding/encoding of SAM, BAM and CRAM file formats. + +module Data.SAM.Version1_6.Write.Base ( -- * Writing + writeSAM_V1_6 + ) where + +import Data.SAM.Version1_6.Base +import Data.SAM.Version1_6.Header.HD +import Data.SAM.Version1_6.Header.SQ +import Data.SAM.Version1_6.Header.RG +import Data.SAM.Version1_6.Header.PG +import Data.SAM.Version1_6.Header.CO +import Data.SAM.Version1_6.Alignment.Base +import Data.SAM.Version1_6.Alignment.OptionalFields.Base +import Data.SAM.Version1_6.Alignment.OptionalFields.AOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.IOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.FOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.ZOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.HOPT +import Data.SAM.Version1_6.Alignment.OptionalFields.BOPT + +import Control.Monad (forM) +import Data.ByteString as DB (pack,singleton) +import Data.ByteString.Lazy as DBL (filter) +import Data.ByteString.Lazy.Char8 as DBLC8 (fromStrict,unpack) +import Data.Foldable (toList) +import Data.List (intercalate) +import Data.Word +import Data.ByteString.Builder (toLazyByteString,word16LE,word32LE) +import System.IO (hFlush,hClose,hPutStr,IOMode(..),openFile,Handle) + + +-- | Deconstruct a @"SAM_V1_6"@ to a `String`. +deconstructSAM_V1_6 :: SAM_V1_6 + -> String +deconstructSAM_V1_6 samv16 = + ( intercalate "\n" $ + Prelude.filter (not . Prelude.null) + [ sam_v1_6_file_level_metadata_tos + , sam_v1_6_reference_sequence_dictionary_tos + , sam_v1_6_read_group_tos + , sam_v1_6_program_tos + , sam_v1_6_one_line_comment_tos + , sam_v1_6_alignment_tos + ] + ) + ++ "\n" + where + sam_v1_6_file_level_metadata_format_version_tos x = "VN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_format_version_value $ + sam_v1_6_file_level_metadata_format_version x + ) + sam_v1_6_file_level_metadata_sorting_order_tos x = case (sam_v1_6_file_level_metadata_sorting_order x) of + Nothing -> + "" + Just rgf -> + "SO:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_sorting_order_value rgf + ) + sam_v1_6_file_level_metadata_alignment_grouping_tos x = case (sam_v1_6_file_level_metadata_alignment_grouping x) of + Nothing -> + "" + Just rgf -> + "GO:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_alignment_grouping_value rgf + ) + sam_v1_6_file_level_metadata_subsorting_order_tos x = case (sam_v1_6_file_level_metadata_subsorting_order x) of + Nothing -> + "" + Just rgf -> + "SS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_file_level_metadata_subsorting_order_value rgf + ) + sam_v1_6_file_level_metadata_tos = case (sam_v1_6_file_level_metadata samv16) of + Nothing -> + "" + Just hdf -> + intercalate "\t" $ + Prelude.filter (not . Prelude.null) + [ "@HD" + , sam_v1_6_file_level_metadata_format_version_tos hdf + , sam_v1_6_file_level_metadata_sorting_order_tos hdf + , sam_v1_6_file_level_metadata_alignment_grouping_tos hdf + , sam_v1_6_file_level_metadata_subsorting_order_tos hdf + ] + sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x = "SN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_name x + ) + sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x = "LN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value $ + sam_v1_6_reference_sequence_dictionary_reference_sequence_length x + ) + sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_locus x) of + Nothing -> + "" + Just sqf -> + "AH:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_alternative_locus_value sqf + ) + sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x = case (sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names x) of + Nothing -> + "" + Just sqf -> + "AN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_value sqf + ) + sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x = case (sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier x) of + Nothing -> + "" + Just sqf -> + "AS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value sqf + ) + sam_v1_6_reference_sequence_dictionary_description_tos x = case (sam_v1_6_reference_sequence_dictionary_description x) of + Nothing -> + "" + Just sqf -> + "DS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_description_value sqf + ) + sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x = case (sam_v1_6_reference_sequence_dictionary_md5_checksum x) of + Nothing -> + "" + Just sqf -> + "M5:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_md5_checksum_value sqf + ) + sam_v1_6_reference_sequence_dictionary_species_tos x = case (sam_v1_6_reference_sequence_dictionary_species x) of + Nothing -> + "" + Just sqf -> + "SP:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_species_value sqf + ) + sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x = case (sam_v1_6_reference_sequence_dictionary_molecule_topology x) of + Nothing -> + "" + Just sqf -> + "TP:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_molecule_topology_value sqf + ) + sam_v1_6_reference_sequence_dictionary_uri_tos x = case (sam_v1_6_reference_sequence_dictionary_uri x) of + Nothing -> + "" + Just sqf -> + "UR:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_reference_sequence_dictionary_uri_value sqf + ) + sam_v1_6_reference_sequence_dictionary_tos = case (sam_v1_6_reference_sequence_dictionary samv16) of + Nothing -> + "" + Just sqf -> + intercalate "\n" $ + map (\x -> intercalate "\t" $ + Prelude.filter (not . Prelude.null) + [ "@SQ" + , sam_v1_6_reference_sequence_dictionary_reference_sequence_name_tos x + , sam_v1_6_reference_sequence_dictionary_reference_sequence_length_tos x + , sam_v1_6_reference_sequence_dictionary_alternative_locus_tos x + , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names_tos x + , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_tos x + , sam_v1_6_reference_sequence_dictionary_description_tos x + , sam_v1_6_reference_sequence_dictionary_md5_checksum_tos x + , sam_v1_6_reference_sequence_dictionary_species_tos x + , sam_v1_6_reference_sequence_dictionary_molecule_topology_tos x + , sam_v1_6_reference_sequence_dictionary_uri_tos x + ] + ) (toList sqf) + sam_v1_6_read_group_identifer_tos x = "ID:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_identifier_value $ + sam_v1_6_read_group_identifier x + ) + sam_v1_6_read_group_barcode_sequence_tos x = case (sam_v1_6_read_group_barcode_sequence x) of + Nothing -> + "" + Just rgf -> + "BC:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_barcode_sequence_value rgf + ) + sam_v1_6_read_group_sequencing_center_tos x = case (sam_v1_6_read_group_sequencing_center x) of + Nothing -> + "" + Just rgf -> + "CN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_sequencing_center_value rgf + ) + sam_v1_6_read_group_description_tos x = case (sam_v1_6_read_group_description x) of + Nothing -> + "" + Just rgf -> + "DS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_description_value rgf + ) + sam_v1_6_read_group_run_date_tos x = case (sam_v1_6_read_group_run_date x) of + Nothing -> + "" + Just rgf -> + "DT:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_run_date_value rgf + ) + sam_v1_6_read_group_flow_order_tos x = case (sam_v1_6_read_group_flow_order x) of + Nothing -> + "" + Just rgf -> + "FO:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_flow_order_value rgf + ) + sam_v1_6_read_group_key_sequence_tos x = case (sam_v1_6_read_group_key_sequence x) of + Nothing -> + "" + Just rgf -> + "KS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_key_sequence_value rgf + ) + sam_v1_6_read_group_library_tos x = case (sam_v1_6_read_group_library x) of + Nothing -> + "" + Just rgf -> + "LB:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_library_value rgf + ) + sam_v1_6_read_group_programs_tos x = case (sam_v1_6_read_group_programs x) of + Nothing -> + "" + Just rgf -> + "PG:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_programs_value rgf + ) + sam_v1_6_read_group_predicted_median_insert_size_tos x = case (sam_v1_6_read_group_predicted_median_insert_size x) of + Nothing -> + "" + Just rgf -> + "PI:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_predicted_median_insert_size_value rgf + ) + sam_v1_6_read_group_platform_tos x = case (sam_v1_6_read_group_platform x) of + Nothing -> + "" + Just rgf -> + "PL:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_platform_value rgf + ) + sam_v1_6_read_group_platform_model_tos x = case (sam_v1_6_read_group_platform_model x) of + Nothing -> + "" + Just rgf -> + "PM:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_platform_model_value rgf + ) + sam_v1_6_read_group_platform_unit_tos x = case (sam_v1_6_read_group_platform_unit x) of + Nothing -> + "" + Just rgf -> + "PU:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_platform_unit_value rgf + ) + sam_v1_6_read_group_sample_tos x = case (sam_v1_6_read_group_sample x) of + Nothing -> + "" + Just rgf -> + "SM:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_read_group_sample_value rgf + ) + sam_v1_6_read_group_tos = case (sam_v1_6_read_group samv16) of + Nothing -> + "" + Just rgf -> + intercalate "\n" $ + map (\x -> intercalate "\t" $ + Prelude.filter (not . Prelude.null) + [ "@RG" + , sam_v1_6_read_group_identifer_tos x + , sam_v1_6_read_group_barcode_sequence_tos x + , sam_v1_6_read_group_sequencing_center_tos x + , sam_v1_6_read_group_description_tos x + , sam_v1_6_read_group_run_date_tos x + , sam_v1_6_read_group_flow_order_tos x + , sam_v1_6_read_group_key_sequence_tos x + , sam_v1_6_read_group_library_tos x + , sam_v1_6_read_group_programs_tos x + , sam_v1_6_read_group_predicted_median_insert_size_tos x + , sam_v1_6_read_group_platform_tos x + , sam_v1_6_read_group_platform_model_tos x + , sam_v1_6_read_group_platform_unit_tos x + , sam_v1_6_read_group_sample_tos x + ] + ) (toList rgf) + sam_v1_6_program_record_identifier_tos x = "ID:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_record_identifier_value $ + sam_v1_6_program_record_identifier x + ) + sam_v1_6_program_name_tos x = case (sam_v1_6_program_name x) of + Nothing -> + "" + Just rgf -> + "PN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_name_value rgf + ) + sam_v1_6_program_command_line_tos x = case (sam_v1_6_program_command_line x) of + Nothing -> + "" + Just rgf -> + "CL:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_command_line_value rgf + ) + sam_v1_6_program_previous_pg_id_tos x = case (sam_v1_6_program_previous_pg_id x) of + Nothing -> + "" + Just rgf -> + "PP:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_previous_pg_id_value rgf + ) + sam_v1_6_program_description_tos x = case (sam_v1_6_program_description x) of + Nothing -> + "" + Just rgf -> + "DS:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_description_value rgf + ) + sam_v1_6_program_version_tos x = case (sam_v1_6_program_version x) of + Nothing -> + "" + Just rgf -> + "VN:" ++ + ( unpack $ + fromStrict $ + sam_v1_6_program_version_value rgf + ) + sam_v1_6_program_tos = case (sam_v1_6_program samv16) of + Nothing -> + "" + Just pgf -> + intercalate "\t" $ + Prelude.filter (not . Prelude.null) + [ "@PG" + , sam_v1_6_program_record_identifier_tos pgf + , sam_v1_6_program_name_tos pgf + , sam_v1_6_program_command_line_tos pgf + , sam_v1_6_program_previous_pg_id_tos pgf + , sam_v1_6_program_description_tos pgf + , sam_v1_6_program_version_tos pgf + ] + sam_v1_6_one_line_comment_tos = case (sam_v1_6_one_line_comment samv16) of + Nothing -> + "" + Just cof -> + intercalate "\n" $ + map (\x -> intercalate "\t" $ + Prelude.filter (not . Prelude.null) + [ "@CO" + , unpack $ + fromStrict $ + sam_v1_6_one_line_comment_value x + ] + ) (toList cof) + sam_v1_6_alignment_tos = intercalate "\n" $ + map (\x -> case (Prelude.null $ sam_v1_6_alignment_opts x) of + True -> + sam_v1_6_alignment_mand x + False -> + intercalate "\t" + [ sam_v1_6_alignment_mand x + , sam_v1_6_alignment_opts x + ] + ) ( toList $ + sam_v1_6_alignment samv16 + ) + sam_v1_6_alignment_mand x = intercalate "\t" $ + Prelude.filter (not . Prelude.null) + [ unpack $ fromStrict $ sam_v1_6_alignment_qname x + , show $ sam_v1_6_alignment_flag x + , unpack $ fromStrict $ sam_v1_6_alignment_rname x + , show $ sam_v1_6_alignment_pos x + , show $ sam_v1_6_alignment_mapq x + , unpack $ fromStrict $ sam_v1_6_alignment_cigar x + , unpack $ fromStrict $ sam_v1_6_alignment_rnext x + , show $ sam_v1_6_alignment_pnext x + , show $ sam_v1_6_alignment_tlen x + , unpack $ fromStrict $ sam_v1_6_alignment_seq x + , unpack $ fromStrict $ sam_v1_6_alignment_qual x + ] + --sam_v1_6_alignment_opts x = intercalate "\t" $ + -- Prelude.filter (not . Prelude.null) + -- [ sam_v1_6_alignment_aopt_d x + -- , sam_v1_6_alignment_iopt_d x + -- , sam_v1_6_alignment_fopt_d x + -- , sam_v1_6_alignment_zopt_d x + -- , sam_v1_6_alignment_hopt_d x + -- , sam_v1_6_alignment_bopt_d x + -- ] + sam_v1_6_alignment_opts x = case (sam_v1_6_alignment_optionalfields x) of + Nothing -> + "" + Just optionalfields -> + concat $ forM (toList optionalfields) $ \currentoptionalfield -> + intercalate "\t" $ + Prelude.filter (not . Prelude.null) + [ case (sam_v1_6_alignment_optionalfields_aopt currentoptionalfield) of + Nothing -> + "" + Just aopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_aopt_tag aopt + ) + ++ + ":A:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_aopt_value aopt + ) + , case (sam_v1_6_alignment_optionalfields_iopt currentoptionalfield) of + Nothing -> + "" + Just iopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_iopt_tag iopt + ) + ++ + ":i:" + ++ + ( show $ + sam_v1_6_alignment_optionalfields_iopt_value iopt + ) + , case (sam_v1_6_alignment_optionalfields_fopt currentoptionalfield) of + Nothing -> + "" + Just fopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_fopt_tag fopt + ) + ++ + ":f:" + ++ + ( show $ + sam_v1_6_alignment_optionalfields_fopt_value fopt + ) + , case (sam_v1_6_alignment_optionalfields_zopt currentoptionalfield) of + Nothing -> + "" + Just zopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_zopt_tag zopt + ) + ++ + ":Z:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_zopt_value zopt + ) + , case (sam_v1_6_alignment_optionalfields_hopt currentoptionalfield) of + Nothing -> + "" + Just hopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_hopt_tag hopt + ) + ++ + ":H:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_optionalfields_hopt_value hopt + ) + , case (sam_v1_6_alignment_optionalfields_bopt currentoptionalfield) of + Nothing -> + "" + Just bopt -> + concat $ + Prelude.filter (not . Prelude.null) + [ case (sam_v1_6_alignment_optionalfields_bopt_int8 bopt) of + Nothing -> + "" + Just bopt_int8 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_int8_tag bopt_int8 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_optionalfields_bopt_int8_type bopt_int8 + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_int8_value bopt_int8 + ) + , case (sam_v1_6_alignment_optionalfields_bopt_word8 bopt) of + Nothing -> + "" + Just bopt_word8 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_word8_tag bopt_word8 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_optionalfields_bopt_word8_type bopt_word8 + ) ++ + "," ++ + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_word8_value bopt_word8 + ) + , case (sam_v1_6_alignment_optionalfields_bopt_int16 bopt) of + Nothing -> + "" + Just bopt_int16 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_int16_tag bopt_int16 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_optionalfields_bopt_int16_type bopt_int16 + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_int16_value bopt_int16 + ) + , case (sam_v1_6_alignment_optionalfields_bopt_word16 bopt) of + Nothing -> + "" + Just bopt_word16 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_word16_tag bopt_word16 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_optionalfields_bopt_word16_type bopt_word16 + ) ++ + "," ++ + ( concat $ + map encodeWord16 $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_word16_value bopt_word16 + ) + , case (sam_v1_6_alignment_optionalfields_bopt_int32 bopt) of + Nothing -> + "" + Just bopt_int32 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_int32_tag bopt_int32 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_optionalfields_bopt_int32_type bopt_int32 + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_int32_value bopt_int32 + ) + , case (sam_v1_6_alignment_optionalfields_bopt_word32 bopt) of + Nothing -> + "" + Just bopt_word32 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_word32_tag bopt_word32 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_optionalfields_bopt_word32_type bopt_word32 + ) ++ + "," ++ + ( concat $ + map encodeWord32 $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_word32_value bopt_word32 + ) + , case (sam_v1_6_alignment_optionalfields_bopt_float bopt) of + Nothing -> + "" + Just bopt_float -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_float_tag bopt_float + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_optionalfields_bopt_float_type bopt_float + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_optionalfields_bopt_float_value bopt_float + ) + ] + ] + +{- + sam_v1_6_alignment_aopt_d x = ( unpack $ + fromStrict $ + sam_v1_6_alignment_aopt_tag aopt + ) + ++ + ":A:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_aopt_value aopt + ) + sam_v1_6_alignment_iopt_d x = case (sam_v1_6_alignment_iopt x) of + Nothing -> + "" + Just iopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_iopt_tag iopt + ) + ++ + ":i:" + ++ + ( show $ + sam_v1_6_alignment_iopt_value iopt + ) + sam_v1_6_alignment_fopt_d x = case (sam_v1_6_alignment_fopt x) of + Nothing -> + "" + Just fopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_fopt_tag fopt + ) + ++ + ":f:" + ++ + ( show $ + sam_v1_6_alignment_fopt_value fopt + ) + sam_v1_6_alignment_zopt_d x = case (sam_v1_6_alignment_zopt x) of + Nothing -> + "" + Just zopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_zopt_tag zopt + ) + ++ + ":Z:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_zopt_value zopt + ) + sam_v1_6_alignment_hopt_d x = case (sam_v1_6_alignment_hopt x) of + Nothing -> + "" + Just hopt -> + ( unpack $ + fromStrict $ + sam_v1_6_alignment_hopt_tag hopt + ) + ++ + ":H:" + ++ + ( unpack $ + fromStrict $ + sam_v1_6_alignment_hopt_value hopt + ) + sam_v1_6_alignment_bopt_d x = case (sam_v1_6_alignment_bopt x) of + Nothing -> + "" + Just bopt -> + concat $ + Prelude.filter (not . Prelude.null) + [ sam_v1_6_alignment_bopt_int8_d bopt + , sam_v1_6_alignment_bopt_word8_d bopt + , sam_v1_6_alignment_bopt_int16_d bopt + , sam_v1_6_alignment_bopt_word16_d bopt + , sam_v1_6_alignment_bopt_int32_d bopt + , sam_v1_6_alignment_bopt_word32_d bopt + , sam_v1_6_alignment_bopt_float_d bopt + ] + sam_v1_6_alignment_bopt_int8_d x = case (sam_v1_6_alignment_bopt_int8 x) of + Nothing -> + "" + Just bopt_int8 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_int8_tag bopt_int8 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_bopt_int8_type bopt_int8 + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_bopt_int8_value bopt_int8 + ) + sam_v1_6_alignment_bopt_word8_d x = case (sam_v1_6_alignment_bopt_word8 x) of + Nothing -> + "" + Just bopt_word8 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_word8_tag bopt_word8 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_bopt_word8_type bopt_word8 + ) ++ + "," ++ + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_word8_value bopt_word8 + ) + sam_v1_6_alignment_bopt_int16_d x = case (sam_v1_6_alignment_bopt_int16 x) of + Nothing -> + "" + Just bopt_int16 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_int16_tag bopt_int16 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_bopt_int16_type bopt_int16 + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_bopt_int16_value bopt_int16 + ) + sam_v1_6_alignment_bopt_word16_d x = case (sam_v1_6_alignment_bopt_word16 x) of + Nothing -> + "" + Just bopt_word16 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_word16_tag bopt_word16 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_bopt_word16_type bopt_word16 + ) ++ + "," ++ + ( concat $ + map encodeWord16 $ + toList $ + sam_v1_6_alignment_bopt_word16_value bopt_word16 + ) + sam_v1_6_alignment_bopt_int32_d x = case (sam_v1_6_alignment_bopt_int32 x) of + Nothing -> + "" + Just bopt_int32 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_int32_tag bopt_int32 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_bopt_int32_type bopt_int32 + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_bopt_int32_value bopt_int32 + ) + sam_v1_6_alignment_bopt_word32_d x = case (sam_v1_6_alignment_bopt_word32 x) of + Nothing -> + "" + Just bopt_word32 -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_word32_tag bopt_word32 + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_bopt_word32_type bopt_word32 + ) ++ + "," ++ + ( concat $ + map encodeWord32 $ + toList $ + sam_v1_6_alignment_bopt_word32_value bopt_word32 + ) + sam_v1_6_alignment_bopt_float_d x = case (sam_v1_6_alignment_bopt_float x) of + Nothing -> + "" + Just bopt_float -> + ( unpack $ + fromStrict $ + pack $ + toList $ + sam_v1_6_alignment_bopt_float_tag bopt_float + ) ++ + ":" ++ + "B" ++ + ":" ++ + ( unpack $ + fromStrict $ + DB.singleton $ + sam_v1_6_alignment_bopt_float_type bopt_float + ) ++ + "," ++ + ( concat $ + map show $ + toList $ + sam_v1_6_alignment_bopt_float_value bopt_float + ) +-} + encodeWord16 :: Word16 + -> [Char] + encodeWord16 = unpack . + DBL.filter (\x -> x /= 0) . + toLazyByteString . + word16LE + encodeWord32 :: Word32 + -> [Char] + encodeWord32 = unpack . + DBL.filter (\x -> x /= 0) . + toLazyByteString . + word32LE -- | Write @"SAM_V1_6"@ to a file. -- Calls deconstructSAM_V1_6. diff --git a/test/Main.hs b/test/Main.hs --- a/test/Main.hs +++ b/test/Main.hs @@ -1,62 +1,47 @@ module Main (main) where -import Data.SAM.Version1_6.Base -import Data.SAM.Version1_6.Alignment -import Data.SAM.Version1_6.Alignment.IOPT -import Data.SAM.Version1_6.Alignment.ZOPT -import Data.SAM.Version1_6.Alignment.BOPT -import Data.SAM.Version1_6.Header +import Data.BAM.Version1_6.Read.Base +import Data.BAM.Version1_6.Write.Base import Data.SAM.Version1_6.Read.Base +import Data.SAM.Version1_6.Write.Base -import Data.Sequence (fromList) -import Data.String (fromString) import Test.Hspec -import Data.SAM.Version1_6.Write.Base main :: IO () -main = hspec $ do - describe "Data.SAM.Version1_6.Read.Base" $ do - describe "readSAM_V1_6" $ do - describe "toy5.sam" $ do - it "Ensures that readSAM_V1_6 can read and parse a SAM file with only alignment fields." $ do - readSAM_V1_6 "test/examples/toy5.sam" `shouldReturn` toy5sam - describe "toy4.sam" $ do - it "Ensures that readSAM_V1_6 can read and parse a SAM file with an optional alignment field." $ do - readSAM_V1_6 "test/examples/toy4.sam" `shouldReturn` toy4sam - describe "toy2.sam" $ do - it "Ensures that readSAM_V1_6 can read and parse a SAM file with file-level metadata (@HD) and reference sequence dictionary (@SQ) optional header fields." $ do - readSAM_V1_6 "test/examples/toy2.sam" `shouldReturn` toy2sam - describe "toy1.sam" $ do - it "Ensures that readSAM_V1_6 can read and parse a SAM file with multiple reference sequence dictionary (@SQ) optional header fields." $ do - readSAM_V1_6 "test/examples/toy1.sam" `shouldReturn` toy1sam - describe "Data.SAM.Version1_6.Write.Base" $ do - describe "writeSAM_V1_6" $ do - describe "toy5.sam" $ do - it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do - toy5 <- readSAM_V1_6 "test/examples/toy5.sam" - writeSAM_V1_6 "test/examples/toy5f.sam" toy5 - toy5f <- readSAM_V1_6 "test/examples/toy5f.sam" - toy5 `shouldBe` toy5f - describe "toy4.sam" $ do - it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do - toy4 <- readSAM_V1_6 "test/examples/toy4.sam" - writeSAM_V1_6 "test/examples/toy4f.sam" toy4 - toy4f <- readSAM_V1_6 "test/examples/toy4f.sam" - toy4 `shouldBe` toy4f - describe "toy2.sam" $ do - it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do - toy2 <- readSAM_V1_6 "test/examples/toy2.sam" - writeSAM_V1_6 "test/examples/toy2f.sam" toy2 - toy2f <- readSAM_V1_6 "test/examples/toy2f.sam" - toy2 `shouldBe` toy2f - describe "toy1.sam" $ do - it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do - toy1 <- readSAM_V1_6 "test/examples/toy1.sam" - writeSAM_V1_6 "test/examples/toy1f.sam" toy1 - toy1f <- readSAM_V1_6 "test/examples/toy1f.sam" - toy1 `shouldBe` toy1f - where - toy1sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing },SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref2" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "40" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } - toy2sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Just SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version = SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value = fromString "1.6" } , sam_v1_6_file_level_metadata_sorting_order = Just SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value = fromString "coordinate" } , sam_v1_6_file_level_metadata_alignment_grouping = Nothing , sam_v1_6_file_level_metadata_subsorting_order = Nothing } , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }]) , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 99 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M2I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "3S6M1P1I4M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGATA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5S6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "GCCTAAGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = fromString "SA" , sam_v1_6_alignment_zopt_value = fromString "ref,29,-,6H5M,17,0;" } , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 2064 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 17 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just SAM_V1_6_Alignment_ZOPT { sam_v1_6_alignment_zopt_tag = fromString "SA" , sam_v1_6_alignment_zopt_value = fromString "ref,9,+,5S6M,30,1;" } , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 147 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGGCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Just SAM_V1_6_Alignment_IOPT { sam_v1_6_alignment_iopt_tag = fromString "NM" , sam_v1_6_alignment_iopt_value = 1 } , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } - toy4sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Nothing , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } - toy5sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing , sam_v1_6_reference_sequence_dictionary = Nothing , sam_v1_6_read_group = Nothing , sam_v1_6_program = Nothing , sam_v1_6_one_line_comment = Nothing , sam_v1_6_alignment = fromList [SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing }] } +main = + hspec $ do + describe "Data.SAM.Version1_6.Write.Base" $ do + describe "writeSAM_V1_6" $ do + describe "SAM/toy5.sam" $ do + it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do + toy5 <- readSAM_V1_6 "test/examples/SAM/toy5.sam" + writeSAM_V1_6 "test/examples/SAM/toy5f.sam" toy5 + toy5f <- readSAM_V1_6 "test/examples/SAM/toy5f.sam" + toy5 `shouldBe` toy5f + describe "SAM/toy4.sam" $ do + it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do + toy4 <- readSAM_V1_6 "test/examples/SAM/toy4.sam" + writeSAM_V1_6 "test/examples/SAM/toy4f.sam" toy4 + toy4f <- readSAM_V1_6 "test/examples/SAM/toy4f.sam" + toy4 `shouldBe` toy4f + describe "SAM/toy2.sam" $ do + it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do + toy2 <- readSAM_V1_6 "test/examples/SAM/toy2.sam" + writeSAM_V1_6 "test/examples/SAM/toy2f.sam" toy2 + toy2f <- readSAM_V1_6 "test/examples/SAM/toy2f.sam" + toy2 `shouldBe` toy2f + describe "SAM/toy1.sam" $ do + it "Ensures writeSAM_V1_6 produces the a sam file equivalent to what was parsed via readSAM_V1_6." $ do + toy1 <- readSAM_V1_6 "test/examples/SAM/toy1.sam" + writeSAM_V1_6 "test/examples/SAM/toy1f.sam" toy1 + toy1f <- readSAM_V1_6 "test/examples/SAM/toy1f.sam" + toy1 `shouldBe` toy1f + describe "Data.BAM.Version1_6.Write.Base" $ do + describe "WriteBAM_V1_6" $ do + describe "BAM/ex1ff_sorted.bam" $ do + it "Ensures writeBAM_V1_6 produces a bam file equivalent to what was parsed via readBAM_V1_6." $ do + _ <- readBAM_V1_6 "test/examples/BAM/ex1ff_sorted.bam" >>= writeBAM_V1_6 "test/examples/BAM/ex1ff_sortedf.bam" + bamv16f <- readBAM_V1_6 "test/examples/BAM/ex1ff_sortedf.bam" + _ <- writeBAM_V1_6 "test/examples/BAM/ex1ff_sortedff.bam" bamv16f + bamv16ff <- readBAM_V1_6 "test/examples/BAM/ex1ff_sortedff.bam" + bamv16f `shouldBe` bamv16ff