packages feed

hs-samtools 0.6.0.1 → 0.7.0.0

raw patch · 57 files changed

+817/−544 lines, 57 filesdep +parser-combinatorsdep ~bytestringdep ~containersdep ~hspecPVP ok

version bump matches the API change (PVP)

Dependencies added: parser-combinators

Dependency ranges changed: bytestring, containers, hspec

API changes (from Hackage documentation)

- Data.SAM.Version1_6.Read.Parser.Header.PG.CL: parse_SAM_V1_6_SAM_V1_6_Program_CL :: Parser SAM_V1_6_Program_Command_Line
- Data.SAM.Version1_6.Read.Parser.Header.PG.DS: parse_SAM_V1_6_SAM_V1_6_Program_DS :: Parser SAM_V1_6_Program_Description
- Data.SAM.Version1_6.Read.Parser.Header.PG.ID: parse_SAM_V1_6_SAM_V1_6_Program_ID :: Parser SAM_V1_6_Program_Record_Identifier
- Data.SAM.Version1_6.Read.Parser.Header.PG.PN: parse_SAM_V1_6_SAM_V1_6_Program_PN :: Parser SAM_V1_6_Program_Name
- Data.SAM.Version1_6.Read.Parser.Header.PG.PP: parse_SAM_V1_6_SAM_V1_6_Program_PP :: Parser SAM_V1_6_Program_Previous_PG_ID
- Data.SAM.Version1_6.Read.Parser.Header.PG.VN: parse_SAM_V1_6_SAM_V1_6_Program_VN :: Parser SAM_V1_6_Program_Version
- Data.SAM.Version1_6.Read.Parser.Header.RG.BC: parse_SAM_V1_6_SAM_V1_6_Read_Group_BC :: Parser SAM_V1_6_Read_Group_Barcode_Sequence
- Data.SAM.Version1_6.Read.Parser.Header.RG.CN: parse_SAM_V1_6_SAM_V1_6_Read_Group_CN :: Parser SAM_V1_6_Read_Group_Sequencing_Center
- Data.SAM.Version1_6.Read.Parser.Header.RG.DS: parse_SAM_V1_6_SAM_V1_6_Read_Group_DS :: Parser SAM_V1_6_Read_Group_Description
- Data.SAM.Version1_6.Read.Parser.Header.RG.DT: parse_SAM_V1_6_SAM_V1_6_Read_Group_DT :: Parser SAM_V1_6_Read_Group_Run_Date
- Data.SAM.Version1_6.Read.Parser.Header.RG.FO: parse_SAM_V1_6_SAM_V1_6_Read_Group_FO :: Parser SAM_V1_6_Read_Group_Flow_Order
- Data.SAM.Version1_6.Read.Parser.Header.RG.ID: parse_SAM_V1_6_SAM_V1_6_Read_Group_ID :: Parser SAM_V1_6_Read_Group_Identifier
- Data.SAM.Version1_6.Read.Parser.Header.RG.KS: parse_SAM_V1_6_SAM_V1_6_Read_Group_KS :: Parser SAM_V1_6_Read_Group_Key_Sequence
- Data.SAM.Version1_6.Read.Parser.Header.RG.LB: parse_SAM_V1_6_SAM_V1_6_Read_Group_LB :: Parser SAM_V1_6_Read_Group_Library
- Data.SAM.Version1_6.Read.Parser.Header.RG.PG: parse_SAM_V1_6_SAM_V1_6_Read_Group_PG :: Parser SAM_V1_6_Read_Group_Programs
- Data.SAM.Version1_6.Read.Parser.Header.RG.PI: parse_SAM_V1_6_SAM_V1_6_Read_Group_PI :: Parser SAM_V1_6_Read_Group_Predicted_Median_Insert_Size
- Data.SAM.Version1_6.Read.Parser.Header.RG.PL: parse_SAM_V1_6_SAM_V1_6_Read_Group_PL :: Parser SAM_V1_6_Read_Group_Platform
- Data.SAM.Version1_6.Read.Parser.Header.RG.PM: parse_SAM_V1_6_SAM_V1_6_Read_Group_PM :: Parser SAM_V1_6_Read_Group_Platform_Model
- Data.SAM.Version1_6.Read.Parser.Header.RG.PU: parse_SAM_V1_6_SAM_V1_6_Read_Group_PU :: Parser SAM_V1_6_Read_Group_Platform_Unit
- Data.SAM.Version1_6.Read.Parser.Header.RG.SM: parse_SAM_V1_6_SAM_V1_6_Read_Group_SM :: Parser SAM_V1_6_Read_Group_Sample
- Data.SAM.Version1_6.Read.Parser.Header.SQ.AH: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AH :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus
- Data.SAM.Version1_6.Read.Parser.Header.SQ.AN: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names
- Data.SAM.Version1_6.Read.Parser.Header.SQ.AS: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier
- Data.SAM.Version1_6.Read.Parser.Header.SQ.DS: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_DS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Description
- Data.SAM.Version1_6.Read.Parser.Header.SQ.LN: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_LN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length
- Data.SAM.Version1_6.Read.Parser.Header.SQ.M5: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_M5 :: Parser SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum
- Data.SAM.Version1_6.Read.Parser.Header.SQ.SN: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name
- Data.SAM.Version1_6.Read.Parser.Header.SQ.SP: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Species
- Data.SAM.Version1_6.Read.Parser.Header.SQ.TP: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_TP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology
- Data.SAM.Version1_6.Read.Parser.Header.SQ.UR: parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_UR :: Parser SAM_V1_6_Reference_Sequence_Dictionary_URI
+ Data.SAM.Version1_6.Alignment.BOPT: instance GHC.Classes.Eq Data.SAM.Version1_6.Alignment.BOPT.SAM_V1_6_Alignment_BOPT
+ Data.SAM.Version1_6.Alignment.Base: instance GHC.Classes.Eq Data.SAM.Version1_6.Alignment.Base.SAM_V1_6_Alignment
+ Data.SAM.Version1_6.Base: instance GHC.Classes.Eq Data.SAM.Version1_6.Base.SAM_V1_6
+ Data.SAM.Version1_6.Header.HD: instance GHC.Classes.Eq Data.SAM.Version1_6.Header.HD.SAM_V1_6_File_Level_Metadata
+ Data.SAM.Version1_6.Header.PG: instance GHC.Classes.Eq Data.SAM.Version1_6.Header.PG.SAM_V1_6_Program
+ Data.SAM.Version1_6.Header.RG: instance GHC.Classes.Eq Data.SAM.Version1_6.Header.RG.SAM_V1_6_Read_Group
+ Data.SAM.Version1_6.Header.SQ: instance GHC.Classes.Eq Data.SAM.Version1_6.Header.SQ.SAM_V1_6_Reference_Sequence_Dictionary
+ Data.SAM.Version1_6.Read.Parser.Header.PG.CL: parse_SAM_V1_6_Program_CL :: Parser SAM_V1_6_Program_Command_Line
+ Data.SAM.Version1_6.Read.Parser.Header.PG.DS: parse_SAM_V1_6_Program_DS :: Parser SAM_V1_6_Program_Description
+ Data.SAM.Version1_6.Read.Parser.Header.PG.ID: parse_SAM_V1_6_Program_ID :: Parser SAM_V1_6_Program_Record_Identifier
+ Data.SAM.Version1_6.Read.Parser.Header.PG.PN: parse_SAM_V1_6_Program_PN :: Parser SAM_V1_6_Program_Name
+ Data.SAM.Version1_6.Read.Parser.Header.PG.PP: parse_SAM_V1_6_Program_PP :: Parser SAM_V1_6_Program_Previous_PG_ID
+ Data.SAM.Version1_6.Read.Parser.Header.PG.VN: parse_SAM_V1_6_Program_VN :: Parser SAM_V1_6_Program_Version
+ Data.SAM.Version1_6.Read.Parser.Header.RG.BC: parse_SAM_V1_6_Read_Group_BC :: Parser SAM_V1_6_Read_Group_Barcode_Sequence
+ Data.SAM.Version1_6.Read.Parser.Header.RG.CN: parse_SAM_V1_6_Read_Group_CN :: Parser SAM_V1_6_Read_Group_Sequencing_Center
+ Data.SAM.Version1_6.Read.Parser.Header.RG.DS: parse_SAM_V1_6_Read_Group_DS :: Parser SAM_V1_6_Read_Group_Description
+ Data.SAM.Version1_6.Read.Parser.Header.RG.DT: parse_SAM_V1_6_Read_Group_DT :: Parser SAM_V1_6_Read_Group_Run_Date
+ Data.SAM.Version1_6.Read.Parser.Header.RG.FO: parse_SAM_V1_6_Read_Group_FO :: Parser SAM_V1_6_Read_Group_Flow_Order
+ Data.SAM.Version1_6.Read.Parser.Header.RG.ID: parse_SAM_V1_6_Read_Group_ID :: Parser SAM_V1_6_Read_Group_Identifier
+ Data.SAM.Version1_6.Read.Parser.Header.RG.KS: parse_SAM_V1_6_Read_Group_KS :: Parser SAM_V1_6_Read_Group_Key_Sequence
+ Data.SAM.Version1_6.Read.Parser.Header.RG.LB: parse_SAM_V1_6_Read_Group_LB :: Parser SAM_V1_6_Read_Group_Library
+ Data.SAM.Version1_6.Read.Parser.Header.RG.PG: parse_SAM_V1_6_Read_Group_PG :: Parser SAM_V1_6_Read_Group_Programs
+ Data.SAM.Version1_6.Read.Parser.Header.RG.PI: parse_SAM_V1_6_Read_Group_PI :: Parser SAM_V1_6_Read_Group_Predicted_Median_Insert_Size
+ Data.SAM.Version1_6.Read.Parser.Header.RG.PL: parse_SAM_V1_6_Read_Group_PL :: Parser SAM_V1_6_Read_Group_Platform
+ Data.SAM.Version1_6.Read.Parser.Header.RG.PM: parse_SAM_V1_6_Read_Group_PM :: Parser SAM_V1_6_Read_Group_Platform_Model
+ Data.SAM.Version1_6.Read.Parser.Header.RG.PU: parse_SAM_V1_6_Read_Group_PU :: Parser SAM_V1_6_Read_Group_Platform_Unit
+ Data.SAM.Version1_6.Read.Parser.Header.RG.SM: parse_SAM_V1_6_Read_Group_SM :: Parser SAM_V1_6_Read_Group_Sample
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.AH: parse_SAM_V1_6_Reference_Sequence_Dictionary_AH :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.AN: parse_SAM_V1_6_Reference_Sequence_Dictionary_AN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.AS: parse_SAM_V1_6_Reference_Sequence_Dictionary_AS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.DS: parse_SAM_V1_6_Reference_Sequence_Dictionary_DS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Description
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.LN: parse_SAM_V1_6_Reference_Sequence_Dictionary_LN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.M5: parse_SAM_V1_6_Reference_Sequence_Dictionary_M5 :: Parser SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.SN: parse_SAM_V1_6_Reference_Sequence_Dictionary_SN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.SP: parse_SAM_V1_6_Reference_Sequence_Dictionary_SP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Species
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.TP: parse_SAM_V1_6_Reference_Sequence_Dictionary_TP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology
+ Data.SAM.Version1_6.Read.Parser.Header.SQ.UR: parse_SAM_V1_6_Reference_Sequence_Dictionary_UR :: Parser SAM_V1_6_Reference_Sequence_Dictionary_URI

Files

CHANGELOG.md view
@@ -76,3 +76,9 @@ ## 0.6.0.1 -- 2023-09-04  * Fixed documentation for readSAM_V1_6.++## 0.7.0.0 -- 2023-10-16++* Fixed broken parsing of SAM_V1_6(..).+* Strengthened parsing of SAM_V1_6(..) by accurately emulating the sam v1.6 specification through use of permutable parsers.+* Added initial test suite.
hs-samtools.cabal view
@@ -20,7 +20,7 @@ -- PVP summary:     +-+------- breaking API changes --                  | | +----- non-breaking API additions --                  | | | +--- code changes with no API change-version:            0.6.0.1+version:            0.7.0.0  -- A short (one-line) description of the package. synopsis: Read and write SAM, BAM, and CRAM files.@@ -131,7 +131,7 @@     -- other-extensions:      -- Other library packages from which modules are imported.-    build-depends:    base                 ^>=4.17.1.0,+    build-depends:    base                 ^>=4.17.1.0,                        ascii                >= 1.7.0 && < 1.8,                       attoparsec           >= 0.14.4 && < 0.15,                       bitvec               >= 1.1.4 && < 1.2,@@ -139,6 +139,7 @@                       containers           >= 0.6.7 && < 0.7,                       crypton              >= 0.33 && < 0.34,                       generic-deriving     >= 1.14.5 && < 1.15,+                      parser-combinators   >= 1.3.0 && < 1.4,                       pcre-heavy           >= 1.0.0 && < 1.1,                       regex-tdfa           >= 1.3.2 && < 1.4,                       streamly             >= 0.9.0 && < 0.10,@@ -174,7 +175,8 @@     main-is:          Main.hs      -- Test dependencies.-    build-depends:-        base ^>=4.17.1.0,-        hspec == 2.11.4,-        hs-samtools+    build-depends: base ^>=4.17.1.0,+                   bytestring,+                   containers,+                   hspec,+                   hs-samtools
src/Data/SAM/Version1_6/Alignment/BOPT.hs view
@@ -69,6 +69,27 @@                                                        }   deriving (Generic,Typeable) +instance Eq SAM_V1_6_Alignment_BOPT where+  SAM_V1_6_Alignment_BOPT sam_v1_6_alignment_bopt_int81+                          sam_v1_6_alignment_bopt_word81+                          sam_v1_6_alignment_bopt_int161+                          sam_v1_6_alignment_bopt_word161+                          sam_v1_6_alignment_bopt_int321+                          sam_v1_6_alignment_bopt_word321+                          sam_v1_6_alignment_bopt_float1 == SAM_V1_6_Alignment_BOPT sam_v1_6_alignment_bopt_int82+                                                                                    sam_v1_6_alignment_bopt_word82+                                                                                    sam_v1_6_alignment_bopt_int162+                                                                                    sam_v1_6_alignment_bopt_word162+                                                                                    sam_v1_6_alignment_bopt_int322+                                                                                    sam_v1_6_alignment_bopt_word322+                                                                                    sam_v1_6_alignment_bopt_float2 = sam_v1_6_alignment_bopt_int81   == sam_v1_6_alignment_bopt_int82   &&+                                                                                                                     sam_v1_6_alignment_bopt_word81  == sam_v1_6_alignment_bopt_word82  &&+                                                                                                                     sam_v1_6_alignment_bopt_int161  == sam_v1_6_alignment_bopt_int162  &&+                                                                                                                     sam_v1_6_alignment_bopt_word161 == sam_v1_6_alignment_bopt_word162 &&+                                                                                                                     sam_v1_6_alignment_bopt_int321  == sam_v1_6_alignment_bopt_int322  &&+                                                                                                                     sam_v1_6_alignment_bopt_word321 == sam_v1_6_alignment_bopt_word322 &&+                                                                                                                     sam_v1_6_alignment_bopt_float1  == sam_v1_6_alignment_bopt_float2+ instance Show SAM_V1_6_Alignment_BOPT where   show (SAM_V1_6_Alignment_BOPT int8                                 word8
src/Data/SAM/Version1_6/Alignment/Base.hs view
@@ -111,6 +111,57 @@                                              }   deriving (Generic,Typeable) +instance Eq SAM_V1_6_Alignment where+  SAM_V1_6_Alignment sam_v1_6_alignment_qname1+                     sam_v1_6_alignment_flag1+                     sam_v1_6_alignment_rname1+                     sam_v1_6_alignment_pos1+                     sam_v1_6_alignment_mapq1+                     sam_v1_6_alignment_cigar1+                     sam_v1_6_alignment_rnext1+                     sam_v1_6_alignment_pnext1+                     sam_v1_6_alignment_tlen1+                     sam_v1_6_alignment_seq1+                     sam_v1_6_alignment_qual1+                     sam_v1_6_alignment_aopt1+                     sam_v1_6_alignment_iopt1+                     sam_v1_6_alignment_fopt1+                     sam_v1_6_alignment_zopt1+                     sam_v1_6_alignment_hopt1+                     sam_v1_6_alignment_bopt1 == SAM_V1_6_Alignment sam_v1_6_alignment_qname2+                                                                    sam_v1_6_alignment_flag2+                                                                    sam_v1_6_alignment_rname2+                                                                    sam_v1_6_alignment_pos2+                                                                    sam_v1_6_alignment_mapq2+                                                                    sam_v1_6_alignment_cigar2+                                                                    sam_v1_6_alignment_rnext2+                                                                    sam_v1_6_alignment_pnext2+                                                                    sam_v1_6_alignment_tlen2+                                                                    sam_v1_6_alignment_seq2+                                                                    sam_v1_6_alignment_qual2+                                                                    sam_v1_6_alignment_aopt2+                                                                    sam_v1_6_alignment_iopt2+                                                                    sam_v1_6_alignment_fopt2+                                                                    sam_v1_6_alignment_zopt2+                                                                    sam_v1_6_alignment_hopt2+                                                                    sam_v1_6_alignment_bopt2 = sam_v1_6_alignment_qname1 == sam_v1_6_alignment_qname2 &&  +                                                                                               sam_v1_6_alignment_flag1  == sam_v1_6_alignment_flag2  &&+                                                                                               sam_v1_6_alignment_rname1 == sam_v1_6_alignment_rname2 &&+                                                                                               sam_v1_6_alignment_pos1   == sam_v1_6_alignment_pos2   &&+                                                                                               sam_v1_6_alignment_mapq1  == sam_v1_6_alignment_mapq2  &&+                                                                                               sam_v1_6_alignment_cigar1 == sam_v1_6_alignment_cigar2 &&+                                                                                               sam_v1_6_alignment_rnext1 == sam_v1_6_alignment_rnext2 &&+                                                                                               sam_v1_6_alignment_pnext1 == sam_v1_6_alignment_pnext2 &&+                                                                                               sam_v1_6_alignment_tlen1  == sam_v1_6_alignment_tlen2  &&+                                                                                               sam_v1_6_alignment_seq1   == sam_v1_6_alignment_seq2   &&+                                                                                               sam_v1_6_alignment_qual1  == sam_v1_6_alignment_qual2  &&+                                                                                               sam_v1_6_alignment_aopt1  == sam_v1_6_alignment_aopt2  &&+                                                                                               sam_v1_6_alignment_iopt1  == sam_v1_6_alignment_iopt2  &&+                                                                                               sam_v1_6_alignment_fopt1  == sam_v1_6_alignment_fopt2  &&+                                                                                               sam_v1_6_alignment_zopt1  == sam_v1_6_alignment_zopt2  &&+                                                                                               sam_v1_6_alignment_hopt1  == sam_v1_6_alignment_hopt2  &&+                                                                                               sam_v1_6_alignment_bopt1  == sam_v1_6_alignment_bopt2+ instance Show SAM_V1_6_Alignment where   show (SAM_V1_6_Alignment qname flag rname pos mapq cigar rnext pnext tlen seq qual aopt iopt fopt zopt hopt bopt) =     "SAM_V1_6_Alignment { " ++
src/Data/SAM/Version1_6/Base.hs view
@@ -57,6 +57,24 @@                          }   deriving (Generic,Typeable) +instance Eq SAM_V1_6 where+  SAM_V1_6 sam_v1_6_file_level_metadata1+           sam_v1_6_reference_sequence_dictionary1+           sam_v1_6_read_group1+           sam_v1_6_program1+           sam_v1_6_one_line_comment1+           sam_v1_6_alignment1 == SAM_V1_6 sam_v1_6_file_level_metadata2+                                           sam_v1_6_reference_sequence_dictionary2+                                           sam_v1_6_read_group2+                                           sam_v1_6_program2+                                           sam_v1_6_one_line_comment2+                                           sam_v1_6_alignment2 = sam_v1_6_file_level_metadata1           == sam_v1_6_file_level_metadata2           &&+                                                                 sam_v1_6_reference_sequence_dictionary1 == sam_v1_6_reference_sequence_dictionary2 &&+                                                                 sam_v1_6_read_group1                    == sam_v1_6_read_group2                    &&+                                                                 sam_v1_6_program1                       == sam_v1_6_program2                       &&+                                                                 sam_v1_6_one_line_comment1              == sam_v1_6_one_line_comment2              &&+                                                                 sam_v1_6_alignment1                     == sam_v1_6_alignment2+ instance Show SAM_V1_6 where   show (SAM_V1_6 file_level_metadata                  reference_sequence_dictionary
src/Data/SAM/Version1_6/Header/HD.hs view
@@ -45,6 +45,18 @@                                                                  }    deriving (Generic,Typeable) +instance Eq SAM_V1_6_File_Level_Metadata where+  SAM_V1_6_File_Level_Metadata sam_v1_6_file_level_metadata_format_version1+                               sam_v1_6_file_level_metadata_sorting_order1+                               sam_v1_6_file_level_metadata_alignment_grouping1+                               sam_v1_6_file_level_metadata_subsorting_order1 == SAM_V1_6_File_Level_Metadata sam_v1_6_file_level_metadata_format_version2+                                                                                                              sam_v1_6_file_level_metadata_sorting_order2+                                                                                                              sam_v1_6_file_level_metadata_alignment_grouping2+                                                                                                              sam_v1_6_file_level_metadata_subsorting_order2 = sam_v1_6_file_level_metadata_format_version1     == sam_v1_6_file_level_metadata_format_version2     &&+                                                                                                                                                               sam_v1_6_file_level_metadata_sorting_order1      == sam_v1_6_file_level_metadata_sorting_order2      &&+                                                                                                                                                               sam_v1_6_file_level_metadata_alignment_grouping1 == sam_v1_6_file_level_metadata_alignment_grouping2 &&+                                                                                                                                                               sam_v1_6_file_level_metadata_subsorting_order1   == sam_v1_6_file_level_metadata_subsorting_order2+ instance Show SAM_V1_6_File_Level_Metadata where   show (SAM_V1_6_File_Level_Metadata version sorting_order alignment_grouping subsorting_order) =     "SAM_V1_6_File_Level_Metadata { " ++
src/Data/SAM/Version1_6/Header/PG.hs view
@@ -49,6 +49,24 @@                                          }   deriving (Generic,Typeable) +instance Eq SAM_V1_6_Program where+  SAM_V1_6_Program sam_v1_6_program_record_identifier1+                   sam_v1_6_program_name1+                   sam_v1_6_program_command_line1+                   sam_v1_6_program_previous_pg_id1+                   sam_v1_6_program_description1+                   sam_v1_6_program_version1 == SAM_V1_6_Program sam_v1_6_program_record_identifier2+                                                                 sam_v1_6_program_name2+                                                                 sam_v1_6_program_command_line2+                                                                 sam_v1_6_program_previous_pg_id2+                                                                 sam_v1_6_program_description2+                                                                 sam_v1_6_program_version2 = sam_v1_6_program_record_identifier1 == sam_v1_6_program_record_identifier2 &&+                                                                                             sam_v1_6_program_name1              == sam_v1_6_program_name2              &&+                                                                                             sam_v1_6_program_command_line1      == sam_v1_6_program_command_line2      &&+                                                                                             sam_v1_6_program_previous_pg_id1    == sam_v1_6_program_previous_pg_id2    &&+                                                                                             sam_v1_6_program_description1       == sam_v1_6_program_description2       &&+                                                                                             sam_v1_6_program_version1           == sam_v1_6_program_version2+ instance Show SAM_V1_6_Program where   show (SAM_V1_6_Program record_identifier name command_line previous_pg_id description version) =     "SAM_V1_6_Program { "    ++
src/Data/SAM/Version1_6/Header/RG.hs view
@@ -64,6 +64,48 @@                                                , sam_v1_6_read_group_sample                       :: Maybe SAM_V1_6_Read_Group_Sample                                                } +instance Eq SAM_V1_6_Read_Group where+  SAM_V1_6_Read_Group sam_v1_6_read_group_identifier1+                      sam_v1_6_read_group_barcode_sequence1+                      sam_v1_6_read_group_sequencing_center1+                      sam_v1_6_read_group_description1+                      sam_v1_6_read_group_run_date1+                      sam_v1_6_read_group_flow_order1+                      sam_v1_6_read_group_key_sequence1+                      sam_v1_6_read_group_library1+                      sam_v1_6_read_group_programs1+                      sam_v1_6_read_group_predicted_median_insert_size1+                      sam_v1_6_read_group_platform1+                      sam_v1_6_read_group_platform_model1+                      sam_v1_6_read_group_platform_unit1+                      sam_v1_6_read_group_sample1 == SAM_V1_6_Read_Group sam_v1_6_read_group_identifier2+                                                                         sam_v1_6_read_group_barcode_sequence2+                                                                         sam_v1_6_read_group_sequencing_center2+                                                                         sam_v1_6_read_group_description2+                                                                         sam_v1_6_read_group_run_date2+                                                                         sam_v1_6_read_group_flow_order2+                                                                         sam_v1_6_read_group_key_sequence2+                                                                         sam_v1_6_read_group_library2+                                                                         sam_v1_6_read_group_programs2+                                                                         sam_v1_6_read_group_predicted_median_insert_size2+                                                                         sam_v1_6_read_group_platform2+                                                                         sam_v1_6_read_group_platform_model2+                                                                         sam_v1_6_read_group_platform_unit2+                                                                         sam_v1_6_read_group_sample2 = sam_v1_6_read_group_identifier1                    == sam_v1_6_read_group_identifier2                    &&+                                                                                                       sam_v1_6_read_group_barcode_sequence1             == sam_v1_6_read_group_barcode_sequence2             &&+                                                                                                       sam_v1_6_read_group_sequencing_center1            == sam_v1_6_read_group_sequencing_center2            &&+                                                                                                       sam_v1_6_read_group_description1                  == sam_v1_6_read_group_description2                  &&+                                                                                                       sam_v1_6_read_group_run_date1                     == sam_v1_6_read_group_run_date2                     &&+                                                                                                       sam_v1_6_read_group_flow_order1                   == sam_v1_6_read_group_flow_order2                   &&+                                                                                                       sam_v1_6_read_group_key_sequence1                 == sam_v1_6_read_group_key_sequence2                 &&+                                                                                                       sam_v1_6_read_group_library1                      == sam_v1_6_read_group_library2                      &&+                                                                                                       sam_v1_6_read_group_programs1                     == sam_v1_6_read_group_programs2                     &&+                                                                                                       sam_v1_6_read_group_predicted_median_insert_size1 == sam_v1_6_read_group_predicted_median_insert_size2 &&+                                                                                                       sam_v1_6_read_group_platform1                     == sam_v1_6_read_group_platform2                     &&+                                                                                                       sam_v1_6_read_group_platform_model1               == sam_v1_6_read_group_platform_model2               &&+                                                                                                       sam_v1_6_read_group_platform_unit1                == sam_v1_6_read_group_platform_unit2                &&+                                                                                                       sam_v1_6_read_group_sample1                       == sam_v1_6_read_group_sample2+ instance Show SAM_V1_6_Read_Group where   show (SAM_V1_6_Read_Group group_identifier                             barcode_sequence
src/Data/SAM/Version1_6/Header/SQ.hs view
@@ -57,6 +57,36 @@                                                                                      }   deriving (Generic,Typeable) +instance Eq SAM_V1_6_Reference_Sequence_Dictionary where+  SAM_V1_6_Reference_Sequence_Dictionary sam_v1_6_reference_sequence_dictionary_reference_sequence_name1+                                         sam_v1_6_reference_sequence_dictionary_reference_sequence_length1+                                         sam_v1_6_reference_sequence_dictionary_reference_alternative_locus1+                                         sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names1+                                         sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier1+                                         sam_v1_6_reference_sequence_dictionary_description1+                                         sam_v1_6_reference_sequence_dictionary_md5_checksum1+                                         sam_v1_6_reference_sequence_dictionary_species1+                                         sam_v1_6_reference_sequence_dictionary_molecule_topology1+                                         sam_v1_6_reference_sequence_dictionary_uri1 == SAM_V1_6_Reference_Sequence_Dictionary sam_v1_6_reference_sequence_dictionary_reference_sequence_name2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_reference_sequence_length2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_reference_alternative_locus2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_description2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_md5_checksum2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_species2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_molecule_topology2+                                                                                                                               sam_v1_6_reference_sequence_dictionary_uri2 = sam_v1_6_reference_sequence_dictionary_reference_sequence_name1                        == sam_v1_6_reference_sequence_dictionary_reference_sequence_name2                        &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_reference_sequence_length1                      == sam_v1_6_reference_sequence_dictionary_reference_sequence_length2                      &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_reference_alternative_locus1                    == sam_v1_6_reference_sequence_dictionary_reference_alternative_locus2                    &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names1 == sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names2 &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier1                     == sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier2                     &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_description1                                    == sam_v1_6_reference_sequence_dictionary_description2                                    &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_md5_checksum1                                   == sam_v1_6_reference_sequence_dictionary_md5_checksum2                                   &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_species1                                        == sam_v1_6_reference_sequence_dictionary_species2                                        &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_molecule_topology1                              == sam_v1_6_reference_sequence_dictionary_molecule_topology2                              &&+                                                                                                                                                                             sam_v1_6_reference_sequence_dictionary_uri1                                            == sam_v1_6_reference_sequence_dictionary_uri2+ instance Show SAM_V1_6_Reference_Sequence_Dictionary where   show (SAM_V1_6_Reference_Sequence_Dictionary reference_sequence_name                                                reference_sequence_length
src/Data/SAM/Version1_6/Read/Base.hs view
@@ -1,16 +1,7 @@-{-# LANGUAGE DeriveDataTypeable    #-}-{-# LANGUAGE DeriveGeneric         #-} {-# LANGUAGE FlexibleContexts      #-} {-# LANGUAGE FlexibleInstances     #-} {-# LANGUAGE MultiParamTypeClasses #-}-{-# LANGUAGE OverloadedLists       #-}-{-# LANGUAGE OverloadedStrings     #-}-{-# LANGUAGE MultiWayIf            #-}-{-# LANGUAGE PackageImports        #-}-{-# LANGUAGE RecordWildCards       #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-}-{-# Language QuasiQuotes           #-}  -- | -- Module      :  Data.SAM.Version1_6.Read.Base@@ -35,12 +26,13 @@ import Data.SAM.Version1_6.Read.Parser.Header.CO.Base import Data.SAM.Version1_6.Read.Parser.Alignment.Base -import Data.Attoparsec.ByteString.Char8  as DABC8+import Control.Applicative.Permutations                          (intercalateEffect,toPermutationWithDefault)+import Data.Attoparsec.ByteString.Char8  as DABC8                (endOfLine) import Data.Attoparsec.ByteString.Lazy   as DABL import Data.ByteString.Lazy              as DBL import Data.Sequence                     as DSeq import qualified Streamly.Data.Stream    as S-import Streamly.External.ByteString.Lazy as StreamlyLByteString (fromChunksIO)+import Streamly.External.ByteString.Lazy as StreamlyLByteString  (fromChunksIO) import Streamly.Internal.FileSystem.File as StreamlyInternalFile (chunkReader)  -- | Make a parser optional, return Nothing if there is no match.@@ -51,36 +43,68 @@ -- | Define the @"SAM_V1_6"@ parser. parse_SAM_V1_6 :: Parser SAM_V1_6 parse_SAM_V1_6 = do-  filelevelmetadata           <- maybeOption $ parse_SAM_V1_6_File_Level_Metadata <* endOfLine-  _                           <- word8 10-  referencesequencedictionary <- maybeOption $ DABL.many' $ parse_SAM_V1_6_Reference_Sequence_Dictionary <* endOfLine-  _                           <- word8 10-  readgroup                   <- maybeOption $ DABL.many' $ parse_SAM_V1_6_Read_Group <* endOfLine-  _                           <- word8 10-  program                     <- maybeOption $ parse_SAM_V1_6_Program <* endOfLine-  _                           <- word8 10-  onelinecomment              <- maybeOption $ DABL.many' $ parse_SAM_V1_6_One_Line_Comment <* endOfLine -  _                           <- word8 10-  alignment                   <- DABL.many' $ parse_SAM_V1_6_Alignment <* endOfLine-  return SAM_V1_6 { sam_v1_6_file_level_metadata           = filelevelmetadata-                  , sam_v1_6_reference_sequence_dictionary = case referencesequencedictionary of-                                                               Nothing                           -> Nothing-                                                               Just referencesequencedictionaryf -> Just $ DSeq.fromList referencesequencedictionaryf-                  , sam_v1_6_read_group                    = case readgroup of-                                                               Nothing         -> Nothing-                                                               Just readgroupf -> Just $ DSeq.fromList readgroupf-                  , sam_v1_6_program                       = program-                  , sam_v1_6_one_line_comment              = case onelinecomment of-                                                               Nothing              -> Nothing-                                                               Just onelinecommentf -> Just $ DSeq.fromList onelinecommentf-                  , sam_v1_6_alignment                     = DSeq.fromList alignment-                  } +  filelevelmetadata <- maybeOption parse_SAM_V1_6_File_Level_Metadata+  case filelevelmetadata of+    Nothing  -> do samwoalignment <- intercalateEffect endOfLine $+                                       (,,,)+                                         <$> toPermutationWithDefault Nothing+                                                                      (Just <$> DABL.many1' parse_SAM_V1_6_Reference_Sequence_Dictionary)+                                         <*> toPermutationWithDefault Nothing+                                                                      (Just <$> DABL.many1' parse_SAM_V1_6_Read_Group)+                                         <*> toPermutationWithDefault Nothing+                                                                      (Just <$> parse_SAM_V1_6_Program)+                                         <*> toPermutationWithDefault Nothing+                                                                      (Just <$> DABL.many1' parse_SAM_V1_6_One_Line_Comment)+                   alignment <- DABL.many1' parse_SAM_V1_6_Alignment+                   return SAM_V1_6 { sam_v1_6_file_level_metadata           = Nothing+                                   , sam_v1_6_reference_sequence_dictionary = (\(a,_,_,_) -> case a of+                                                                                               Nothing      -> Nothing+                                                                                               Just finala  -> Just $ DSeq.fromList finala+                                                                              ) samwoalignment+                                   , sam_v1_6_read_group                    = (\(_,b,_,_) -> case b of+                                                                                               Nothing      -> Nothing+                                                                                               Just finalb  -> Just $ DSeq.fromList finalb+                                                                              ) samwoalignment+                                   , sam_v1_6_program                       = (\(_,_,c,_) -> c) samwoalignment+                                   , sam_v1_6_one_line_comment              = (\(_,_,_,d) -> case d of+                                                                                               Nothing      -> Nothing+                                                                                               Just finald  -> Just $ DSeq.fromList finald+                                                                              ) samwoalignment+                                   , sam_v1_6_alignment                     = DSeq.fromList alignment+                                   }+    Just flm -> do samwoalignment <- intercalateEffect endOfLine $+                                       (,,,)+                                         <$> toPermutationWithDefault Nothing+                                                                      (Just <$> DABL.many1' parse_SAM_V1_6_Reference_Sequence_Dictionary)+                                         <*> toPermutationWithDefault Nothing+                                                                      (Just <$> DABL.many1' parse_SAM_V1_6_Read_Group)+                                         <*> toPermutationWithDefault Nothing+                                                                      (Just <$> parse_SAM_V1_6_Program)+                                         <*> toPermutationWithDefault Nothing+                                                                      (Just <$> DABL.many1' parse_SAM_V1_6_One_Line_Comment)+                   alignment <- DABL.many1' parse_SAM_V1_6_Alignment+                   return SAM_V1_6 { sam_v1_6_file_level_metadata           = Just flm+                                   , sam_v1_6_reference_sequence_dictionary = (\(a,_,_,_) -> case a of+                                                                                               Nothing      -> Nothing+                                                                                               Just finala  -> Just $ DSeq.fromList finala+                                                                              ) samwoalignment+                                   , sam_v1_6_read_group                    = (\(_,b,_,_) -> case b of+                                                                                               Nothing      -> Nothing+                                                                                               Just finalb  -> Just $ DSeq.fromList finalb+                                                                              ) samwoalignment+                                   , sam_v1_6_program                       = (\(_,_,c,_) -> c) samwoalignment+                                   , sam_v1_6_one_line_comment              = (\(_,_,_,d) -> case d of+                                                                                               Nothing      -> Nothing+                                                                                               Just finald  -> Just $ DSeq.fromList finald+                                                                              ) samwoalignment+                                   , sam_v1_6_alignment                     = DSeq.fromList alignment+                                   }  -- | Run the @"SAM_V1_6"@ parser. readSAM_V1_6_LBS :: DBL.ByteString                  -> IO SAM_V1_6 readSAM_V1_6_LBS lbs =-  case (DABL.parseOnly parse_SAM_V1_6 lbs) of+  case (DABL.parseOnly parse_SAM_V1_6 lbs) of      Left  samparseerror -> error samparseerror     Right sam           -> return sam 
src/Data/SAM/Version1_6/Read/Parser/Alignment/AOPT.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# Language QuasiQuotes           #-} @@ -46,6 +45,7 @@  import Data.SAM.Version1_6.Read.Error +import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL import qualified Data.ByteString                   as DB import           Text.Regex.PCRE.Heavy@@ -57,19 +57,19 @@ parse_SAM_V1_6_Alignment_AOPT = do   _ <- do alignmentaoptfieldtagp <- DABL.takeTill (== 58)           -- Parse AOPT tag of the alignment section.-          case (alignmentaoptfieldtagp =~ [re|/[A-Za-z][A-Za-z0-9]/|]) of+          case (alignmentaoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Tag_Incorrect_Format             True  -> -- AOPT tag is in the accepted format. -                     return alignmentaoptfieldtagp+                     return ()   _ <- word8 58   _ <- do alignmentaoptfieldtypep <- DABL.takeTill (== 58)           -- Parse AOPT type of the alignment section.           case (alignmentaoptfieldtypep =~ [re|[A]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Type_Incorrect_Format             True  -> -- AOPT type is in the accepted format.-                     return alignmentaoptfieldtypep+                     return ()   _ <- word8 58-  alignmentaoptfieldvalue <- do alignmentaoptfieldvaluep <- DABL.takeTill (== 09)+  alignmentaoptfieldvalue <- do alignmentaoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                 -- Parse AOPT value of the alignment section.                                 case (alignmentaoptfieldvaluep =~ [re|[!-~]|]) of                                   False -> fail $ show SAM_V1_6_Error_Alignment_AOPT_Value_Incorrect_Format
src/Data/SAM/Version1_6/Read/Parser/Alignment/BOPT.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# Language QuasiQuotes           #-} @@ -47,6 +46,7 @@ import Data.SAM.Version1_6.Alignment.BOPT import Data.SAM.Version1_6.Read.Error +import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL import qualified Data.ByteString                   as DB (head,unpack) import qualified Data.ByteString.Char8             as DBC8@@ -60,7 +60,7 @@ parse_SAM_V1_6_Alignment_BOPT = do   alignmentboptfieldtag <- do alignmentboptfieldtagp <- DABL.takeTill (== 58)                               -- Parse BOPT tag of the alignment section.-                              case (alignmentboptfieldtagp =~ [re|/[A-Za-z][A-Za-z0-9]/|]) of+                              case (alignmentboptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of                                 False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Tag_Incorrect_Format                                 True  -> -- BOPT tag is in the accepted format.                                           return alignmentboptfieldtagp@@ -70,7 +70,7 @@           case (alignmentboptfieldtypep =~ [re|[B]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Type_Incorrect_Format             True  -> -- BOPT type is in the accepted format.-                     return alignmentboptfieldtypep+                     return ()   _ <- word8 58   alignmentboptfieldvaluetype <- do alignmentboptfieldvaluetypep <- DABL.take 1                                     -- Parse BOPT value type of the alignment section.@@ -78,9 +78,10 @@                                       False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Value_Type_Incorrect_Format                                       True  -> -- BOPT value type is in the accepted format.                                                return alignmentboptfieldvaluetypep-  alignmentboptfieldvaluedata <- do alignmentboptfieldvaluedatap <- DABL.takeTill (\x -> x == 09 || x == 0x0D || x == 0x0A)+  _ <- word8 44+  alignmentboptfieldvaluedata <- do alignmentboptfieldvaluedatap <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                     -- Parse BOPT value data of the alignment section.-                                    case (alignmentboptfieldvaluedatap =~ [re|(,[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of+                                    case (alignmentboptfieldvaluedatap =~ [re|([-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?)*|]) of                                       False -> fail $ show SAM_V1_6_Error_Alignment_BOPT_Value_Data_Incorrect_Format                                       True  -> -- BOPT value data is in the accepted format.                                                return alignmentboptfieldvaluedatap@@ -169,4 +170,4 @@                                           , sam_v1_6_alignment_bopt_int32  = Nothing                                           , sam_v1_6_alignment_bopt_word32 = Nothing                                           , sam_v1_6_alignment_bopt_float  = Nothing-                                          } +                                          }
src/Data/SAM/Version1_6/Read/Parser/Alignment/Base.hs view
@@ -8,7 +8,6 @@ {-# LANGUAGE MultiWayIf                  #-} {-# LANGUAGE PackageImports              #-} {-# LANGUAGE RecordWildCards             #-}-{-# LANGUAGE TemplateHaskell             #-} {-# LANGUAGE TypeFamilies                #-} {-# Language QuasiQuotes                 #-} {-# OPTIONS_GHC -fno-warn-name-shadowing #-}@@ -53,15 +52,12 @@ import Data.SAM.Version1_6.Read.Parser.Alignment.HOPT import Data.SAM.Version1_6.Read.Parser.Alignment.BOPT +import           Control.Applicative.Permutations           (intercalateEffect,toPermutationWithDefault)+import           Data.Attoparsec.ByteString.Char8  as DABC8 (endOfLine,isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL import qualified Data.ByteString.Char8             as DBC8 import           Text.Regex.PCRE.Heavy --- | Make a parser optional, return Nothing if there is no match.-maybeOption :: Parser a-            -> Parser (Maybe a)-maybeOption p = option Nothing (Just <$> p)- -- | @"SAM_V1_6_Alignment"@ parser. -- -- Defines a parser for the alignment section of the SAM v1.6 file format.@@ -78,28 +74,28 @@   _ <- word8 09   flag <- do flagp <- DABL.takeTill (== 09)              -- Parse FLAG field of alignment section.-             case (flagp =~ [re|[0-9]*|]) of+             case (flagp =~ [re|[0-9]+|]) of                False -> fail $ show SAM_V1_6_Error_Alignment_FLAG_Incorrect_Format                True  -> -- FLAG is in the accepted format.                         return flagp   _ <- word8 09   rname <- do rnamep <- DABL.takeTill (== 09)               -- Parse RNAME field of alignment section.-              case (rnamep =~ [re|\*|[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*|]) of+              case (rnamep =~ [re|\*|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*|]) of                 False -> fail $ show SAM_V1_6_Error_Alignment_RNAME_Incorrect_Format                  True  -> -- RNAME is in the accepted format.                          return rnamep   _ <- word8 09   pos <- do posp <- DABL.takeTill (== 09)             -- Parse POS field of the alignment section.-            case (posp =~ [re|[0-9]*|]) of+            case (posp =~ [re|[0-9]+|]) of               False -> fail $ show SAM_V1_6_Error_Alignment_POS_Incorrect_Format               True  -> -- POS is in the accepted format.                        return posp   _ <- word8 09   mapq <- do mapqp <- DABL.takeTill (== 09)              -- Parse MAPQ field of the alignment section.-             case (mapqp =~ [re|[0-9]*|]) of+             case (mapqp =~ [re|[0-9]+|]) of                False -> fail $ show SAM_V1_6_Error_Alignment_MAPQ_Incorrect_Format                True  -> -- MAPQ is in the accepted format.                         return mapqp@@ -113,21 +109,21 @@   _ <- word8 09   rnext <- do rnextp <- DABL.takeTill (== 09)               -- Parse RNEXT field of the alignment section.-              case (rnextp =~ [re|\*|=|[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*|]) of+              case (rnextp =~ [re|\*|=|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*|]) of                 False -> fail $ show SAM_V1_6_Error_Alignment_RNEXT_Incorrect_Format                 True  -> -- RNEXT is in the accepted format.                          return rnextp   _ <- word8 09   pnext <- do pnextp <- DABL.takeTill (== 09)               -- Parse PNEXT field of the alignment section.-              case (pnextp =~ [re|[0-9]*|]) of+              case (pnextp =~ [re|[0-9]+|]) of                 False -> fail $ show SAM_V1_6_Error_Alignment_PNEXT_Incorrect_Format                 True  -> -- PNEXT is in the accepted format.                          return pnextp   _ <- word8 09   tlen <- do tlenp <- DABL.takeTill (== 09)              -- Parse TLEN field of the alignment section.-             case (tlenp =~ [re|[-]?[0-9]*|]) of+             case (tlenp =~ [re|[-]?[0-9]+|]) of                False -> fail $ show SAM_V1_6_Error_Alignment_TLEN_Incorrect_Format                 True  -> -- TLEN is in the accepted format.                         return tlenp@@ -139,53 +135,89 @@               True  -> -- SEQ is in the accepted format.                        return seqp   _ <- word8 09-  qual <- do qualp <- DABL.takeTill (== 09)+  qual <- do qualp <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)              -- Parse QUAL field of the alignment section.              case (qualp =~ [re|[!-~?]+|\*|]) of                False -> fail $ show SAM_V1_6_Error_Alignment_QUAL_Incorrect_Format                True  -> -- QUAL is in the accepted format.-                        return qualp-  _ <- word8 09-  -- This parser assumes that the AOPT tag always appears first,-  -- followed by IOPT, FOPT, ZOPT, HOPT, and BOPT, if they exist,-  -- in that order.-  aopt <- maybeOption parse_SAM_V1_6_Alignment_AOPT-  _    <- word8 09-  iopt <- maybeOption parse_SAM_V1_6_Alignment_IOPT-  _    <- word8 09-  fopt <- maybeOption parse_SAM_V1_6_Alignment_FOPT-  _    <- word8 09-  zopt <- maybeOption parse_SAM_V1_6_Alignment_ZOPT-  _    <- word8 09-  hopt <- maybeOption parse_SAM_V1_6_Alignment_HOPT-  _    <- word8 09-  bopt <- maybeOption parse_SAM_V1_6_Alignment_BOPT-  -- Return the parsed SAM_V1_6.-  return SAM_V1_6_Alignment { sam_v1_6_alignment_qname  = qname-                            , sam_v1_6_alignment_flag   = case (DBC8.readInt flag) of-                                                            Nothing          -> (-1)-                                                            Just (flagint,_) -> flagint-                            , sam_v1_6_alignment_rname = rname-                            , sam_v1_6_alignment_pos   = case (DBC8.readInteger pos) of-                                                           Nothing             -> 0-                                                           Just (posinteger,_) -> posinteger-                            , sam_v1_6_alignment_mapq  = case (DBC8.readInt mapq) of-                                                           Nothing          -> 255-                                                           Just (mapqint,_) -> mapqint-                            , sam_v1_6_alignment_cigar = cigar-                            , sam_v1_6_alignment_rnext = rnext-                            , sam_v1_6_alignment_pnext = case (DBC8.readInteger pnext) of-                                                           Nothing               -> 0-                                                           Just (pnextinteger,_) -> pnextinteger-                            , sam_v1_6_alignment_tlen  = case (DBC8.readInteger tlen) of-                                                           Nothing              -> 0-                                                           Just (tleninteger,_) -> tleninteger-                            , sam_v1_6_alignment_seq   = seq-                            , sam_v1_6_alignment_qual  = qual-                            , sam_v1_6_alignment_aopt  = aopt-                            , sam_v1_6_alignment_iopt  = iopt-                            , sam_v1_6_alignment_fopt  = fopt-                            , sam_v1_6_alignment_zopt  = zopt-                            , sam_v1_6_alignment_hopt  = hopt-                            , sam_v1_6_alignment_bopt  = bopt-                            }+                        return qualp +  optfields <- peekWord8+  case optfields of+    Just 10 -> do -- Return the parsed SAM_V1_6.+                  _ <- endOfLine+                  return SAM_V1_6_Alignment { sam_v1_6_alignment_qname  = qname+                                            , sam_v1_6_alignment_flag   = case (DBC8.readInt flag) of+                                                                            Nothing          -> (-1)+                                                                            Just (flagint,_) -> flagint+                                            , sam_v1_6_alignment_rname = rname+                                            , sam_v1_6_alignment_pos   = case (DBC8.readInteger pos) of+                                                                           Nothing             -> 0+                                                                           Just (posinteger,_) -> posinteger+                                            , sam_v1_6_alignment_mapq  = case (DBC8.readInt mapq) of+                                                                           Nothing          -> 255+                                                                           Just (mapqint,_) -> mapqint+                                            , sam_v1_6_alignment_cigar = cigar+                                            , sam_v1_6_alignment_rnext = rnext+                                            , sam_v1_6_alignment_pnext = case (DBC8.readInteger pnext) of+                                                                           Nothing               -> 0+                                                                           Just (pnextinteger,_) -> pnextinteger+                                            , sam_v1_6_alignment_tlen  = case (DBC8.readInteger tlen) of+                                                                           Nothing              -> 0+                                                                           Just (tleninteger,_) -> tleninteger+                                            , sam_v1_6_alignment_seq   = seq+                                            , sam_v1_6_alignment_qual  = qual+                                            , sam_v1_6_alignment_aopt  = Nothing+                                            , sam_v1_6_alignment_iopt  = Nothing+                                            , sam_v1_6_alignment_fopt  = Nothing+                                            , sam_v1_6_alignment_zopt  = Nothing+                                            , sam_v1_6_alignment_hopt  = Nothing+                                            , sam_v1_6_alignment_bopt  = Nothing+                                            }+    _       -> do -- This parser assumes that+                  -- the AOPT, IOPT, FOPT, ZOPT, HOPT, and BOPT+                  -- tags can appear in any order.+                  _ <- word8 09+                  optionalfields <- intercalateEffect (word8 09) $+                                      (,,,,,)+                                        <$> toPermutationWithDefault Nothing+                                                                     (Just <$> parse_SAM_V1_6_Alignment_AOPT)+                                        <*> toPermutationWithDefault Nothing+                                                                     (Just <$> parse_SAM_V1_6_Alignment_IOPT)+                                        <*> toPermutationWithDefault Nothing+                                                                     (Just <$> parse_SAM_V1_6_Alignment_FOPT)+                                        <*> toPermutationWithDefault Nothing+                                                                     (Just <$> parse_SAM_V1_6_Alignment_ZOPT)+                                        <*> toPermutationWithDefault Nothing+                                                                     (Just <$> parse_SAM_V1_6_Alignment_HOPT)+                                        <*> toPermutationWithDefault Nothing+                                                                     (Just <$> parse_SAM_V1_6_Alignment_BOPT)+                  _ <- endOfLine +                  -- Return the parsed SAM_V1_6.+                  return SAM_V1_6_Alignment { sam_v1_6_alignment_qname  = qname+                                            , sam_v1_6_alignment_flag   = case (DBC8.readInt flag) of+                                                                            Nothing          -> (-1)+                                                                            Just (flagint,_) -> flagint+                                            , sam_v1_6_alignment_rname = rname+                                            , sam_v1_6_alignment_pos   = case (DBC8.readInteger pos) of+                                                                           Nothing             -> 0+                                                                           Just (posinteger,_) -> posinteger+                                            , sam_v1_6_alignment_mapq  = case (DBC8.readInt mapq) of+                                                                           Nothing          -> 255+                                                                           Just (mapqint,_) -> mapqint+                                            , sam_v1_6_alignment_cigar = cigar+                                            , sam_v1_6_alignment_rnext = rnext+                                            , sam_v1_6_alignment_pnext = case (DBC8.readInteger pnext) of+                                                                           Nothing               -> 0+                                                                           Just (pnextinteger,_) -> pnextinteger+                                            , sam_v1_6_alignment_tlen  = case (DBC8.readInteger tlen) of+                                                                           Nothing              -> 0+                                                                           Just (tleninteger,_) -> tleninteger+                                            , sam_v1_6_alignment_seq   = seq+                                            , sam_v1_6_alignment_qual  = qual+                                            , sam_v1_6_alignment_aopt  = (\(a,_,_,_,_,_) -> a) optionalfields+                                            , sam_v1_6_alignment_iopt  = (\(_,i,_,_,_,_) -> i) optionalfields+                                            , sam_v1_6_alignment_fopt  = (\(_,_,f,_,_,_) -> f) optionalfields+                                            , sam_v1_6_alignment_zopt  = (\(_,_,_,z,_,_) -> z) optionalfields+                                            , sam_v1_6_alignment_hopt  = (\(_,_,_,_,h,_) -> h) optionalfields+                                            , sam_v1_6_alignment_bopt  = (\(_,_,_,_,_,b) -> b) optionalfields+                                            }
src/Data/SAM/Version1_6/Read/Parser/Alignment/FOPT.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# Language QuasiQuotes           #-} @@ -46,6 +45,7 @@  import Data.SAM.Version1_6.Read.Error +import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL import qualified Data.ByteString.Char8             as DBC8 import           Text.Regex.PCRE.Heavy@@ -57,19 +57,19 @@ parse_SAM_V1_6_Alignment_FOPT = do   _ <- do alignmentfoptfieldtagp <- DABL.takeTill (== 58)           -- Parse FOPT tag of the alignment section.-          case (alignmentfoptfieldtagp =~ [re|/[A-Za-z][A-Za-z0-9]/|]) of+          case (alignmentfoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Tag_Incorrect_Format             True  -> -- FOPT tag is in the accepted format. -                     return alignmentfoptfieldtagp+                     return ()   _ <- word8 58   _ <- do alignmentfoptfieldtypep <- DABL.takeTill (== 58)           -- Parse FOPT type of the alignment section.           case (alignmentfoptfieldtypep =~ [re|[f]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Type_Incorrect_Format             True  -> -- FOPT type is in the accepted format.-                     return alignmentfoptfieldtypep+                     return ()   _ <- word8 58-  alignmentfoptfieldvalue <- do alignmentfoptfieldvaluep <- DABL.takeTill (== 09)+  alignmentfoptfieldvalue <- do alignmentfoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                 -- Parse FOPT value of the alignment section.                                 case (alignmentfoptfieldvaluep =~ [re|[-+]?[0-9]*\.?[0-9]+([eE][-+]?[0-9]+)?|]) of                                   False -> fail $ show SAM_V1_6_Error_Alignment_FOPT_Value_Incorrect_Format
src/Data/SAM/Version1_6/Read/Parser/Alignment/HOPT.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# Language QuasiQuotes           #-} @@ -46,6 +45,7 @@  import Data.SAM.Version1_6.Read.Error +import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL import qualified Data.ByteString                   as DB import           Data.Sequence                     as DSeq@@ -59,19 +59,19 @@ parse_SAM_V1_6_Alignment_HOPT = do   _ <- do alignmenthoptfieldtagp <- DABL.takeTill (== 58)           -- Parse HOPT tag of the alignment section.-          case (alignmenthoptfieldtagp =~ [re|/[A-Za-z][A-Za-z0-9]/|]) of+          case (alignmenthoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Tag_Incorrect_Format             True  -> -- HOPT tag is in the accepted format. -                     return alignmenthoptfieldtagp+                     return ()   _ <- word8 58   _ <- do alignmenthoptfieldtypep <- DABL.takeTill (== 58)           -- Parse HOPT type of the alignment section.           case (alignmenthoptfieldtypep =~ [re|[H]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Type_Incorrect_Format             True  -> -- HOPT type is in the accepted format.-                     return alignmenthoptfieldtypep+                     return ()   _ <- word8 58-  alignmenthoptfieldvalue <- do alignmenthoptfieldvaluep <- DABL.takeTill (== 09)+  alignmenthoptfieldvalue <- do alignmenthoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                 -- Parse HOPT value of the alignment section.                                 case (alignmenthoptfieldvaluep =~ [re|([0-9A-F][0-9A-F])*|]) of                                   False -> fail $ show SAM_V1_6_Error_Alignment_HOPT_Value_Incorrect_Format
src/Data/SAM/Version1_6/Read/Parser/Alignment/IOPT.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# Language QuasiQuotes           #-} @@ -46,6 +45,7 @@  import Data.SAM.Version1_6.Read.Error +import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL import qualified Data.ByteString.Char8             as DBC8 import           Text.Regex.PCRE.Heavy@@ -57,19 +57,19 @@ parse_SAM_V1_6_Alignment_IOPT = do   _ <- do alignmentioptfieldtagp <- DABL.takeTill (== 58)           -- Parse IOPT tag of the alignment section.-          case (alignmentioptfieldtagp =~ [re|/[A-Za-z][A-Za-z0-9]/|]) of+          case (alignmentioptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Tag_Incorrect_Format             True  -> -- IOPT tag is in the accepted format. -                     return alignmentioptfieldtagp+                     return ()   _ <- word8 58   _ <- do alignmentioptfieldtypep <- DABL.takeTill (== 58)           -- Parse IOPT type of the alignment section.           case (alignmentioptfieldtypep =~ [re|[i]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Type_Incorrect_Format             True  -> -- IOPT type is in the accepted format.-                     return alignmentioptfieldtypep+                     return ()   _ <- word8 58-  alignmentioptfieldvalue <- do alignmentioptfieldvaluep <- DABL.takeTill (== 09)+  alignmentioptfieldvalue <- do alignmentioptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                 -- Parse IOPT value of the alignment section.                                 case (alignmentioptfieldvaluep =~ [re|[-+]?[0-9]+|]) of                                   False -> fail $ show SAM_V1_6_Error_Alignment_IOPT_Value_Incorrect_Format
src/Data/SAM/Version1_6/Read/Parser/Alignment/ZOPT.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# Language QuasiQuotes           #-} @@ -46,6 +45,7 @@  import Data.SAM.Version1_6.Read.Error +import           Data.Attoparsec.ByteString.Char8  as DABC8 (isEndOfLine) import           Data.Attoparsec.ByteString.Lazy   as DABL import qualified Data.ByteString                   as DB import           Text.Regex.PCRE.Heavy@@ -57,19 +57,19 @@ parse_SAM_V1_6_Alignment_ZOPT = do   _ <- do alignmentzoptfieldtagp <- DABL.takeTill (== 58)           -- Parse ZOPT tag of the alignment section.-          case (alignmentzoptfieldtagp =~ [re|/[A-Za-z][A-Za-z0-9]/|]) of+          case (alignmentzoptfieldtagp =~ [re|[A-Za-z][A-Za-z0-9]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Tag_Incorrect_Format             True  -> -- ZOPT tag is in the accepted format. -                     return alignmentzoptfieldtagp+                     return ()   _ <- word8 58   _ <- do alignmentzoptfieldtypep <- DABL.takeTill (== 58)           -- Parse ZOPT type of the alignment section.           case (alignmentzoptfieldtypep =~ [re|[Z]|]) of             False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Type_Incorrect_Format             True  -> -- ZOPT type is in the accepted format.-                     return alignmentzoptfieldtypep+                     return ()   _ <- word8 58-  alignmentzoptfieldvalue <- do alignmentzoptfieldvaluep <- DABL.takeTill (== 09)+  alignmentzoptfieldvalue <- do alignmentzoptfieldvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                 -- Parse ZOPT value of the alignment section.                                 case (alignmentzoptfieldvaluep =~ [re|[ !-~]*|]) of                                   False -> fail $ show SAM_V1_6_Error_Alignment_ZOPT_Value_Incorrect_Format
src/Data/SAM/Version1_6/Read/Parser/Header/CO/Base.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports              #-} {-# LANGUAGE RecordWildCards             #-} {-# LANGUAGE ScopedTypeVariables         #-}-{-# LANGUAGE TemplateHaskell             #-} {-# LANGUAGE TypeFamilies                #-} {-# LANGUAGE QuasiQuotes                 #-} {-# OPTIONS_GHC -fno-warn-name-shadowing #-}@@ -48,7 +47,7 @@ import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import Data.Attoparsec.ByteString.Char8  as DABC8+import Data.Attoparsec.ByteString.Char8  as DABC8 (endOfLine,isEndOfLine) import Data.Attoparsec.ByteString.Lazy   as DABL import Text.Regex.PCRE.Heavy @@ -64,8 +63,9 @@                   case (coheaderp =~ [re|[@][C][O]|]) of                     False -> fail $ show SAM_V1_6_Error_One_Line_Comment_Tag_Incorrect_Format                     True  -> -- @CO tag is in the accepted format.-                             return coheaderp+                             return ()   _         <- word8 09-  value     <- DABL.takeTill (\x -> x == 13 || x == 10)+  value     <- DABL.takeTill isEndOfLine+  _         <- endOfLine   return SAM_V1_6_One_Line_Comment { sam_v1_6_one_line_comment_value = value                                    }
src/Data/SAM/Version1_6/Read/Parser/Header/HD/Base.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -51,14 +50,11 @@ import Data.SAM.Version1_6.Read.Parser.Header.HD.GO import Data.SAM.Version1_6.Read.Parser.Header.HD.SS +import Control.Applicative.Permutations           (intercalateEffect,toPermutation,toPermutationWithDefault)+import Data.Attoparsec.ByteString.Char8  as DABC8 (endOfLine) import Data.Attoparsec.ByteString.Lazy   as DABL import Text.Regex.PCRE.Heavy --- | Make a parser optional, return Nothing if there is no match.-maybeOption :: Parser a-            -> Parser (Maybe a)-maybeOption p = option Nothing (Just <$> p)- -- | @"SAM_V1_6_File_Level_Metadata"@ parser. -- -- Defines a parser for @HD tag section of the SAM v1.6 file format.@@ -71,19 +67,18 @@                   case (hdheaderp =~ [re|[@][H][D]|]) of                     False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Tag_Incorrect_Format                     True  -> -- @HD tag is in the accepted format.-                             return hdheaderp+                             return ()    _         <- word8 09-  -- This parser assumes that the VN tag always appears first, followed by-  -- SO, GO and SS tags, if they exist, in that order.-  vn <- parse_SAM_V1_6_File_Level_Metadata_VN-  _  <- word8 09-  so <- maybeOption parse_SAM_V1_6_File_Level_Metadata_SO-  _  <- word8 09-  go <- maybeOption parse_SAM_V1_6_File_Level_Metadata_GO-  _  <- word8 09-  ss <- maybeOption parse_SAM_V1_6_File_Level_Metadata_SS-  return SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version     = vn-                                      , sam_v1_6_file_level_metadata_sorting_order      = so-                                      , sam_v1_6_file_level_metadata_alignment_grouping = go-                                      , sam_v1_6_file_level_metadata_subsorting_order   = ss-                                      }+  -- This parser assumes that the+  -- VN, SO, GO and SS tags can appear in any order.+  hd <- intercalateEffect (word8 09) $+          SAM_V1_6_File_Level_Metadata+            <$> toPermutation parse_SAM_V1_6_File_Level_Metadata_VN+            <*> toPermutationWithDefault Nothing +                                         (Just <$> parse_SAM_V1_6_File_Level_Metadata_SO)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_File_Level_Metadata_GO)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_File_Level_Metadata_SS)+  _ <- endOfLine+  return hd 
src/Data/SAM/Version1_6/Read/Parser/Header/HD/GO.hs view
@@ -47,8 +47,9 @@ import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the GO tag of the @HD tag section of the SAM v1.6 file format. --@@ -60,9 +61,9 @@           case (hdheaderalignmentgroupingtagp =~ [re|[G][O]|]) of             False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Grouping_Of_Alignments_Tag_Incorrect_Format             True  -> -- GO tag is in the accepted format.-                     return hdheaderalignmentgroupingtagp+                     return ()   _ <- word8 58-  hdheaderalignmentgroupingvalue <- do hdheaderalignmentgroupingvaluep <- DABL.takeTill (== 09)+  hdheaderalignmentgroupingvalue <- do hdheaderalignmentgroupingvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                        -- Parse GO value of the header section.                                        case (hdheaderalignmentgroupingvaluep =~ [re|[n][o][n][e]|[q][u][e][r][y]|[r][e][f][e][r][e][n][c][e]|]) of                                          False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Grouping_Of_Alignments_Invalid_Value
src/Data/SAM/Version1_6/Read/Parser/Header/HD/SO.hs view
@@ -47,8 +47,9 @@ import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the SO tag of the @HD tag section of the SAM v1.6 file format. --@@ -60,9 +61,9 @@           case (hdheadersortingordertagp =~ [re|[S][O]|]) of             False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Sorting_Order_Tag_Incorrect_Format             True  -> -- SO tag is in the accepted format.-                     return hdheadersortingordertagp+                     return ()   _ <- word8 58-  hdheadersortingordervalue <- do hdheadersortingordervaluep <- DABL.takeTill (== 09)+  hdheadersortingordervalue <- do hdheadersortingordervaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                   -- Parse SO value of the header section.                                   case (hdheadersortingordervaluep =~ [re|[u][n][k][n][o][w][n]|[u][n][s][o][r][t][e][d]|[q][u][e][r][y][n][a][m][e]|[c][o][o][r][d][i][n][a][t][e]|]) of                                     False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Sorting_Order_Invalid_Value
src/Data/SAM/Version1_6/Read/Parser/Header/HD/SS.hs view
@@ -47,8 +47,9 @@ import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the SS tag of the @HD tag section of the SAM v1.6 file format. --@@ -60,9 +61,9 @@           case (hdheadersubsortingordertagp =~ [re|[S][S]|]) of             False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Subsorting_Order_Tag_Incorrect_Format             True  -> -- SS tag is in the accepted format.-                     return hdheadersubsortingordertagp+                     return ()   _ <- word8 58-  hdheadersubsortingordervalue <- do hdheadersubsortingordervaluep <- DABL.takeTill (== 09)+  hdheadersubsortingordervalue <- do hdheadersubsortingordervaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                      -- Parse SS value of the header section.                                      case (hdheadersubsortingordervaluep =~ [re|(coordinate|queryname|unsorted)(:[A-Za-z0-9_-]+)+|]) of                                        False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Subsorting_Order_Incorrect_Format 
src/Data/SAM/Version1_6/Read/Parser/Header/HD/VN.hs view
@@ -47,8 +47,9 @@ import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the VN tag of the @HD tag section of the SAM v1.6 file format. --@@ -60,11 +61,11 @@           case (hdheaderversiontagp =~ [re|[V][N]|]) of             False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Format_Version_Tag_Incorrect_Format             True  -> -- VN tag is in the accepted format. -                     return hdheaderversiontagp+                     return ()   _ <- word8 58-  hdheaderversionvalue <- do hdheaderversionvaluep <- DABL.takeTill (== 09)+  hdheaderversionvalue <- do hdheaderversionvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                              -- Parse VN value of the header section.-                             case (hdheaderversionvaluep =~ [re|/^[0-9]+\.[0-9]+$/.|]) of+                             case (hdheaderversionvaluep =~ [re|^[0-9]+\.[0-9]+$|]) of                                False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Format_Version_Value_Incorrect_Format                                True  -> -- VN value is in the accepted format.                                         return hdheaderversionvaluep  
src/Data/SAM/Version1_6/Read/Parser/Header/PG/Base.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports              #-} {-# LANGUAGE RecordWildCards             #-} {-# LANGUAGE ScopedTypeVariables         #-}-{-# LANGUAGE TemplateHaskell             #-} {-# LANGUAGE TypeFamilies                #-} {-# LANGUAGE QuasiQuotes                 #-} {-# OPTIONS_GHC -fno-warn-name-shadowing #-}@@ -54,14 +53,11 @@ import Data.SAM.Version1_6.Read.Parser.Header.PG.DS import Data.SAM.Version1_6.Read.Parser.Header.PG.VN +import Control.Applicative.Permutations           (intercalateEffect,toPermutation,toPermutationWithDefault)+import Data.Attoparsec.ByteString.Char8  as DABC8 (endOfLine) import Data.Attoparsec.ByteString.Lazy   as DABL import Text.Regex.PCRE.Heavy --- | Make a parser optional, return Nothing if there is no match.-maybeOption :: Parser a-            -> Parser (Maybe a)-maybeOption p = option Nothing (Just <$> p)- -- | @"SAM_V1_6_Program"@ parser. -- -- Defines a parser for @PG tag section of the SAM v1.6 file format.@@ -74,26 +70,22 @@                   case (pgheaderp =~ [re|[@][P][G]|]) of                     False -> fail $ show SAM_V1_6_Error_Program_Tag_Incorrect_Format                      True  -> -- @PG tag is in the accepted format.-                             return pgheaderp+                             return ()   _         <- word8 09-  -- This parser assumes that the ID tag always appears first, followed by-  -- the PN, CL, PP,-  -- DS and VN tags if they exist, in that order.-  id <- parse_SAM_V1_6_SAM_V1_6_Program_ID-  _  <- word8 09-  pn <- maybeOption parse_SAM_V1_6_SAM_V1_6_Program_PN-  _  <- word8 09-  cl <- maybeOption parse_SAM_V1_6_SAM_V1_6_Program_CL-  _  <- word8 09-  pp <- maybeOption parse_SAM_V1_6_SAM_V1_6_Program_PP-  _  <- word8 09-  ds <- maybeOption parse_SAM_V1_6_SAM_V1_6_Program_DS-  _  <- word8 09-  vn <- maybeOption parse_SAM_V1_6_SAM_V1_6_Program_VN-  return SAM_V1_6_Program { sam_v1_6_program_record_identifier = id-                          , sam_v1_6_program_name              = pn-                          , sam_v1_6_program_command_line      = cl-                          , sam_v1_6_program_previous_pg_id    = pp-                          , sam_v1_6_program_description       = ds-                          , sam_v1_6_program_version           = vn-                          }+  -- This parser assumes that the+  -- ID, PN, CL, PP, DS, and VN tags can appear in any order.+  pg <- intercalateEffect (word8 09) $+          SAM_V1_6_Program+            <$> toPermutation parse_SAM_V1_6_Program_ID+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Program_PN)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Program_CL)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Program_PP)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Program_DS)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Program_VN)+  _ <- endOfLine+  return pg
src/Data/SAM/Version1_6/Read/Parser/Header/PG/CL.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.PG.CL ( -- * SAM_V1_6 parser - header section (Program) - CL tag-                                                      parse_SAM_V1_6_SAM_V1_6_Program_CL+                                                      parse_SAM_V1_6_Program_CL                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the CL tag of the @PG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Program_CL :: Parser SAM_V1_6_Program_Command_Line-parse_SAM_V1_6_SAM_V1_6_Program_CL = do+parse_SAM_V1_6_Program_CL :: Parser SAM_V1_6_Program_Command_Line+parse_SAM_V1_6_Program_CL = do   _ <- do pgheadercommandlinetagp <- DABL.takeTill (== 58)           -- Parse CL tag of the header section.           case (pgheadercommandlinetagp =~ [re|[C][L]|]) of             False -> fail $ show SAM_V1_6_Error_Program_Command_Line_Incorrect_Format              True  -> -- CL tag is in the accepted format. -                     return pgheadercommandlinetagp+                     return ()   _ <- word8 58-  pgheadercommandlinevalue <- DABL.takeTill (== 09)+  pgheadercommandlinevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Program_Command_Line { sam_v1_6_program_command_line_value = pgheadercommandlinevalue                                        }
src/Data/SAM/Version1_6/Read/Parser/Header/PG/DS.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.PG.DS ( -- * SAM_V1_6 parser - header section (Program) - DS tag-                                                      parse_SAM_V1_6_SAM_V1_6_Program_DS+                                                      parse_SAM_V1_6_Program_DS                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the DS tag of the @PG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Program_DS :: Parser SAM_V1_6_Program_Description-parse_SAM_V1_6_SAM_V1_6_Program_DS = do+parse_SAM_V1_6_Program_DS :: Parser SAM_V1_6_Program_Description+parse_SAM_V1_6_Program_DS = do   _ <- do pgheaderdescriptiontagp <- DABL.takeTill (== 58)           -- Parse DS tag of the header section.           case (pgheaderdescriptiontagp =~ [re|[D][S]|]) of             False -> fail $ show SAM_V1_6_Error_Program_Description_Incorrect_Format              True  -> -- DS tag is in the accepted format. -                     return pgheaderdescriptiontagp+                     return ()   _ <- word8 58-  pgheaderdescriptionvalue <- DABL.takeTill (== 09)+  pgheaderdescriptionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Program_Description { sam_v1_6_program_description_value = pgheaderdescriptionvalue                                       }
src/Data/SAM/Version1_6/Read/Parser/Header/PG/ID.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.PG.ID ( -- * SAM_V1_6 parser - header section (Program) - ID tag-                                                      parse_SAM_V1_6_SAM_V1_6_Program_ID+                                                      parse_SAM_V1_6_Program_ID                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the ID tag of the @PG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Program_ID :: Parser SAM_V1_6_Program_Record_Identifier-parse_SAM_V1_6_SAM_V1_6_Program_ID = do+parse_SAM_V1_6_Program_ID :: Parser SAM_V1_6_Program_Record_Identifier+parse_SAM_V1_6_Program_ID = do   _ <- do pgheaderidentifiertagp <- DABL.takeTill (== 58)           -- Parse ID tag of the header section.           case (pgheaderidentifiertagp =~ [re|[I][D]|]) of             False -> fail $ show SAM_V1_6_Error_Program_Identifier_Incorrect_Format              True  -> -- ID tag is in the accepted format. -                     return pgheaderidentifiertagp+                     return ()   _ <- word8 58-  pgheaderidentifiervalue <- DABL.takeTill (== 09)+  pgheaderidentifiervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Program_Record_Identifier { sam_v1_6_program_record_identifier_value = pgheaderidentifiervalue                                             }
src/Data/SAM/Version1_6/Read/Parser/Header/PG/PN.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.PG.PN ( -- * SAM_V1_6 parser - header section (Program) - PN tag-                                                      parse_SAM_V1_6_SAM_V1_6_Program_PN+                                                      parse_SAM_V1_6_Program_PN                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the PN tag of the @PG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Program_PN :: Parser SAM_V1_6_Program_Name-parse_SAM_V1_6_SAM_V1_6_Program_PN = do+parse_SAM_V1_6_Program_PN :: Parser SAM_V1_6_Program_Name+parse_SAM_V1_6_Program_PN = do   _ <- do pgheadernametagp <- DABL.takeTill (== 58)           -- Parse PN tag of the header section.           case (pgheadernametagp =~ [re|[P][N]|]) of             False -> fail $ show SAM_V1_6_Error_Program_Name_Incorrect_Format              True  -> -- PN tag is in the accepted format. -                     return pgheadernametagp+                     return ()   _ <- word8 58-  pgheadernamevalue <- DABL.takeTill (== 09)+  pgheadernamevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Program_Name { sam_v1_6_program_name_value = pgheadernamevalue                                }
src/Data/SAM/Version1_6/Read/Parser/Header/PG/PP.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.PG.PP ( -- * SAM_V1_6 parser - header section (Program) - PP tag-                                                      parse_SAM_V1_6_SAM_V1_6_Program_PP+                                                      parse_SAM_V1_6_Program_PP                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the PP tag of the @PG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Program_PP :: Parser SAM_V1_6_Program_Previous_PG_ID-parse_SAM_V1_6_SAM_V1_6_Program_PP = do+parse_SAM_V1_6_Program_PP :: Parser SAM_V1_6_Program_Previous_PG_ID+parse_SAM_V1_6_Program_PP = do   _ <- do pgheaderpreviouspgidtagp <- DABL.takeTill (== 58)           -- Parse PP tag of the header section.           case (pgheaderpreviouspgidtagp =~ [re|[P][P]|]) of             False -> fail $ show SAM_V1_6_Error_Program_Previous_PG_ID_Incorrect_Format              True  -> -- PP tag is in the accepted format. -                     return pgheaderpreviouspgidtagp+                     return ()   _ <- word8 58-  pgheaderpreviouspgidvalue <- DABL.takeTill (== 09)+  pgheaderpreviouspgidvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Program_Previous_PG_ID { sam_v1_6_program_previous_pg_id_value = pgheaderpreviouspgidvalue                                          }
src/Data/SAM/Version1_6/Read/Parser/Header/PG/VN.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.PG.VN ( -- * SAM_V1_6 parser - header section (Program) - VN tag-                                                      parse_SAM_V1_6_SAM_V1_6_Program_VN+                                                      parse_SAM_V1_6_Program_VN                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the VN tag of the @PG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Program_VN :: Parser SAM_V1_6_Program_Version-parse_SAM_V1_6_SAM_V1_6_Program_VN = do+parse_SAM_V1_6_Program_VN :: Parser SAM_V1_6_Program_Version+parse_SAM_V1_6_Program_VN = do   _ <- do pgheaderversiontagp <- DABL.takeTill (== 58)           -- Parse VN tag of the header section.           case (pgheaderversiontagp =~ [re|[V][N]|]) of             False -> fail $ show SAM_V1_6_Error_Program_Version_Incorrect_Format              True  -> -- VN tag is in the accepted format. -                     return pgheaderversiontagp+                     return ()   _ <- word8 58-  pgheaderversionvalue <- DABL.takeTill (== 09)+  pgheaderversionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Program_Version { sam_v1_6_program_version_value = pgheaderversionvalue                                   }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/BC.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.BC ( -- * SAM_V1_6 parser - header section (Read group) - BC tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_BC+                                                      parse_SAM_V1_6_Read_Group_BC                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the BC tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_BC :: Parser SAM_V1_6_Read_Group_Barcode_Sequence -parse_SAM_V1_6_SAM_V1_6_Read_Group_BC = do+parse_SAM_V1_6_Read_Group_BC :: Parser SAM_V1_6_Read_Group_Barcode_Sequence +parse_SAM_V1_6_Read_Group_BC = do   _ <- do rgheaderbarcodesequencetagp <- DABL.takeTill (== 58)           -- Parse BC tag of the header section.           case (rgheaderbarcodesequencetagp =~ [re|[B][C]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Barcode_Sequence_Incorrect_Format              True  -> -- BC tag is in the accepted format. -                     return rgheaderbarcodesequencetagp+                     return ()   _ <- word8 58-  rgheaderbarcodesequencevalue <- DABL.takeTill (== 09)+  rgheaderbarcodesequencevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Barcode_Sequence { sam_v1_6_read_group_barcode_sequence_value = rgheaderbarcodesequencevalue                                               }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/Base.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports              #-} {-# LANGUAGE RecordWildCards             #-} {-# LANGUAGE ScopedTypeVariables         #-}-{-# LANGUAGE TemplateHaskell             #-} {-# LANGUAGE TypeFamilies                #-} {-# LANGUAGE QuasiQuotes                 #-} {-# OPTIONS_GHC -fno-warn-name-shadowing #-}@@ -62,14 +61,11 @@ import Data.SAM.Version1_6.Read.Parser.Header.RG.PU import Data.SAM.Version1_6.Read.Parser.Header.RG.SM +import Control.Applicative.Permutations           (intercalateEffect,toPermutation,toPermutationWithDefault)+import Data.Attoparsec.ByteString.Char8  as DABC8 (endOfLine) import Data.Attoparsec.ByteString.Lazy   as DABL import Text.Regex.PCRE.Heavy --- | Make a parser optional, return Nothing if there is no match.-maybeOption :: Parser a-            -> Parser (Maybe a)-maybeOption p = option Nothing (Just <$> p)- -- | @"SAM_V1_6_Read_Group"@ parser. -- -- Defines a parser for @RG tag section of the SAM v1.6 file format.@@ -82,50 +78,39 @@                   case (rgheaderp =~ [re|[@][R][G]|]) of                     False -> fail $ show SAM_V1_6_Error_Read_Group_Tag_Incorrect_Format                     True  -> -- @RG tag is in the accepted format.-                             return rgheaderp+                             return ()   _         <- word8 09-  -- This parser assumes that the ID tag always appears first, followed by-  -- the BC, CN, DS, DT, FO, KS, LB, PG, PI, PL,-  -- PM, PU and SM tags if they exist, in that order.-  id <- parse_SAM_V1_6_SAM_V1_6_Read_Group_ID-  _  <- word8 09-  bc <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_BC-  _  <- word8 09-  cn <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_CN-  _  <- word8 09-  ds <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_DS-  _  <- word8 09-  dt <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_DT-  _  <- word8 09-  fo <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_FO-  _  <- word8 09-  ks <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_KS-  _  <- word8 09-  lb <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_LB-  _  <- word8 09-  pg <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_PG-  _  <- word8 09-  pi <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_PI-  _  <- word8 09-  pl <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_PL-  _  <- word8 09-  pm <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_PM-  _  <- word8 09-  pu <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_PU-  _  <- word8 09-  sm <- maybeOption parse_SAM_V1_6_SAM_V1_6_Read_Group_SM-  return SAM_V1_6_Read_Group { sam_v1_6_read_group_identifer                    = id-                             , sam_v1_6_read_group_barcode_sequence             = bc-                             , sam_v1_6_read_group_sequencing_center            = cn-                             , sam_v1_6_read_group_description                  = ds-                             , sam_v1_6_read_group_run_date                     = dt-                             , sam_v1_6_read_group_flow_order                   = fo-                             , sam_v1_6_read_group_key_sequence                 = ks-                             , sam_v1_6_read_group_library                      = lb-                             , sam_v1_6_read_group_programs                     = pg-                             , sam_v1_6_read_group_predicted_median_insert_size = pi-                             , sam_v1_6_read_group_platform                     = pl-                             , sam_v1_6_read_group_platform_model               = pm-                             , sam_v1_6_read_group_platform_unit                = pu-                             , sam_v1_6_read_group_sample                       = sm-                             }+  -- This parser assumes that the+  -- ID, BC, CN, DS, DT, FO, KS, LB, PG, PI, PL,+  -- PM, PU and SM tags can appear in any order.+  rg <- intercalateEffect (word8 09) $+          SAM_V1_6_Read_Group+            <$> toPermutation parse_SAM_V1_6_Read_Group_ID+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_BC)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_CN)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_DS)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_DT)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_FO)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_KS)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_LB)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_PG)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_PI)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_PL)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_PM)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_PU)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Read_Group_SM)+  _ <- endOfLine+  return rg 
src/Data/SAM/Version1_6/Read/Parser/Header/RG/CN.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.CN ( -- * SAM_V1_6 parser - header section (Read group) - CN tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_CN+                                                      parse_SAM_V1_6_Read_Group_CN                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the CN tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_CN :: Parser SAM_V1_6_Read_Group_Sequencing_Center -parse_SAM_V1_6_SAM_V1_6_Read_Group_CN = do+parse_SAM_V1_6_Read_Group_CN :: Parser SAM_V1_6_Read_Group_Sequencing_Center +parse_SAM_V1_6_Read_Group_CN = do   _ <- do rgheadersequencingcentertagp <- DABL.takeTill (== 58)           -- Parse CN tag of the header section.           case (rgheadersequencingcentertagp =~ [re|[C][N]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Sequencing_Center_Incorrect_Format              True  -> -- CN tag is in the accepted format. -                     return rgheadersequencingcentertagp+                     return ()   _ <- word8 58-  rgheadersequencingcentervalue <- DABL.takeTill (== 09)+  rgheadersequencingcentervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Sequencing_Center { sam_v1_6_read_group_sequencing_center_value = rgheadersequencingcentervalue                                                }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/DS.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.DS ( -- * SAM_V1_6 parser - header section (Read group) - DS tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_DS+                                                      parse_SAM_V1_6_Read_Group_DS                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the DS tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_DS :: Parser SAM_V1_6_Read_Group_Description -parse_SAM_V1_6_SAM_V1_6_Read_Group_DS = do+parse_SAM_V1_6_Read_Group_DS :: Parser SAM_V1_6_Read_Group_Description +parse_SAM_V1_6_Read_Group_DS = do   _ <- do rgheaderdescriptiontagp <- DABL.takeTill (== 58)           -- Parse DS tag of the header section.           case (rgheaderdescriptiontagp =~ [re|[D][S]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Description_Incorrect_Format              True  -> -- DS tag is in the accepted format. -                     return rgheaderdescriptiontagp+                     return ()   _ <- word8 58-  rgheaderdescriptionvalue <- DABL.takeTill (== 09)+  rgheaderdescriptionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Description { sam_v1_6_read_group_description_value = rgheaderdescriptionvalue                                          }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/DT.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.DT ( -- * SAM_V1_6 parser - header section (Read group) - DT tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_DT+                                                      parse_SAM_V1_6_Read_Group_DT                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the DT tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_DT :: Parser SAM_V1_6_Read_Group_Run_Date -parse_SAM_V1_6_SAM_V1_6_Read_Group_DT = do+parse_SAM_V1_6_Read_Group_DT :: Parser SAM_V1_6_Read_Group_Run_Date +parse_SAM_V1_6_Read_Group_DT = do   _ <- do rgheaderrundatetagp <- DABL.takeTill (== 58)           -- Parse DT tag of the header section.           case (rgheaderrundatetagp =~ [re|[D][T]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Date_Run_Produced_Incorrect_Format             True  -> -- DT tag is in the accepted format. -                     return rgheaderrundatetagp+                     return ()   _ <- word8 58-  rgheaderrundatevalue <- DABL.takeTill (== 09)+  rgheaderrundatevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Run_Date { sam_v1_6_read_group_run_date_value = rgheaderrundatevalue                                       }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/FO.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,30 +40,31 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.FO ( -- * SAM_V1_6 parser - header section (Read group) - FO tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_FO+                                                      parse_SAM_V1_6_Read_Group_FO                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the FO tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_FO :: Parser SAM_V1_6_Read_Group_Flow_Order -parse_SAM_V1_6_SAM_V1_6_Read_Group_FO = do+parse_SAM_V1_6_Read_Group_FO :: Parser SAM_V1_6_Read_Group_Flow_Order +parse_SAM_V1_6_Read_Group_FO = do   _ <- do rgheaderflowordertagp <- DABL.takeTill (== 58)           -- Parse FO tag of the header section.           case (rgheaderflowordertagp =~ [re|[F][O]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Flow_Order_Incorrect_Format             True  -> -- FO tag is in the accepted format. -                     return rgheaderflowordertagp+                     return ()   _ <- word8 58-  rgheaderflowordervalue <- do rgheaderflowordervaluep <- DABL.takeTill (== 09)+  rgheaderflowordervalue <- do rgheaderflowordervaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                -- Parse FO value of the header section.-                               case (rgheaderflowordervaluep =~ [re|/\*|[ACMGRSVTWYHKDBN]+/|]) of+                               case (rgheaderflowordervaluep =~ [re|\*|[ACMGRSVTWYHKDBN]+|]) of                                  False -> fail $ show SAM_V1_6_Error_Read_Group_Flow_Order_Incorrect_Format                                  True  -> -- FO value is in the accepted format.                                           return rgheaderflowordervaluep
src/Data/SAM/Version1_6/Read/Parser/Header/RG/ID.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.ID ( -- * SAM_V1_6 parser - header section (Read group) - ID tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_ID+                                                      parse_SAM_V1_6_Read_Group_ID                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the ID tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_ID :: Parser SAM_V1_6_Read_Group_Identifier -parse_SAM_V1_6_SAM_V1_6_Read_Group_ID = do+parse_SAM_V1_6_Read_Group_ID :: Parser SAM_V1_6_Read_Group_Identifier +parse_SAM_V1_6_Read_Group_ID = do   _ <- do rgheaderreadgroupidentifiertagp <- DABL.takeTill (== 58)           -- Parse ID tag of the header section.           case (rgheaderreadgroupidentifiertagp =~ [re|[I][D]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Read_Group_Identifier_Incorrect_Format             True  -> -- ID tag is in the accepted format. -                     return rgheaderreadgroupidentifiertagp+                     return ()   _ <- word8 58-  rgheaderreadgroupidentifiervalue <- DABL.takeTill (== 09)+  rgheaderreadgroupidentifiervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Identifier { sam_v1_6_read_group_identifier_value = rgheaderreadgroupidentifiervalue                                         }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/KS.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.KS ( -- * SAM_V1_6 parser - header section (Read group) - KS tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_KS+                                                      parse_SAM_V1_6_Read_Group_KS                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the KS tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_KS :: Parser SAM_V1_6_Read_Group_Key_Sequence -parse_SAM_V1_6_SAM_V1_6_Read_Group_KS = do+parse_SAM_V1_6_Read_Group_KS :: Parser SAM_V1_6_Read_Group_Key_Sequence +parse_SAM_V1_6_Read_Group_KS = do   _ <- do rgheaderkeysequencetagp <- DABL.takeTill (== 58)           -- Parse KS tag of the header section.           case (rgheaderkeysequencetagp =~ [re|[K][S]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Key_Sequence_Incorrect_Format             True  -> -- KS tag is in the accepted format. -                     return rgheaderkeysequencetagp+                     return ()   _ <- word8 58-  rgheaderkeysequencevalue <- DABL.takeTill (== 09)+  rgheaderkeysequencevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Key_Sequence { sam_v1_6_read_group_key_sequence_value = rgheaderkeysequencevalue                                           }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/LB.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.LB ( -- * SAM_V1_6 parser - header section (Read group) - LB tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_LB+                                                      parse_SAM_V1_6_Read_Group_LB                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the LB tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_LB :: Parser SAM_V1_6_Read_Group_Library -parse_SAM_V1_6_SAM_V1_6_Read_Group_LB = do+parse_SAM_V1_6_Read_Group_LB :: Parser SAM_V1_6_Read_Group_Library +parse_SAM_V1_6_Read_Group_LB = do   _ <- do rgheaderlibrarytagp <- DABL.takeTill (== 58)           -- Parse LB tag of the header section.           case (rgheaderlibrarytagp =~ [re|[L][B]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Library_Incorrect_Format             True  -> -- LB tag is in the accepted format. -                     return rgheaderlibrarytagp+                     return ()   _ <- word8 58-  rgheaderlibraryvalue <- DABL.takeTill (== 09)+  rgheaderlibraryvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Library { sam_v1_6_read_group_library_value = rgheaderlibraryvalue                                      }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/PG.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.PG ( -- * SAM_V1_6 parser - header section (Read group) - PG tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_PG+                                                      parse_SAM_V1_6_Read_Group_PG                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the PG tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_PG :: Parser SAM_V1_6_Read_Group_Programs -parse_SAM_V1_6_SAM_V1_6_Read_Group_PG = do+parse_SAM_V1_6_Read_Group_PG :: Parser SAM_V1_6_Read_Group_Programs +parse_SAM_V1_6_Read_Group_PG = do   _ <- do rgheaderprogramstagp <- DABL.takeTill (== 58)           -- Parse PG tag of the header section.           case (rgheaderprogramstagp =~ [re|[P][G]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Programs_Incorrect_Format             True  -> -- PG tag is in the accepted format. -                     return rgheaderprogramstagp+                     return ()   _ <- word8 58-  rgheaderprogramsvalue <- DABL.takeTill (== 09)+  rgheaderprogramsvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Programs { sam_v1_6_read_group_programs_value = rgheaderprogramsvalue                                       }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/PI.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.PI ( -- * SAM_V1_6 parser - header section (Read group) - PI tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_PI+                                                      parse_SAM_V1_6_Read_Group_PI                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the PI tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_PI :: Parser SAM_V1_6_Read_Group_Predicted_Median_Insert_Size -parse_SAM_V1_6_SAM_V1_6_Read_Group_PI = do+parse_SAM_V1_6_Read_Group_PI :: Parser SAM_V1_6_Read_Group_Predicted_Median_Insert_Size +parse_SAM_V1_6_Read_Group_PI = do   _ <- do rgheaderpredictedmedianinsertsizetagp <- DABL.takeTill (== 58)           -- Parse PI tag of the header section.           case (rgheaderpredictedmedianinsertsizetagp =~ [re|[P][I]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Predicted_Median_Insert_Size_Incorrect_Format             True  -> -- PI tag is in the accepted format. -                     return rgheaderpredictedmedianinsertsizetagp+                     return ()   _ <- word8 58-  rgheaderpredictedmedianinsertsizevalue <- DABL.takeTill (== 09)+  rgheaderpredictedmedianinsertsizevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Predicted_Median_Insert_Size { sam_v1_6_read_group_predicted_median_insert_size_value = rgheaderpredictedmedianinsertsizevalue                                                           }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/PL.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,28 +40,29 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.PL ( -- * SAM_V1_6 parser - header section (Read group) - PL tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_PL+                                                      parse_SAM_V1_6_Read_Group_PL                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the PL tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_PL :: Parser SAM_V1_6_Read_Group_Platform -parse_SAM_V1_6_SAM_V1_6_Read_Group_PL = do+parse_SAM_V1_6_Read_Group_PL :: Parser SAM_V1_6_Read_Group_Platform +parse_SAM_V1_6_Read_Group_PL = do   _ <- do rgheaderplatformtagp <- DABL.takeTill (== 58)           -- Parse PL tag of the header section.           case (rgheaderplatformtagp =~ [re|[P][L]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Incorrect_Format             True  -> -- PL tag is in the accepted format. -                     return rgheaderplatformtagp+                     return ()   _ <- word8 58-  rgheaderplatformvalue <- do rgheaderplatformvaluep <- DABL.takeTill (== 09)+  rgheaderplatformvalue <- do rgheaderplatformvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                               -- Parse PL value of the header section.                               case (rgheaderplatformvaluep =~ [re|[C][A][P][I][L][L][A][R][Y]|[D][N][B][S][E][Q]|[E][L][E][M][E][N][T]|[H][E][L][I][C][O][S]|[I][L][L][U][M][I][N][A]|[I][O][N][T][O][R][R][E][N][T]|[L][S][4][5][4]|[O][N][T]|[P][A][C][B][I][O]|[S][O][L][I][D]|[U][L][T][I][M][A]|]) of                                 False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Incorrect_Format
src/Data/SAM/Version1_6/Read/Parser/Header/RG/PM.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.PM ( -- * SAM_V1_6 parser - header section (Read group) - PM tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_PM+                                                      parse_SAM_V1_6_Read_Group_PM                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the PM tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_PM :: Parser SAM_V1_6_Read_Group_Platform_Model -parse_SAM_V1_6_SAM_V1_6_Read_Group_PM = do+parse_SAM_V1_6_Read_Group_PM :: Parser SAM_V1_6_Read_Group_Platform_Model +parse_SAM_V1_6_Read_Group_PM = do   _ <- do rgheaderplatformmodeltagp <- DABL.takeTill (== 58)           -- Parse PM tag of the header section.           case (rgheaderplatformmodeltagp =~ [re|[P][M]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Model_Incorrect_Format             True  -> -- PM tag is in the accepted format. -                     return rgheaderplatformmodeltagp+                     return ()   _ <- word8 58-  rgheaderplatformmodelvalue <- DABL.takeTill (== 09)+  rgheaderplatformmodelvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Platform_Model { sam_v1_6_read_group_platform_model_value = rgheaderplatformmodelvalue                                             }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/PU.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.PU ( -- * SAM_V1_6 parser - header section (Read group) - PU tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_PU+                                                      parse_SAM_V1_6_Read_Group_PU                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the PU tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_PU :: Parser SAM_V1_6_Read_Group_Platform_Unit -parse_SAM_V1_6_SAM_V1_6_Read_Group_PU = do+parse_SAM_V1_6_Read_Group_PU :: Parser SAM_V1_6_Read_Group_Platform_Unit +parse_SAM_V1_6_Read_Group_PU = do   _ <- do rgheaderplatformunittagp <- DABL.takeTill (== 58)           -- Parse PU tag of the header section.           case (rgheaderplatformunittagp =~ [re|[P][U]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Platform_Unit_Incorrect_Format              True  -> -- PU tag is in the accepted format. -                     return rgheaderplatformunittagp+                     return ()   _ <- word8 58-  rgheaderplatformunitvalue <- DABL.takeTill (== 09)+  rgheaderplatformunitvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Platform_Unit { sam_v1_6_read_group_platform_unit_value = rgheaderplatformunitvalue                                            }
src/Data/SAM/Version1_6/Read/Parser/Header/RG/SM.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.RG.SM ( -- * SAM_V1_6 parser - header section (Read group) - SM tag-                                                      parse_SAM_V1_6_SAM_V1_6_Read_Group_SM+                                                      parse_SAM_V1_6_Read_Group_SM                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the SM tag of the @RG tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Read_Group_SM :: Parser SAM_V1_6_Read_Group_Sample -parse_SAM_V1_6_SAM_V1_6_Read_Group_SM = do+parse_SAM_V1_6_Read_Group_SM :: Parser SAM_V1_6_Read_Group_Sample +parse_SAM_V1_6_Read_Group_SM = do   _ <- do rgheadersampletagp <- DABL.takeTill (== 58)           -- Parse SM tag of the header section.           case (rgheadersampletagp =~ [re|[S][M]|]) of             False -> fail $ show SAM_V1_6_Error_Read_Group_Sample_Incorrect_Format             True  -> -- SM tag is in the accepted format. -                     return rgheadersampletagp+                     return ()   _ <- word8 58-  rgheadersamplevalue <- DABL.takeTill (== 09)+  rgheadersamplevalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Read_Group_Sample { sam_v1_6_read_group_sample_value = rgheadersamplevalue                                     }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AH.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.AH ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - AH tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AH+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_AH                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the AH tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AH :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AH = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_AH :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus+parse_SAM_V1_6_Reference_Sequence_Dictionary_AH = do   _ <- do sqheaderalternativelocustagp <- DABL.takeTill (== 58)           -- Parse AH tag of the header section.           case (sqheaderalternativelocustagp =~ [re|[A][H]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Locus_Incorrect_Format             True  -> -- AH tag is in the accepted format.-                     return sqheaderalternativelocustagp+                     return ()   _ <- word8 58-  sqheaderalternativelocusvalue <- DABL.takeTill (== 09) +  sqheaderalternativelocusvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Locus { sam_v1_6_reference_sequence_dictionary_alternative_locus_value = sqheaderalternativelocusvalue                                                                   }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AN.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,30 +40,31 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.AN ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - AN tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AN+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_AN                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the AN tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AN = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_AN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names+parse_SAM_V1_6_Reference_Sequence_Dictionary_AN = do   _ <- do sqheaderalternativereferencesequencenamestagp <- DABL.takeTill (== 58)           -- Parse AN tag of the header section.           case (sqheaderalternativereferencesequencenamestagp =~ [re|[A][N]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Incorrect_Format             True  -> -- AN tag is in the accepted format.-                     return sqheaderalternativereferencesequencenamestagp+                     return ()   _ <- word8 58-  sqheaderalternativereferencesequencenamesvalue <- do sqheaderalternativereferencesequencenamesvaluep <- DABL.takeTill (== 09)+  sqheaderalternativereferencesequencenamesvalue <- do sqheaderalternativereferencesequencenamesvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                                        -- Parse AN value of the header section.-                                                       case (sqheaderalternativereferencesequencenamesvaluep =~ [re|[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*(,[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*)*|]) of+                                                       case (sqheaderalternativereferencesequencenamesvaluep =~ [re|[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*(,[0-9A-Za-z!#$%&+.:;?@^_|~-][0-9A-Za-z!#$%&*+.:;=?@^_|~-]*)*|]) of                                                          False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Alternative_Reference_Sequence_Names_Invalid_Value                                                          True  -> -- AN value is in the accepted format.                                                                   return sqheaderalternativereferencesequencenamesvaluep
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/AS.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.AS ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - AS tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AS+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_AS                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the AS tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AS = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_AS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier+parse_SAM_V1_6_Reference_Sequence_Dictionary_AS = do   _ <- do sqheadergenomeassemblyidentifiertagp <- DABL.takeTill (== 58)           -- Parse AS tag of the header section.           case (sqheadergenomeassemblyidentifiertagp =~ [re|[A][S]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Genome_Assembly_Identifier_Incorrect_Format             True  -> -- AS tag is in the accepted format.-                     return sqheadergenomeassemblyidentifiertagp+                     return ()   _ <- word8 58-  sqheadergenomeassemblyidentifiervalue <- DABL.takeTill (== 09)+  sqheadergenomeassemblyidentifiervalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Reference_Sequence_Dictionary_Genome_Assembly_Identifier { sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier_value = sqheadergenomeassemblyidentifiervalue                                                                            }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/Base.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -57,14 +56,11 @@ import Data.SAM.Version1_6.Read.Parser.Header.SQ.TP import Data.SAM.Version1_6.Read.Parser.Header.SQ.UR +import Control.Applicative.Permutations           (intercalateEffect,toPermutation,toPermutationWithDefault)+import Data.Attoparsec.ByteString.Char8  as DABC8 (endOfLine) import Data.Attoparsec.ByteString.Lazy   as DABL import Text.Regex.PCRE.Heavy --- | Make a parser optional, return Nothing if there is no match.-maybeOption :: Parser a-            -> Parser (Maybe a)-maybeOption p = option Nothing (Just <$> p)- -- | @"SAM_V1_6_Reference_Sequence_Dictionary"@ parser. -- -- Defines a parser for @SQ tag section of the SAM v1.6 file format.@@ -77,38 +73,30 @@                   case (sqheaderp =~ [re|[@][S][Q]|]) of                     False -> fail $ show SAM_V1_6_Error_File_Level_Metadata_Tag_Incorrect_Format                     True  -> -- @SQ tag is in the accepted format.-                             return sqheaderp+                             return ()   _         <- word8 09-  -- This parser assumes that the SN tag always appears first, followed by-  -- the LN tag, followed by the AH, AN, AS, DS, M5,-  -- SP, TP and UR tags if they exist, in that order.-  sn <- parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SN-  _  <- word8 09-  ln <- parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_LN-  _  <- word8 09-  ah <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AH-  _  <- word8 09-  an <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AN-  _  <- word8 09-  as <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_AS-  _  <- word8 09-  ds <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_DS-  _  <- word8 09-  m5 <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_M5-  _  <- word8 09-  sp <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SP-  _  <- word8 09-  tp <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_TP-  _  <- word8 09-  ur <- maybeOption parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_UR -  return SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name                        = sn  -                                                , sam_v1_6_reference_sequence_dictionary_reference_sequence_length                      = ln-                                                , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus                    = ah-                                                , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = an-                                                , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier                     = as-                                                , sam_v1_6_reference_sequence_dictionary_description                                    = ds-                                                , sam_v1_6_reference_sequence_dictionary_md5_checksum                                   = m5-                                                , sam_v1_6_reference_sequence_dictionary_species                                        = sp-                                                , sam_v1_6_reference_sequence_dictionary_molecule_topology                              = tp-                                                , sam_v1_6_reference_sequence_dictionary_uri                                            = ur-                                                } +  -- This parser assumes that the+  -- SN, LN, AH, AN, AS, DS, M5,+  -- SP, TP and UR tags can appear in any order.+  sq <- intercalateEffect (word8 09) $+          SAM_V1_6_Reference_Sequence_Dictionary+            <$> toPermutation parse_SAM_V1_6_Reference_Sequence_Dictionary_SN+            <*> toPermutation parse_SAM_V1_6_Reference_Sequence_Dictionary_LN+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AH)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AN)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_AS)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_DS)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_M5)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_SP) +            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_TP)+            <*> toPermutationWithDefault Nothing+                                         (Just <$> parse_SAM_V1_6_Reference_Sequence_Dictionary_UR)+  _ <- endOfLine+  return sq
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/DS.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.DS ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - DS tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_DS+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_DS                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the DS tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_DS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Description-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_DS = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_DS :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Description+parse_SAM_V1_6_Reference_Sequence_Dictionary_DS = do   _ <- do sqheaderdescriptiontagp <- DABL.takeTill (== 58)           -- Parse DS tag of the header section.           case (sqheaderdescriptiontagp =~ [re|[D][S]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Description_Incorrect_Format              True  -> -- DS tag is in the accepted format.-                     return sqheaderdescriptiontagp+                     return ()   _ <- word8 58-  sqheaderdescriptionvalue <- DABL.takeTill (== 09)+  sqheaderdescriptionvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Reference_Sequence_Dictionary_Description { sam_v1_6_reference_sequence_dictionary_description_value = sqheaderdescriptionvalue                                                             }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/LN.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,28 +40,29 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.LN ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - LN tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_LN+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_LN                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the LN tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_LN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_LN = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_LN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length+parse_SAM_V1_6_Reference_Sequence_Dictionary_LN = do   _ <- do sqheadersequencelengthtagp <- DABL.takeTill (== 58)           -- Parse LN tag of the header section.           case (sqheadersequencelengthtagp =~ [re|[L][N]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Incorrect_Format             True  -> -- LN tag is in the accepted format.-                     return sqheadersequencelengthtagp+                     return ()   _ <- word8 58-  sqheadersequencelengthvalue <- do sqheadersequencelengthvaluep <- DABL.takeTill (== 09)+  sqheadersequencelengthvalue <- do sqheadersequencelengthvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                     -- Parse LN value of the header section.                                     case (sqheadersequencelengthvaluep =~ [re|[0-9]*|]) of -- Make this regex actually check the range of [1,2^31 - 1]?                                       False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Length_Invalid_Value
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/M5.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.M5 ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - M5 tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_M5+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_M5                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the M5 tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_M5 :: Parser SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_M5 = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_M5 :: Parser SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum+parse_SAM_V1_6_Reference_Sequence_Dictionary_M5 = do   _ <- do sqheadermd5checksumtagp <- DABL.takeTill (== 58)           -- Parse M5 tag of the header section.           case (sqheadermd5checksumtagp =~ [re|[M][5]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_MD5_Checksum_Incorrect_Format              True  -> -- M5 tag is in the accepted format.-                     return sqheadermd5checksumtagp+                     return ()   _ <- word8 58-  sqheadermd5checksumvalue <- DABL.takeTill (== 09)+  sqheadermd5checksumvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Reference_Sequence_Dictionary_MD5_Checksum { sam_v1_6_reference_sequence_dictionary_md5_checksum_value = sqheadermd5checksumvalue                                                              }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SN.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,32 +40,33 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.SN ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - SN tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SN+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_SN                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the SN tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SN = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_SN :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name+parse_SAM_V1_6_Reference_Sequence_Dictionary_SN = do   _ <- do sqheadersequencenametagp <- DABL.takeTill (== 58)           -- Parse SN tag of the header section.           case (sqheadersequencenametagp =~ [re|[S][N]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Incorrect_Format             True  -> -- SN tag is in the accepted format. -                     return sqheadersequencenametagp+                     return ()   _ <- word8 58-  sqheadersequencenamevalue <- do sqheadersequencenamevaluep <- DABL.takeTill (== 09)+  sqheadersequencenamevalue <- do sqheadersequencenamevaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                   -- Parse SN value of the header section.                                   case (sqheadersequencenamevaluep =~ [re|[0-9A-Za-z!#$%&+./:;?@^_|~-][0-9A-Za-z!#$%&*+./:;=?@^_|~-]*|]) of                                     False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Reference_Sequence_Name_Invalid_Value                                     True  -> -- SN value is in the accepted format.-                                             return sqheadersequencenamevaluep  +                                             return sqheadersequencenamevaluep   return SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = sqheadersequencenamevalue                                                                         }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/SP.hs view
@@ -41,27 +41,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.SP ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - SP tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SP+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_SP                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the SP tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Species-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_SP = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_SP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Species+parse_SAM_V1_6_Reference_Sequence_Dictionary_SP = do   _ <- do sqheaderspeciestagp <- DABL.takeTill (== 58)           -- Parse SP tag of the header section.           case (sqheaderspeciestagp =~ [re|[S][P]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Species_Incorrect_Format             True  -> -- SP tag is in the accepted format.-                     return sqheaderspeciestagp+                     return ()   _ <- word8 58-  sqheaderspeciesvalue <- DABL.takeTill (== 09)+  sqheaderspeciesvalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Reference_Sequence_Dictionary_Species { sam_v1_6_reference_sequence_dictionary_species_value = sqheaderspeciesvalue                                                         }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/TP.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,32 +40,33 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.TP ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - TP tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_TP+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_TP                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the TP tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_TP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_TP = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_TP :: Parser SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology+parse_SAM_V1_6_Reference_Sequence_Dictionary_TP = do   _ <- do sqheadermoleculetopologytagp <- DABL.takeTill (== 58)           -- Parse TP tag of the header section.           case (sqheadermoleculetopologytagp =~ [re|[T][P]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Molecule_Topology_Incorrect_Format             True  -> -- TP tag is in the accepted format. -                     return sqheadermoleculetopologytagp+                     return ()   _ <- word8 58-  sqheadermoleculetopologyvalue <- do sqheadermoleculetopologyvaluep <- DABL.takeTill (== 09)+  sqheadermoleculetopologyvalue <- do sqheadermoleculetopologyvaluep <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)                                       -- Parse TP value of the header section.                                       case (sqheadermoleculetopologyvaluep =~ [re|[l][i][n][e][a][r]|[c][i][r][c][u][l][a][r]|]) of                                         False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_Molecule_Topology_Invalid_Value                                         True  -> -- TP value is in the accepted format.-                                                 return sqheadermoleculetopologyvaluep  +                                                 return sqheadermoleculetopologyvaluep   return SAM_V1_6_Reference_Sequence_Dictionary_Molecule_Topology { sam_v1_6_reference_sequence_dictionary_molecule_topology_value = sqheadermoleculetopologyvalue                                                                   }
src/Data/SAM/Version1_6/Read/Parser/Header/SQ/UR.hs view
@@ -9,7 +9,6 @@ {-# LANGUAGE PackageImports        #-} {-# LANGUAGE RecordWildCards       #-} {-# LANGUAGE ScopedTypeVariables   #-}-{-# LANGUAGE TemplateHaskell       #-} {-# LANGUAGE TypeFamilies          #-} {-# LANGUAGE QuasiQuotes           #-} @@ -41,27 +40,28 @@ -- This library enables the decoding/encoding of SAM, BAM and CRAM file formats.  module Data.SAM.Version1_6.Read.Parser.Header.SQ.UR ( -- * SAM_V1_6 parser - header section (Reference sequence dictionary) - UR tag-                                                      parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_UR+                                                      parse_SAM_V1_6_Reference_Sequence_Dictionary_UR                                                     ) where  import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Error -import           Data.Attoparsec.ByteString.Lazy   as DABL-import           Text.Regex.PCRE.Heavy+import Data.Attoparsec.ByteString.Char8 (isEndOfLine)+import Data.Attoparsec.ByteString.Lazy   as DABL+import Text.Regex.PCRE.Heavy  -- | Defines a parser for the UR tag of the @SQ tag section of the SAM v1.6 file format. -- -- See the [SAM v1.6](http://samtools.github.io/hts-specs/SAMv1.pdf) specification documentation.-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_UR :: Parser SAM_V1_6_Reference_Sequence_Dictionary_URI-parse_SAM_V1_6_SAM_V1_6_Reference_Sequence_Dictionary_UR = do+parse_SAM_V1_6_Reference_Sequence_Dictionary_UR :: Parser SAM_V1_6_Reference_Sequence_Dictionary_URI+parse_SAM_V1_6_Reference_Sequence_Dictionary_UR = do   _ <- do sqheaderuritagp <- DABL.takeTill (== 58)           -- Parse UR tag of the header section.           case (sqheaderuritagp =~ [re|[U][R]|]) of             False -> fail $ show SAM_V1_6_Error_Reference_Sequence_Dictionary_URI_Incorrect_Format             True  -> -- UR tag is in the accepted format.-                     return sqheaderuritagp+                     return ()   _ <- word8 58-  sqheaderurivalue <- DABL.takeTill (== 09)+  sqheaderurivalue <- DABL.takeTill (\x -> x == 09 || isEndOfLine x)   return SAM_V1_6_Reference_Sequence_Dictionary_URI { sam_v1_6_reference_sequence_dictionary_uri_value = sqheaderurivalue                                                     }
test/Main.hs view
@@ -1,14 +1,65 @@ module Main (main) where +import Data.SAM.Version1_6.Base+import Data.SAM.Version1_6.Alignment+import Data.SAM.Version1_6.Alignment.BOPT+import Data.SAM.Version1_6.Header import Data.SAM.Version1_6.Read.Base +import Data.Sequence (fromList)+import Data.String (fromString) import Test.Hspec  main :: IO ()-main = do --hspec $ do- -- describe "Data.SAM.Version1_6.Read.Base" $ do- --   describe "readSAM_V1_6" $ do- --     describe "toy1.sam" $ do- --       it "Ensures that readSAM_V1_6 can read and parse: toy1.sam" $ do- toy1sam <- readSAM_V1_6 "test/examples/toy4.sam"- print toy1sam +main = hspec $ do+  describe "Data.SAM.Version1_6.Read.Base" $ do+    describe "readSAM_V1_6" $ do+      describe "toy5.sam" $ do+        it "Ensures that readSAM_V1_6 can read and parse a SAM file with only alignment fields." $ do+          readSAM_V1_6 "test/examples/toy5.sam" `shouldReturn` toy5sam+      describe "toy4.sam" $ do+        it "Ensures that readSAM_V1_6 can read and parse a SAM file with an optional alignment field." $ do+          readSAM_V1_6 "test/examples/toy4.sam" `shouldReturn` toy4sam+      describe "toy2.sam" $ do+        it "Ensures that readSAM_V1_6 can read and parse a SAM file with file-level metadata (@HD) and reference sequence dictionary (@SQ) optional header fields." $ do+          readSAM_V1_6 "test/examples/toy2.sam" `shouldReturn` toy2sam+      describe "toy1.sam" $ do+        it "Ensures that readSAM_V1_6 can read and parse a SAM file with multiple reference sequence dictionary (@SQ) optional header fields." $ do+          readSAM_V1_6 "test/examples/toy1.sam" `shouldReturn` toy1sam+  where+    toy1sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing+                       , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing },SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref2" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "40" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }])+                       , sam_v1_6_read_group = Nothing+                       , sam_v1_6_program = Nothing+                       , sam_v1_6_one_line_comment = Nothing+                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag  = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing+                                                                            }+                                                       ]+                       }+    toy2sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Just SAM_V1_6_File_Level_Metadata { sam_v1_6_file_level_metadata_format_version = SAM_V1_6_File_Level_Metadata_Format_Version { sam_v1_6_file_level_metadata_format_version_value = fromString "1.6" } , sam_v1_6_file_level_metadata_sorting_order = Just SAM_V1_6_File_Level_Metadata_Sorting_Order { sam_v1_6_file_level_metadata_sorting_order_value = fromString "coordinate" } , sam_v1_6_file_level_metadata_alignment_grouping = Nothing , sam_v1_6_file_level_metadata_subsorting_order = Nothing }+                       , sam_v1_6_reference_sequence_dictionary = Just (fromList [SAM_V1_6_Reference_Sequence_Dictionary { sam_v1_6_reference_sequence_dictionary_reference_sequence_name = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Name { sam_v1_6_reference_sequence_dictionary_reference_sequence_name_value = fromString "ref" } , sam_v1_6_reference_sequence_dictionary_reference_sequence_length = SAM_V1_6_Reference_Sequence_Dictionary_Reference_Sequence_Length { sam_v1_6_reference_sequence_dictionary_reference_sequence_length_value = fromString "45" } , sam_v1_6_reference_sequence_dictionary_reference_alternative_locus = Nothing , sam_v1_6_reference_sequence_dictionary_reference_alternative_reference_sequence_names = Nothing , sam_v1_6_reference_sequence_dictionary_genome_assembly_identifier = Nothing , sam_v1_6_reference_sequence_dictionary_description = Nothing , sam_v1_6_reference_sequence_dictionary_md5_checksum = Nothing , sam_v1_6_reference_sequence_dictionary_species = Nothing , sam_v1_6_reference_sequence_dictionary_molecule_topology = Nothing , sam_v1_6_reference_sequence_dictionary_uri = Nothing }])+                       , sam_v1_6_read_group = Nothing+                       , sam_v1_6_program = Nothing+                       , sam_v1_6_one_line_comment = Nothing+                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 99 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M2I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "3S6M1P1I4M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGATA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5S6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "GCCTAAGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just (fromString "ref,29,-,6H5M,17,0;") , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 2064 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 17 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Just (fromString "ref,9,+,5S6M,30,1;") , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 147 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGGCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Just 1 , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing+                                                                            }+                                                       ]+                       }+    toy4sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing+                       , sam_v1_6_reference_sequence_dictionary = Nothing+                       , sam_v1_6_read_group = Nothing+                       , sam_v1_6_program = Nothing+                       , sam_v1_6_one_line_comment = Nothing+                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Just SAM_V1_6_Alignment_BOPT { sam_v1_6_alignment_bopt_int8 = Nothing , sam_v1_6_alignment_bopt_word8 = Nothing , sam_v1_6_alignment_bopt_int16 = Nothing , sam_v1_6_alignment_bopt_word16 = Just SAM_V1_6_Alignment_BOPT_Word16 { sam_v1_6_alignment_bopt_word16_tag  = fromList [88,88] , sam_v1_6_alignment_bopt_word16_type = 83 , sam_v1_6_alignment_bopt_word16_value = fromList [49,50,53,54,49,44,50,44,50,48,44,49,49,50] } , sam_v1_6_alignment_bopt_int32 = Nothing , sam_v1_6_alignment_bopt_word32 = Nothing , sam_v1_6_alignment_bopt_float = Nothing } },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing+                                                                            }+                                                       ]+                       }+    toy5sam = SAM_V1_6 { sam_v1_6_file_level_metadata = Nothing+                       , sam_v1_6_reference_sequence_dictionary = Nothing+                       , sam_v1_6_read_group = Nothing+                       , sam_v1_6_program = Nothing+                       , sam_v1_6_one_line_comment = Nothing+                       , sam_v1_6_alignment = fromList [ SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 163 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 7 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "8M4I4M1D3M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 37 , sam_v1_6_alignment_tlen = 39 , sam_v1_6_alignment_seq = fromString "TTAGATAAAGAGGATACTG" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r002" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "1S2I6M1P1I1P1I4M2I" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AAAAGATAAGGGATAAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 9 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "5H6M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "AGCTAA" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r004" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 16 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6M14N1I5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ATAGCTCTCAGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r003" , sam_v1_6_alignment_flag = 16 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 29 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "6H5M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "TAGGC" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "r001" , sam_v1_6_alignment_flag = 83 , sam_v1_6_alignment_rname = fromString "ref" , sam_v1_6_alignment_pos = 37 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M" , sam_v1_6_alignment_rnext = fromString "=" , sam_v1_6_alignment_pnext = 7 , sam_v1_6_alignment_tlen = -39 , sam_v1_6_alignment_seq = fromString "CAGCGCCAT" , sam_v1_6_alignment_qual = fromString "*" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x1" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 1 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "20M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aggttttataaaacaaataa" , sam_v1_6_alignment_qual = fromString "????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x2" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 2 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "21M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ggttttataaaacaaataatt" , sam_v1_6_alignment_qual = fromString "?????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x3" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 6 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "9M4I13M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "ttataaaacAAATaattaagtctaca" , sam_v1_6_alignment_qual = fromString "??????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x4" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 10 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "25M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "CaaaTaattaagtctacagagcaac" , sam_v1_6_alignment_qual = fromString "?????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x5" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 12 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "24M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "aaTaattaagtctacagagcaact" , sam_v1_6_alignment_qual = fromString "????????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing },SAM_V1_6_Alignment { sam_v1_6_alignment_qname = fromString "x6" , sam_v1_6_alignment_flag = 0 , sam_v1_6_alignment_rname = fromString "ref2" , sam_v1_6_alignment_pos = 14 , sam_v1_6_alignment_mapq = 30 , sam_v1_6_alignment_cigar = fromString "23M" , sam_v1_6_alignment_rnext = fromString "*" , sam_v1_6_alignment_pnext = 0 , sam_v1_6_alignment_tlen = 0 , sam_v1_6_alignment_seq = fromString "Taattaagtctacagagcaacta" , sam_v1_6_alignment_qual = fromString "???????????????????????" , sam_v1_6_alignment_aopt = Nothing , sam_v1_6_alignment_iopt = Nothing , sam_v1_6_alignment_fopt = Nothing , sam_v1_6_alignment_zopt = Nothing , sam_v1_6_alignment_hopt = Nothing , sam_v1_6_alignment_bopt = Nothing+                                                                            }+                                                       ]+                       }