diff --git a/Data/Attoparsec.hs b/Data/Attoparsec.hs
--- a/Data/Attoparsec.hs
+++ b/Data/Attoparsec.hs
@@ -1,6 +1,6 @@
 -- |
 -- Module      :  Data.Attoparsec
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/ByteString.hs b/Data/Attoparsec/ByteString.hs
--- a/Data/Attoparsec/ByteString.hs
+++ b/Data/Attoparsec/ByteString.hs
@@ -1,6 +1,10 @@
+{-# LANGUAGE CPP #-}
+#if __GLASGOW_HASKELL__ >= 702
+{-# LANGUAGE Trustworthy #-}
+#endif
 -- |
 -- Module      :  Data.Attoparsec.ByteString
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -92,6 +96,7 @@
     ) where
 
 import Data.Attoparsec.Combinator
+import Data.List (intercalate)
 import qualified Data.Attoparsec.ByteString.Internal as I
 import qualified Data.Attoparsec.Internal as I
 import qualified Data.ByteString as B
@@ -218,6 +223,7 @@
 -- | Convert a 'Result' value to an 'Either' value. A 'T.Partial'
 -- result is treated as failure.
 eitherResult :: Result r -> Either String r
-eitherResult (T.Done _ r)     = Right r
-eitherResult (T.Fail _ _ msg) = Left msg
-eitherResult _                = Left "Result: incomplete input"
+eitherResult (T.Done _ r)        = Right r
+eitherResult (T.Fail _ [] msg)   = Left msg
+eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
+eitherResult _                   = Left "Result: incomplete input"
diff --git a/Data/Attoparsec/ByteString/Buffer.hs b/Data/Attoparsec/ByteString/Buffer.hs
--- a/Data/Attoparsec/ByteString/Buffer.hs
+++ b/Data/Attoparsec/ByteString/Buffer.hs
@@ -1,7 +1,7 @@
 {-# LANGUAGE BangPatterns, CPP #-}
 -- |
 -- Module      :  Data.Attoparsec.ByteString.Buffer
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/ByteString/Char8.hs b/Data/Attoparsec/ByteString/Char8.hs
--- a/Data/Attoparsec/ByteString/Char8.hs
+++ b/Data/Attoparsec/ByteString/Char8.hs
@@ -1,10 +1,13 @@
 {-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeFamilies,
     TypeSynonymInstances, GADTs #-}
+#if __GLASGOW_HASKELL__ >= 702
+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
+#endif
 {-# OPTIONS_GHC -fno-warn-orphans -fno-warn-warnings-deprecations #-}
 
 -- |
 -- Module      :  Data.Attoparsec.ByteString.Char8
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -67,7 +70,7 @@
 
     -- * Efficient string handling
     , I.string
-    , stringCI
+    , I.stringCI
     , skipSpace
     , skipWhile
     , I.take
@@ -165,16 +168,6 @@
 -- @0xA4@ (which is the Euro symbol in ISO-8859-15, but the generic
 -- currency sign in ISO-8859-1).  Haskell 'Char' values above U+00FF
 -- are truncated, so e.g. U+1D6B7 is truncated to the byte @0xB7@.
-
--- ASCII-specific but fast, oh yes.
-toLower :: Word8 -> Word8
-toLower w | w >= 65 && w <= 90 = w + 32
-          | otherwise          = w
-
--- | Satisfy a literal string, ignoring case.
-stringCI :: B.ByteString -> Parser B.ByteString
-stringCI = I.stringTransform (B8.map toLower)
-{-# INLINE stringCI #-}
 
 -- | Consume input as long as the predicate returns 'True', and return
 -- the consumed input.
diff --git a/Data/Attoparsec/ByteString/FastSet.hs b/Data/Attoparsec/ByteString/FastSet.hs
--- a/Data/Attoparsec/ByteString/FastSet.hs
+++ b/Data/Attoparsec/ByteString/FastSet.hs
@@ -3,7 +3,7 @@
 -----------------------------------------------------------------------------
 -- |
 -- Module      :  Data.Attoparsec.ByteString.FastSet
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/ByteString/Internal.hs b/Data/Attoparsec/ByteString/Internal.hs
--- a/Data/Attoparsec/ByteString/Internal.hs
+++ b/Data/Attoparsec/ByteString/Internal.hs
@@ -1,7 +1,7 @@
-{-# LANGUAGE BangPatterns, GADTs, OverloadedStrings, RecordWildCards #-}
+{-# LANGUAGE BangPatterns, GADTs, OverloadedStrings, RankNTypes, RecordWildCards #-}
 -- |
 -- Module      :  Data.Attoparsec.ByteString.Internal
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -46,7 +46,7 @@
     -- * Efficient string handling
     , skipWhile
     , string
-    , stringTransform
+    , stringCI
     , take
     , scan
     , runScanner
@@ -74,6 +74,7 @@
 import Data.Attoparsec.Internal.Fhthagn (inlinePerformIO)
 import Data.Attoparsec.Internal.Types hiding (Parser, Failure, Success)
 import Data.ByteString (ByteString)
+import Data.List (intercalate)
 import Data.Word (Word8)
 import Foreign.ForeignPtr (withForeignPtr)
 import Foreign.Ptr (castPtr, minusPtr, plusPtr)
@@ -139,19 +140,12 @@
     return . inlinePerformIO . withForeignPtr fp $ \p ->
         peek (castPtr $ p `plusPtr` o)
 
--- | Consume @n@ bytes of input, but succeed only if the predicate
--- returns 'True'.
-takeWith :: Int -> (ByteString -> Bool) -> Parser ByteString
-takeWith n0 p = do
-  let n = max n0 0
-  s <- ensure n
-  if p s
-    then advance n >> return s
-    else fail "takeWith"
-
 -- | Consume exactly @n@ bytes of input.
 take :: Int -> Parser ByteString
-take n = takeWith n (const True)
+take n0 = do
+  let n = max n0 0
+  s <- ensure n
+  advance n >> return s
 {-# INLINE take #-}
 
 -- | @string s@ parses a sequence of bytes that identically match
@@ -170,14 +164,57 @@
 -- before failing.  In attoparsec, the above parser will /succeed/ on
 -- that input, because the failed first branch will consume nothing.
 string :: ByteString -> Parser ByteString
-string s = takeWith (B.length s) (==s)
+string s = string_ (stringSuspended id) id s
 {-# INLINE string #-}
 
-stringTransform :: (ByteString -> ByteString) -> ByteString
-                -> Parser ByteString
-stringTransform f s = takeWith (B.length s) ((==f s) . f)
-{-# INLINE stringTransform #-}
+-- ASCII-specific but fast, oh yes.
+toLower :: Word8 -> Word8
+toLower w | w >= 65 && w <= 90 = w + 32
+          | otherwise          = w
 
+-- | Satisfy a literal string, ignoring case.
+stringCI :: ByteString -> Parser ByteString
+stringCI s = string_ (stringSuspended lower) lower s
+  where lower = B8.map toLower
+{-# INLINE stringCI #-}
+
+string_ :: (forall r. ByteString -> ByteString -> Buffer -> Pos -> More
+            -> Failure r -> Success ByteString r -> Result r)
+        -> (ByteString -> ByteString)
+        -> ByteString -> Parser ByteString
+string_ suspended f s0 = T.Parser $ \t pos more lose succ ->
+  let n = B.length s
+      s = f s0
+  in if lengthAtLeast pos n t
+     then if s == substring pos (Pos n) t
+          then succ t (pos + Pos n) more s
+          else lose t pos more [] "string"
+     else let t' = Buf.unsafeDrop (fromPos pos) t
+          in if t' `B.isPrefixOf` s
+             then suspended s (B.drop (B.length t') s) t pos more lose succ
+             else lose t pos more [] "string"
+{-# INLINE string_ #-}
+
+stringSuspended :: (ByteString -> ByteString)
+                -> ByteString -> ByteString -> Buffer -> Pos -> More
+                -> Failure r
+                -> Success ByteString r
+                -> Result r
+stringSuspended f s0 s t pos more lose succ =
+    runParser (demandInput_ >>= go) t pos more lose succ
+  where go s'0   = T.Parser $ \t' pos' more' lose' succ' ->
+          let m  = B.length s
+              s' = f s'0
+              n  = B.length s'
+          in if n >= m
+             then if B.unsafeTake m s' == s
+                  then succ' t' (pos' + Pos (B.length s0)) more' s0
+                  else lose' t' pos' more' [] "string"
+             else if s' == B.unsafeTake n s
+                  then stringSuspended f s0 (B.unsafeDrop n s)
+                       t' pos' more' lose' succ'
+                  else lose' t' pos' more' [] "string"
+
 -- | Skip past input for as long as the predicate returns 'True'.
 skipWhile :: (Word8 -> Bool) -> Parser ()
 skipWhile p = go
@@ -416,9 +453,10 @@
 -- @
 parseOnly :: Parser a -> ByteString -> Either String a
 parseOnly m s = case T.runParser m (buffer s) (Pos 0) Complete failK successK of
-                  Fail _ _ err -> Left err
-                  Done _ a     -> Right a
-                  _            -> error "parseOnly: impossible error!"
+                  Fail _ [] err   -> Left err
+                  Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)
+                  Done _ a        -> Right a
+                  _               -> error "parseOnly: impossible error!"
 {-# INLINE parseOnly #-}
 
 get :: Parser ByteString
@@ -465,7 +503,6 @@
     then succ t pos more (substring pos (Pos n) t)
     -- The uncommon case is kept out-of-line to reduce code size:
     else ensureSuspended n t pos more lose succ
--- Non-recursive so the bounds check can be inlined:
 {-# INLINE ensure #-}
 
 -- | Return both the result of a parse and the portion of the input
diff --git a/Data/Attoparsec/ByteString/Lazy.hs b/Data/Attoparsec/ByteString/Lazy.hs
--- a/Data/Attoparsec/ByteString/Lazy.hs
+++ b/Data/Attoparsec/ByteString/Lazy.hs
@@ -1,6 +1,11 @@
+{-# LANGUAGE CPP #-}
+#if __GLASGOW_HASKELL__ >= 702
+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
+#endif
+
 -- |
 -- Module      :  Data.Attoparsec.ByteString.Lazy
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -36,6 +41,7 @@
 
 import Control.DeepSeq (NFData(rnf))
 import Data.ByteString.Lazy.Internal (ByteString(..), chunk)
+import Data.List (intercalate)
 import qualified Data.ByteString as B
 import qualified Data.Attoparsec.ByteString as A
 import qualified Data.Attoparsec.Internal.Types as T
@@ -99,5 +105,6 @@
 
 -- | Convert a 'Result' value to an 'Either' value.
 eitherResult :: Result r -> Either String r
-eitherResult (Done _ r)     = Right r
-eitherResult (Fail _ _ msg) = Left msg
+eitherResult (Done _ r)        = Right r
+eitherResult (Fail _ [] msg)   = Left msg
+eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
diff --git a/Data/Attoparsec/Char8.hs b/Data/Attoparsec/Char8.hs
--- a/Data/Attoparsec/Char8.hs
+++ b/Data/Attoparsec/Char8.hs
@@ -1,6 +1,6 @@
 -- |
 -- Module      :  Data.Attoparsec.Char8
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/Combinator.hs b/Data/Attoparsec/Combinator.hs
--- a/Data/Attoparsec/Combinator.hs
+++ b/Data/Attoparsec/Combinator.hs
@@ -1,7 +1,10 @@
 {-# LANGUAGE BangPatterns, CPP #-}
+#if __GLASGOW_HASKELL__ >= 702
+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
+#endif
 -- |
 -- Module      :  Data.Attoparsec.Combinator
--- Copyright   :  Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2014
+-- Copyright   :  Daan Leijen 1999-2001, Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -33,6 +36,7 @@
     , satisfyElem
     , endOfInput
     , atEnd
+    , lookAhead
     ) where
 
 #if !MIN_VERSION_base(4,8,0)
@@ -129,7 +133,7 @@
 -- | @sepBy p sep@ applies /zero/ or more occurrences of @p@, separated
 -- by @sep@. Returns a list of the values returned by @p@.
 --
--- > commaSep p  = p `sepBy` (symbol ",")
+-- > commaSep p  = p `sepBy` (char ',')
 sepBy :: Alternative f => f a -> f s -> f [a]
 sepBy p s = liftA2 (:) p ((s *> sepBy1 p s) <|> pure []) <|> pure []
 {-# SPECIALIZE sepBy :: Parser ByteString a -> Parser ByteString s
@@ -141,7 +145,7 @@
 -- by @sep@. Returns a list of the values returned by @p@. The value
 -- returned by @p@ is forced to WHNF.
 --
--- > commaSep p  = p `sepBy'` (symbol ",")
+-- > commaSep p  = p `sepBy'` (char ',')
 sepBy' :: (MonadPlus m) => m a -> m s -> m [a]
 sepBy' p s = scan `mplus` return []
   where scan = liftM2' (:) p ((s >> sepBy1' p s) `mplus` return [])
@@ -153,7 +157,7 @@
 -- | @sepBy1 p sep@ applies /one/ or more occurrences of @p@, separated
 -- by @sep@. Returns a list of the values returned by @p@.
 --
--- > commaSep p  = p `sepBy1` (symbol ",")
+-- > commaSep p  = p `sepBy1` (char ',')
 sepBy1 :: Alternative f => f a -> f s -> f [a]
 sepBy1 p s = scan
     where scan = liftA2 (:) p ((s *> scan) <|> pure [])
@@ -166,7 +170,7 @@
 -- by @sep@. Returns a list of the values returned by @p@. The value
 -- returned by @p@ is forced to WHNF.
 --
--- > commaSep p  = p `sepBy1'` (symbol ",")
+-- > commaSep p  = p `sepBy1'` (char ',')
 sepBy1' :: (MonadPlus m) => m a -> m s -> m [a]
 sepBy1' p s = scan
     where scan = liftM2' (:) p ((s >> scan) `mplus` return [])
@@ -239,7 +243,14 @@
 -- | If a parser has returned a 'T.Partial' result, supply it with more
 -- input.
 feed :: Monoid i => IResult i r -> i -> IResult i r
-feed f@(Fail _ _ _) _ = f
+feed (Fail t ctxs msg) d = Fail (mappend t d) ctxs msg
 feed (Partial k) d    = k d
 feed (Done t r) d     = Done (mappend t d) r
 {-# INLINE feed #-}
+
+-- | Apply a parser without consuming any input.
+lookAhead :: Parser i a -> Parser i a
+lookAhead p = Parser $ \t pos more lose succ ->
+  let succ' t' _pos' more' = succ t' pos more'
+  in runParser p t pos more lose succ'
+{-# INLINE lookAhead #-}
diff --git a/Data/Attoparsec/Internal.hs b/Data/Attoparsec/Internal.hs
--- a/Data/Attoparsec/Internal.hs
+++ b/Data/Attoparsec/Internal.hs
@@ -1,7 +1,7 @@
 {-# LANGUAGE BangPatterns, ScopedTypeVariables #-}
 -- |
 -- Module      :  Data.Attoparsec.Internal
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -15,6 +15,7 @@
     ( compareResults
     , prompt
     , demandInput
+    , demandInput_
     , wantInput
     , endOfInput
     , atEnd
@@ -40,8 +41,8 @@
 compareResults (Partial _) (Partial _) = Nothing
 compareResults _ _ = Just False
 
--- | Ask for input.  If we receive any, pass it to a success
--- continuation, otherwise to a failure continuation.
+-- | Ask for input.  If we receive any, pass the augmented input to a
+-- success continuation, otherwise to a failure continuation.
 prompt :: Chunk t
        => State t -> Pos -> More
        -> (State t -> Pos -> More -> IResult t r)
@@ -68,11 +69,24 @@
 demandInput = Parser $ \t pos more lose succ ->
   case more of
     Complete -> lose t pos more [] "not enough input"
-    _ -> let lose' t' pos' more' = lose t' pos' more' [] "not enough input"
+    _ -> let lose' _ pos' more' = lose t pos' more' [] "not enough input"
              succ' t' pos' more' = succ t' pos' more' ()
          in prompt t pos more lose' succ'
 {-# SPECIALIZE demandInput :: Parser ByteString () #-}
 {-# SPECIALIZE demandInput :: Parser Text () #-}
+
+-- | Immediately demand more input via a 'Partial' continuation
+-- result.  Return the new input.
+demandInput_ :: Chunk t => Parser t t
+demandInput_ = Parser $ \t pos more lose succ ->
+  case more of
+    Complete -> lose t pos more [] "not enough input"
+    _ -> Partial $ \s ->
+         if nullChunk s
+         then lose t pos Complete [] "not enough input"
+         else succ (pappendChunk t s) pos more s
+{-# SPECIALIZE demandInput_ :: Parser ByteString ByteString #-}
+{-# SPECIALIZE demandInput_ :: Parser Text Text #-}
 
 -- | This parser always succeeds.  It returns 'True' if any input is
 -- available either immediately or on demand, and 'False' if the end
diff --git a/Data/Attoparsec/Internal/Types.hs b/Data/Attoparsec/Internal/Types.hs
--- a/Data/Attoparsec/Internal/Types.hs
+++ b/Data/Attoparsec/Internal/Types.hs
@@ -2,7 +2,7 @@
     Rank2Types, RecordWildCards, TypeFamilies #-}
 -- |
 -- Module      :  Data.Attoparsec.Internal.Types
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -70,10 +70,13 @@
     -- not yet been consumed (if any) when the parse succeeded.
 
 instance (Show i, Show r) => Show (IResult i r) where
-    show (Fail t stk msg) =
-      unwords [ "Fail", show t, show stk, show msg]
-    show (Partial _)          = "Partial _"
-    show (Done t r)       = unwords ["Done", show t, show r]
+    showsPrec d ir = showParen (d > 10) $
+      case ir of
+        (Fail t stk msg) -> showString "Fail" . f t . f stk . f msg
+        (Partial _)      -> showString "Partial _"
+        (Done t r)       -> showString "Done" . f t . f r
+      where f :: Show a => a -> ShowS
+            f x = showChar ' ' . showsPrec 11 x
 
 instance (NFData i, NFData r) => NFData (IResult i r) where
     rnf (Fail t stk msg) = rnf t `seq` rnf stk `seq` rnf msg
@@ -86,8 +89,8 @@
     fmap f (Partial k)      = Partial (fmap f . k)
     fmap f (Done t r)   = Done t (f r)
 
--- | The core parser type.  This is parameterised over the types @i@
--- of string being processed and @t@ of internal state representation.
+-- | The core parser type.  This is parameterised over the type @i@
+-- of string being processed.
 --
 -- This type is an instance of the following classes:
 --
diff --git a/Data/Attoparsec/Lazy.hs b/Data/Attoparsec/Lazy.hs
--- a/Data/Attoparsec/Lazy.hs
+++ b/Data/Attoparsec/Lazy.hs
@@ -1,6 +1,6 @@
 -- |
 -- Module      :  Data.Attoparsec.Lazy
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/Number.hs b/Data/Attoparsec/Number.hs
--- a/Data/Attoparsec/Number.hs
+++ b/Data/Attoparsec/Number.hs
@@ -1,7 +1,7 @@
 {-# LANGUAGE DeriveDataTypeable #-}
 -- |
 -- Module      :  Data.Attoparsec.Number
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/Text.hs b/Data/Attoparsec/Text.hs
--- a/Data/Attoparsec/Text.hs
+++ b/Data/Attoparsec/Text.hs
@@ -1,9 +1,12 @@
 {-# LANGUAGE BangPatterns, CPP, FlexibleInstances, TypeSynonymInstances #-}
+#if __GLASGOW_HASKELL__ >= 702
+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
+#endif
 {-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
 
 -- |
 -- Module      :  Data.Attoparsec.Text
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -135,6 +138,7 @@
 import Data.Bits (Bits, (.|.), shiftL)
 import Data.Char (isAlpha, isDigit, isSpace, ord)
 import Data.Int (Int8, Int16, Int32, Int64)
+import Data.List (intercalate)
 import Data.Text (Text)
 import Data.Word (Word8, Word16, Word32, Word64)
 import qualified Data.Attoparsec.Internal as I
@@ -261,9 +265,10 @@
 -- | Convert a 'Result' value to an 'Either' value. A 'Partial' result
 -- is treated as failure.
 eitherResult :: Result r -> Either String r
-eitherResult (T.Done _ r)     = Right r
-eitherResult (T.Fail _ _ msg) = Left msg
-eitherResult _                = Left "Result: incomplete input"
+eitherResult (T.Done _ r)        = Right r
+eitherResult (T.Fail _ [] msg)   = Left msg
+eitherResult (T.Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
+eitherResult _                   = Left "Result: incomplete input"
 
 -- | A predicate that matches either a carriage return @\'\\r\'@ or
 -- newline @\'\\n\'@ character.
diff --git a/Data/Attoparsec/Text/Buffer.hs b/Data/Attoparsec/Text/Buffer.hs
--- a/Data/Attoparsec/Text/Buffer.hs
+++ b/Data/Attoparsec/Text/Buffer.hs
@@ -3,7 +3,7 @@
 
 -- |
 -- Module      :  Data.Attoparsec.Text.Buffer
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/Text/FastSet.hs b/Data/Attoparsec/Text/FastSet.hs
--- a/Data/Attoparsec/Text/FastSet.hs
+++ b/Data/Attoparsec/Text/FastSet.hs
@@ -3,7 +3,7 @@
 ------------------------------------------------------------------------------
 -- |
 -- Module      :  Data.Attoparsec.FastSet
--- Copyright   :  Felipe Lessa 2010, Bryan O'Sullivan 2007-2014
+-- Copyright   :  Felipe Lessa 2010, Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  felipe.lessa@gmail.com
diff --git a/Data/Attoparsec/Text/Internal.hs b/Data/Attoparsec/Text/Internal.hs
--- a/Data/Attoparsec/Text/Internal.hs
+++ b/Data/Attoparsec/Text/Internal.hs
@@ -3,7 +3,7 @@
 {-# OPTIONS_GHC -fno-warn-orphans #-}
 -- |
 -- Module      :  Data.Attoparsec.Text.Internal
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -73,6 +73,7 @@
 import qualified Data.Attoparsec.Text.Buffer as Buf
 import Data.Attoparsec.Text.Buffer (Buffer, buffer)
 import Data.Char (chr, ord)
+import Data.List (intercalate)
 import Data.String (IsString(..))
 import Data.Text.Internal (Text(..))
 import Prelude hiding (getChar, succ, take, takeWhile)
@@ -159,9 +160,46 @@
 -- before failing.  In attoparsec, the above parser will /succeed/ on
 -- that input, because the failed first branch will consume nothing.
 string :: Text -> Parser Text
-string s = takeWith (T.length s) (==s)
+string s = string_ (stringSuspended id) id s
 {-# INLINE string #-}
 
+string_ :: (forall r. Text -> Text -> Buffer -> Pos -> More
+            -> Failure r -> Success Text r -> Result r)
+        -> (Text -> Text)
+        -> Text -> Parser Text
+string_ suspended f s0 = T.Parser $ \t pos more lose succ ->
+  let s  = f s0
+      ft = f (Buf.unbuffer t)
+  in case T.commonPrefixes s ft of
+       Nothing
+         | T.null s          -> succ t pos more T.empty
+         | T.null ft         -> suspended s s t pos more lose succ
+         | otherwise         -> lose t pos more [] "string"
+       Just (pfx,ssfx,tsfx)
+         | T.null ssfx       -> let l = Pos (T.lengthWord16 pfx)
+                                in succ t (pos + l) more (substring pos l t)
+         | not (T.null tsfx) -> lose t pos more [] "string"
+         | otherwise         -> suspended s ssfx t pos more lose succ
+{-# INLINE string_ #-}
+
+stringSuspended :: (Text -> Text)
+                -> Text -> Text -> Buffer -> Pos -> More
+                -> Failure r
+                -> Success Text r
+                -> Result r
+stringSuspended f s000 s0 t0 pos0 more0 lose0 succ0 =
+    runParser (demandInput_ >>= go) t0 pos0 more0 lose0 succ0
+  where
+    go s' = T.Parser $ \t pos more lose succ ->
+      let s = f s'
+      in case T.commonPrefixes s0 s of
+        Nothing         -> lose t pos more [] "string"
+        Just (_pfx,ssfx,tsfx)
+          | T.null ssfx -> let l = Pos (T.lengthWord16 s000)
+                           in succ t (pos + l) more (substring pos l t)
+          | T.null tsfx -> stringSuspended f s000 ssfx t pos more lose succ
+          | otherwise   -> lose t pos more [] "string"
+
 -- | Satisfy a literal string, ignoring case.
 --
 -- Note: this function is currently quite inefficient. Unicode case
@@ -184,16 +222,8 @@
 
 -- | Satisfy a literal string, ignoring case for characters in the ASCII range.
 asciiCI :: Text -> Parser Text
-asciiCI input = do
-  (k,t) <- ensure n
-  if asciiToLower t == s
-    then advance k >> return t
-    else fail "asciiCI"
+asciiCI s = string_ (stringSuspended asciiToLower) asciiToLower s
   where
-    n = T.length input
-    s = asciiToLower input
-
-    -- convert letters in the ASCII range to lower-case
     asciiToLower = T.map f
       where
         offset = ord 'a' - ord 'A'
@@ -429,9 +459,10 @@
 -- @
 parseOnly :: Parser a -> Text -> Either String a
 parseOnly m s = case runParser m (buffer s) 0 Complete failK successK of
-                  Fail _ _ err -> Left err
-                  Done _ a     -> Right a
-                  _            -> error "parseOnly: impossible error!"
+                  Fail _ [] err   -> Left err
+                  Fail _ ctxs err -> Left (intercalate " > " ctxs ++ ": " ++ err)
+                  Done _ a        -> Right a
+                  _               -> error "parseOnly: impossible error!"
 {-# INLINE parseOnly #-}
 
 get :: Parser Text
@@ -476,7 +507,6 @@
       Just n' -> succ t pos more (n', substring pos n' t)
       -- The uncommon case is kept out-of-line to reduce code size:
       Nothing -> ensureSuspended n t pos more lose succ
--- Non-recursive so the bounds check can be inlined:
 {-# INLINE ensure #-}
 
 -- | Return both the result of a parse and the portion of the input
@@ -487,6 +517,8 @@
                               (substring pos (pos'-pos) t', a)
   in runParser p t pos more lose succ'
 
+-- | Ensure that at least @n@ code points of input are available.
+-- Returns the number of words consumed while traversing.
 lengthAtLeast :: Pos -> Int -> Buffer -> Maybe Pos
 lengthAtLeast pos n t = go 0 (fromPos pos)
   where go i !p
diff --git a/Data/Attoparsec/Text/Lazy.hs b/Data/Attoparsec/Text/Lazy.hs
--- a/Data/Attoparsec/Text/Lazy.hs
+++ b/Data/Attoparsec/Text/Lazy.hs
@@ -1,7 +1,12 @@
+{-# LANGUAGE CPP #-}
+#if __GLASGOW_HASKELL__ >= 702
+{-# LANGUAGE Trustworthy #-} -- Imports internal modules
+#endif
+
 {-# OPTIONS_GHC -fno-warn-warnings-deprecations #-}
 -- |
 -- Module      :  Data.Attoparsec.Text.Lazy
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
@@ -36,6 +41,7 @@
     ) where
 
 import Control.DeepSeq (NFData(rnf))
+import Data.List (intercalate)
 import Data.Text.Lazy.Internal (Text(..), chunk)
 import qualified Data.Attoparsec.Internal.Types as T
 import qualified Data.Attoparsec.Text as A
@@ -54,11 +60,7 @@
               -- ^ The parse succeeded.  The 'Text' is the
               -- input that had not yet been consumed (if any) when
               -- the parse succeeded.
-
-instance Show r => Show (Result r) where
-    show (Fail bs stk msg) =
-        "Fail " ++ show bs ++ " " ++ show stk ++ " " ++ show msg
-    show (Done bs r)       = "Done " ++ show bs ++ " " ++ show r
+    deriving (Show)
 
 instance NFData r => NFData (Result r) where
     rnf (Fail bs ctxs msg) = rnf bs `seq` rnf ctxs `seq` rnf msg
@@ -94,5 +96,6 @@
 
 -- | Convert a 'Result' value to an 'Either' value.
 eitherResult :: Result r -> Either String r
-eitherResult (Done _ r)     = Right r
-eitherResult (Fail _ _ msg) = Left msg
+eitherResult (Done _ r)        = Right r
+eitherResult (Fail _ [] msg)   = Left msg
+eitherResult (Fail _ ctxs msg) = Left (intercalate " > " ctxs ++ ": " ++ msg)
diff --git a/Data/Attoparsec/Types.hs b/Data/Attoparsec/Types.hs
--- a/Data/Attoparsec/Types.hs
+++ b/Data/Attoparsec/Types.hs
@@ -1,6 +1,6 @@
 -- |
 -- Module      :  Data.Attoparsec.Types
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/Data/Attoparsec/Zepto.hs b/Data/Attoparsec/Zepto.hs
--- a/Data/Attoparsec/Zepto.hs
+++ b/Data/Attoparsec/Zepto.hs
@@ -1,8 +1,12 @@
+{-# LANGUAGE CPP #-}
+#if __GLASGOW_HASKELL__ >= 702
+{-# LANGUAGE Trustworthy #-} -- Data.ByteString.Unsafe
+#endif
 {-# LANGUAGE BangPatterns, MagicHash, UnboxedTuples #-}
 
 -- |
 -- Module      :  Data.Attoparsec.Zepto
--- Copyright   :  Bryan O'Sullivan 2007-2014
+-- Copyright   :  Bryan O'Sullivan 2007-2015
 -- License     :  BSD3
 --
 -- Maintainer  :  bos@serpentine.com
diff --git a/attoparsec.cabal b/attoparsec.cabal
--- a/attoparsec.cabal
+++ b/attoparsec.cabal
@@ -1,12 +1,12 @@
 name:            attoparsec
-version:         0.12.1.3
+version:         0.12.1.4
 license:         BSD3
 license-file:    LICENSE
 category:        Text, Parsing
 author:          Bryan O'Sullivan <bos@serpentine.com>
 maintainer:      Bryan O'Sullivan <bos@serpentine.com>
 stability:       experimental
-tested-with:     GHC == 7.0, GHC == 7.2, GHC == 7.4, GHC == 7.6, GHC == 7.8
+tested-with:     GHC == 7.0, GHC == 7.2, GHC == 7.4, GHC == 7.6, GHC == 7.8, GHC == 7.10
 synopsis:        Fast combinator parsing for bytestrings and text
 cabal-version:   >= 1.8
 homepage:        https://github.com/bos/attoparsec
@@ -53,6 +53,8 @@
                    Data.Attoparsec.ByteString.Lazy
                    Data.Attoparsec.Char8
                    Data.Attoparsec.Combinator
+                   Data.Attoparsec.Internal
+                   Data.Attoparsec.Internal.Types
                    Data.Attoparsec.Lazy
                    Data.Attoparsec.Number
                    Data.Attoparsec.Text
@@ -62,9 +64,7 @@
   other-modules:   Data.Attoparsec.ByteString.Buffer
                    Data.Attoparsec.ByteString.FastSet
                    Data.Attoparsec.ByteString.Internal
-                   Data.Attoparsec.Internal
                    Data.Attoparsec.Internal.Fhthagn
-                   Data.Attoparsec.Internal.Types
                    Data.Attoparsec.Text.Buffer
                    Data.Attoparsec.Text.FastSet
                    Data.Attoparsec.Text.Internal
diff --git a/benchmarks/Benchmarks.hs b/benchmarks/Benchmarks.hs
--- a/benchmarks/Benchmarks.hs
+++ b/benchmarks/Benchmarks.hs
@@ -13,6 +13,7 @@
 import Text.Parsec.Text.Lazy ()
 import qualified Warp
 import qualified Aeson
+import qualified Genome
 import qualified Data.Attoparsec.ByteString as AB
 import qualified Data.Attoparsec.ByteString.Char8 as AC
 import qualified Data.Attoparsec.ByteString.Lazy as ABL
@@ -80,6 +81,7 @@
      , bench "long" $ nf (AB.parse quotedString) b
      ]
    , aeson
+   , Genome.genome
    , headersBS
    , headersT
    , Links.links
diff --git a/benchmarks/Genome.hs b/benchmarks/Genome.hs
new file mode 100644
--- /dev/null
+++ b/benchmarks/Genome.hs
@@ -0,0 +1,75 @@
+{-# LANGUAGE OverloadedStrings #-}
+
+module Genome
+    (
+      genome
+    ) where
+
+import Control.Applicative
+import Criterion.Main
+import Data.ByteString (ByteString)
+import qualified Data.ByteString.Char8 as B8
+import qualified Data.ByteString.Lazy.Char8 as L8
+import Data.Attoparsec.ByteString.Char8 as B
+import qualified Data.Attoparsec.ByteString.Lazy as BL
+import Data.Text (Text)
+import qualified Data.Text as T
+import qualified Data.Text.Lazy as TL
+import Data.Attoparsec.Text as T
+import qualified Data.Attoparsec.Text.Lazy as TL
+import Common (rechunkBS, rechunkT)
+
+genome :: Benchmark
+genome = bgroup "genome" [
+    bgroup "bytestring" [
+        bench "s" $ nf (map (B.parse searchBS)) (B8.tails geneB)
+      , bench "l" $ nf (map (BL.parse searchBS)) (L8.tails geneBL)
+      , bgroup "CI" [
+          bench "s" $ nf (map (B.parse searchBSCI)) (B8.tails geneB)
+        , bench "l" $ nf (map (BL.parse searchBSCI)) (L8.tails geneBL)
+      ]
+    ]
+  , bgroup "text" [
+        bench "s" $ nf (map (T.parse searchT)) (T.tails geneT)
+      , bench "l" $ nf (map (TL.parse searchT)) (TL.tails geneTL)
+      , bgroup "CI" [
+          bench "s" $ nf (map (T.parse searchTCI)) (T.tails geneT)
+        , bench "l" $ nf (map (TL.parse searchTCI)) (TL.tails geneTL)
+      ]
+    ]
+  ]
+  where geneB  = B8.pack gene
+        geneBL = rechunkBS 4 geneB
+        geneT  = T.pack gene
+        geneTL = rechunkT 4 geneT
+
+searchBS :: B.Parser ByteString
+searchBS = "caac" *> ("aaca" <|> "aact")
+
+searchBSCI :: B.Parser ByteString
+searchBSCI = B.stringCI "CAAC" *> (B.stringCI "AACA" <|> B.stringCI "AACT")
+
+searchT :: T.Parser Text
+searchT = "caac" *> ("aaca" <|> "aact")
+
+searchTCI :: T.Parser Text
+searchTCI = T.asciiCI "CAAC" *> (T.asciiCI "AACA" <|> T.asciiCI "AACT")
+
+-- Dictyostelium discoideum developmental protein DG1094 (gacT) gene,
+-- partial cds. http://www.ncbi.nlm.nih.gov/nuccore/AF081586.1
+
+gene :: String
+gene = "atcgatttagaaagatacaaagatagaaccatcaataataaacaagagaagagagcaagt\
+       \agagatattaataaagagattgaaagagagattgaaaagaagagattatcaccaagagaa\
+       \agattaaatttatttggtctttcttcctcatcttcatcagtgaattcaacattaacaaga\
+       \tctacagcaaatattatctctacaatagacggtagtggaggtagtaatcgtaatagtaaa\
+       \aattatggtaatggctcatcctcctcctcaaatagaagatatagtaatactattaatcaa\
+       \caattacaaatgcaattacaacaacttcaaatccaacaacaacaatatcaacaaactcaa\
+       \caatctcaaataccattacaatatcaacaacaacaacagcaacaacaacaacaaaccact\
+       \acaactacaactacatcaagtggtagtaatagattctcttcaaatagatataaaccagtt\
+       \gatcttacacaatcatcttcaaactttcgttattcacgtgaaatttatgatgatgattat\
+       \tattcaaataataatttaatgatgtttggtaatgagcaaccaaatcaaacaccaatttct\
+       \gtatcatcttcatctgcattcacacgtcaaagatctcaaagttgctttgaaccagagaat\
+       \cttgtattgctacaacaacaatatcaacaatatcaacaacaacaacaacaacaacaacaa\
+       \attccattccaagcaaatccacaatatagtaatgctgttattgaacaaaaattggatcaa\
+       \attagagataccattaataatttacatagagataaccgagtctctaga"
diff --git a/changelog.md b/changelog.md
--- a/changelog.md
+++ b/changelog.md
@@ -1,3 +1,12 @@
+0.12.1.4
+
+* Fixed a case where the string parser would consume an unnecessary
+  amount of input before failing a match, when it could bail much
+  earlier (https://github.com/bos/attoparsec/issues/97)
+
+* Added more context to error messages
+  (https://github.com/bos/attoparsec/pull/79)
+
 0.12.1.3
 
 * Fixed incorrect tracking of Text lengths
diff --git a/tests/QC/Combinator.hs b/tests/QC/Combinator.hs
--- a/tests/QC/Combinator.hs
+++ b/tests/QC/Combinator.hs
@@ -1,8 +1,11 @@
+{-# LANGUAGE OverloadedStrings #-}
+
 module QC.Combinator where
 
 import Control.Applicative
+import Data.Maybe (fromJust, isJust)
 import Data.Word (Word8)
-import QC.Common (Repack, parseBS, repackBS)
+import QC.Common (Repack, parseBS, repackBS, toLazyBS)
 import Test.Framework (Test)
 import Test.Framework.Providers.QuickCheck2 (testProperty)
 import Test.QuickCheck
@@ -22,6 +25,13 @@
     (length <$> parseBS (C.count n (P.string s)) input) == Just n
   where input = repackBS rs (B.concat (replicate (n+1) s))
 
+lookAhead :: NonEmptyList Word8 -> Bool
+lookAhead (NonEmpty xs) =
+  let ys = B.pack xs
+      withLookAheadThenConsume = (\x y -> (x, y)) <$> C.lookAhead (P.string ys) <*> P.string ys
+      mr = parseBS withLookAheadThenConsume $ toLazyBS ys
+  in isJust mr && fst (fromJust mr) == snd (fromJust mr)
+
 match :: Int -> NonNegative Int -> NonNegative Int -> Repack -> Bool
 match n (NonNegative x) (NonNegative y) rs =
     parseBS (P.match parser) (repackBS rs input) == Just (input, n)
@@ -35,5 +45,6 @@
 tests = [
     testProperty "choice" choice
   , testProperty "count" count
+  , testProperty "lookAhead" lookAhead
   , testProperty "match" match
   ]
diff --git a/tests/QC/Rechunked.hs b/tests/QC/Rechunked.hs
--- a/tests/QC/Rechunked.hs
+++ b/tests/QC/Rechunked.hs
@@ -29,7 +29,7 @@
 
 rechunkSizes :: Int -> Gen [Int]
 rechunkSizes n0 = shuffle =<< loop [] (0:repeat 1) n0
-  where loop _ [] _ = error "it's 2014, where's my Stream type?"
+  where loop _ [] _ = error "it's 2015, where's my Stream type?"
         loop acc (lb:lbs) n
           | n <= 0 = shuffle (reverse acc)
           | otherwise = do