ViennaRNA-bindings 0.233.1.2 → 0.233.2.0

raw patch · 10 files changed

+132/−99 lines, 10 filesdep +bytestringPVP: major bump suggested

API removals or changes: PVP suggests a major version bump

Dependencies added: bytestring

API changes (from Hackage documentation)

Files

• BioInf/ViennaRNA/Bindings.hs +22/−21
• BioInf/ViennaRNA/Bindings/FFI/Centroid.chs +14/−7
• BioInf/ViennaRNA/Bindings/FFI/CoFold.chs +19/−17
• BioInf/ViennaRNA/Bindings/FFI/Duplex.chs +6/−5
• BioInf/ViennaRNA/Bindings/FFI/Fold.chs +23/−22
• BioInf/ViennaRNA/Bindings/FFI/PartFunc.chs +22/−20
• C/ffiwrap_centroid.c +3/−3
• ViennaRNA-bindings.cabal +6/−2
• changelog.md +5/−0
• tests/properties.hs +12/−2

@@ -10,38 +10,39 @@   , Duplex (..)   ) where +import           Data.ByteString.Char8 import qualified Data.Array.IArray as A -import BioInf.ViennaRNA.Bindings.FFI.Centroid as FFI-import BioInf.ViennaRNA.Bindings.FFI.CoFold   as FFI-import BioInf.ViennaRNA.Bindings.FFI.Duplex   as FFI-import BioInf.ViennaRNA.Bindings.FFI.Fold     as FFI-import BioInf.ViennaRNA.Bindings.FFI.PartFunc as FFI+import           BioInf.ViennaRNA.Bindings.FFI.Centroid as FFI+import           BioInf.ViennaRNA.Bindings.FFI.CoFold   as FFI+import           BioInf.ViennaRNA.Bindings.FFI.Duplex   as FFI+import           BioInf.ViennaRNA.Bindings.FFI.Fold     as FFI+import           BioInf.ViennaRNA.Bindings.FFI.PartFunc as FFI  -- | Fold a sequence into an optimal secondary structure. Returns a pair of -- energy and structure. -mfe :: String -> IO (Double,String)+mfe :: ByteString -> IO (Double,ByteString) mfe = ffiFold -mfeTemp :: Double -> String -> IO (Double,String)+mfeTemp :: Double -> ByteString -> IO (Double,ByteString) mfeTemp = ffiFoldTemp -circmfe :: String -> IO (Double,String)+circmfe :: ByteString -> IO (Double,ByteString) circmfe = ffiCircFold  -- | Given a sequence and a structure, returns the energy of the -- sequence/structure pair. -eos :: String -> String -> IO Double+eos :: ByteString -> ByteString -> IO Double eos i s = ffiEnergyOfStructure i s 0 -eosTemp :: Double -> String -> String -> IO Double+eosTemp :: Double -> ByteString -> ByteString -> IO Double eosTemp t i s = ffiEnergyOfStructureTemp t i s 0  -- | Energy of a circular structure -eosCirc :: String -> String -> IO Double+eosCirc :: ByteString -> ByteString -> IO Double eosCirc i s = ffiEnergyOfCircStructure i s 0  -- | Given a string, calculates the partition function for said string. Returns@@ -49,46 +50,46 @@ -- annotated with the strength of the potential pairing, and the whole base -- pair probability table. -part :: String -> IO (Double,String,A.Array (Int,Int) Double)+part :: ByteString -> IO (Double,ByteString,A.Array (Int,Int) Double) part = ffi_pf_fold -partConstrained :: String -> String -> IO (Double, String, A.Array (Int,Int) Double)+partConstrained :: ByteString -> ByteString -> IO (Double, ByteString, A.Array (Int,Int) Double) partConstrained = ffi_pf_fold_constrained -circPart :: String -> IO (Double,String,A.Array (Int,Int) Double)+circPart :: ByteString -> IO (Double,ByteString,A.Array (Int,Int) Double) circPart = ffi_pf_circ_fold -circPartConstrained :: String -> String -> IO (Double, String, A.Array (Int,Int) Double)+circPartConstrained :: ByteString -> ByteString -> IO (Double, ByteString, A.Array (Int,Int) Double) circPartConstrained = ffi_pf_circ_fold_constrained  -- | Centroid structure -centroidTemp :: Double -> String -> IO (Double,String)+centroidTemp :: Double -> ByteString -> IO (Double,ByteString,Double) centroidTemp t i = ffiCentroidTemp t i  -- * RNAcofold  -- | Energy of struct for cofolded structures. -coeos :: String -> String -> Int -> IO Double+coeos :: ByteString -> ByteString -> Int -> IO Double coeos i s c = ffiCoEnergyOfStructure c i s 0  -- | mfe of co-folded structure -comfe :: String -> Int -> IO (Double,String)+comfe :: ByteString -> Int -> IO (Double,ByteString) comfe s c = ffiCoFold c s  -- | Cofolded partition function. Makes the set of different partfun values -- from cofoldF available. -copart :: String -> Int -> IO (CofoldF,String,A.Array (Int,Int) Double)+copart :: ByteString -> Int -> IO (CofoldF,ByteString,A.Array (Int,Int) Double) copart s c = ffiCoPartitionFunction  c s -copartConstrained :: String -> String -> Int -> IO (CofoldF,String,A.Array (Int,Int) Double)+copartConstrained :: ByteString -> ByteString -> Int -> IO (CofoldF,ByteString,A.Array (Int,Int) Double) copartConstrained sq str c = ffiCoPartitionConstrained c sq str  -- | Fold a duplex structure -duplexFold :: String -> String -> IO Duplex+duplexFold :: ByteString -> ByteString -> IO Duplex duplexFold = ffiDuplexFold 

@@ -1,10 +1,13 @@  module BioInf.ViennaRNA.Bindings.FFI.Centroid where +import Data.ByteString.Char8 as BS import Foreign.C.String import Foreign.C.Types import Foreign.Marshal.Alloc+import Foreign.Marshal.Utils import Foreign.Ptr+import Foreign.Storable import GHC.Float import Unsafe.Coerce @@ -16,15 +19,19 @@   -ffiCentroidTemp :: Double -> String -> IO (Double,String)+ffiCentroidTemp :: Double -> ByteString -> IO (Double,ByteString,Double) ffiCentroidTemp t inp =-  withCAString inp $ \cinp ->-  withCAString inp $ \struc -> do-  e <- fold_centroid_p (realToFrac t) cinp struc-  s <- peekCAString struc-  return (cd2d e, s)+  if BS.null inp+    then return (0,BS.empty,0)+    else useAsCString inp $ \cinp ->+         useAsCString inp $ \struc ->+         with (0 :: CDouble) $ \dist -> do+           e <- if BS.null inp then return 0 else fold_centroid_p (realToFrac t) cinp struc dist+           s <- packCString struc+           d <- peek dist+           return (cd2d e, s, cd2d d)   -foreign import ccall "ffiwrap_centroid_temp" fold_centroid_p :: CDouble -> CString -> CString -> IO CDouble+foreign import ccall "ffiwrap_centroid_temp" fold_centroid_p :: CDouble -> CString -> CString -> Ptr CDouble -> IO CDouble 

@@ -9,6 +9,7 @@  import           Control.Applicative import           Control.Monad+import           Data.ByteString.Char8 (ByteString, useAsCString, packCString) import           Foreign.C.String import           Foreign.C.Types import           Foreign.Marshal.Alloc@@ -17,6 +18,7 @@ import           Foreign.Storable import           GHC.Float import qualified Data.Array.IArray as A+import qualified Data.ByteString.Char8 as BS import           Unsafe.Coerce  import           BioInf.ViennaRNA.Bindings.FFI.Utils@@ -50,36 +52,36 @@  -- | -ffiCoFold :: Int -> String -> IO (Double,String)-ffiCoFold cp inp = withCAString inp $ \cinp ->-                   withCAString inp $ \struc -> do+ffiCoFold :: Int -> ByteString -> IO (Double,ByteString)+ffiCoFold cp inp = useAsCString inp $ \cinp ->+                   useAsCString inp $ \struc -> do   setCutPoint cp   e <- {#call cofold #} cinp struc-  s <- peekCAString struc+  s <- packCString struc   return (cf2d e, s)  -- | -ffiCoEnergyOfStructure :: Int -> String -> String -> Int -> IO Double+ffiCoEnergyOfStructure :: Int -> ByteString -> ByteString -> Int -> IO Double ffiCoEnergyOfStructure cp inp struc verb =-  withCAString inp   $ \i ->-  withCAString struc $ \s ->+  useAsCString inp   $ \i ->+  useAsCString struc $ \s ->     setCutPoint cp     >>  {#call energy_of_structure #} i s (fromIntegral verb :: CInt)     >>= (return . cf2d)  -- | -ffiCoPartitionFunction :: Int -> String -> IO (CofoldF,String,A.Array (Int,Int) Double)+ffiCoPartitionFunction :: Int -> ByteString -> IO (CofoldF,ByteString,A.Array (Int,Int) Double) ffiCoPartitionFunction cutpoint i =-  withCAString i $ \ci ->-  withCAString i $ \cs ->+  useAsCString i $ \ci ->+  useAsCString i $ \cs ->   alloca         $ \ptr -> do   setCutPoint cutpoint-  let n = length i+  let n = BS.length i   let z = n * (n+1) `div` 2 +1   eF <- co_pf_fold_p ptr ci cs >> peek ptr-  s  <- peekCAString cs+  s  <- packCString cs   bp <- {#call export_co_bppm #}   xs <- peekArray z (bp :: Ptr CDouble)   let ar = A.accumArray (const id) 0 ((1,1),(n,n)) $ zip [ (ii,jj) | ii <- [n,n-1..1], jj <- [n,n-1..ii]] (drop 1 $ map unsafeCoerce xs)@@ -87,16 +89,16 @@  -- | Constrained partition function -ffiCoPartitionConstrained :: Int -> String -> String -> IO (CofoldF,String,A.Array (Int,Int) Double)+ffiCoPartitionConstrained :: Int -> ByteString -> ByteString -> IO (CofoldF,ByteString,A.Array (Int,Int) Double) ffiCoPartitionConstrained cutpoint sq st =-  withCAString sq $ \csq ->-  withCAString st $ \cst ->+  useAsCString sq $ \csq ->+  useAsCString st $ \cst ->   alloca          $ \ptr -> do   setCutPoint cutpoint-  let n = length sq+  let n = BS.length sq   let z = n * (n+1) `div` 2 +1   eF <- co_pf_fold_constrained_p ptr csq cst 1 >> peek ptr-  s  <- peekCAString cst+  s  <- packCString cst   bp <- {#call export_co_bppm #}   xs <- peekArray z (bp :: Ptr CDouble)   let ar = A.accumArray (const id) 0 ((1,1),(n,n)) $ zip [ (ii,jj) | ii <- [n,n-1..1], jj <- [n,n-1..ii]] (drop 1 $ map unsafeCoerce xs)

@@ -6,6 +6,7 @@  import           Control.Applicative import           Control.Monad+import           Data.ByteString.Char8 import           Foreign.C.String import           Foreign.C.Types import           Foreign.Marshal.Alloc@@ -29,7 +30,7 @@   { i                 :: {-# UNPACK #-} !Int   , j                 :: {-# UNPACK #-} !Int   , end               :: {-# UNPACK #-} !Int-  , structure         ::                !String+  , structure         ::                !ByteString   , energy            :: {-# UNPACK #-} !Double   , energyBacktrack   :: {-# UNPACK #-} !Double   , openingBacktrackX :: {-# UNPACK #-} !Double@@ -52,7 +53,7 @@     <$> liftM fromIntegral ({# get duplexT->i #} p)     <*> liftM fromIntegral ({# get duplexT->j #} p)     <*> liftM fromIntegral ({# get duplexT->end #} p)-    <*> (peekCAString =<<  ({# get duplexT->structure #} p))+    <*> (packCString =<<   ({# get duplexT->structure #} p))     <*> liftM realToFrac   ({# get duplexT->energy #} p)     <*> liftM realToFrac   ({# get duplexT->energy_backtrack #} p)     <*> liftM realToFrac   ({# get duplexT->opening_backtrack_x #} p)@@ -66,10 +67,10 @@     <*> liftM fromIntegral ({# get duplexT->qb #} p)     <*> liftM fromIntegral ({# get duplexT->qe #} p) -ffiDuplexFold :: String -> String -> IO Duplex+ffiDuplexFold :: ByteString -> ByteString -> IO Duplex ffiDuplexFold l r =-  withCAString l $ \cl  ->-  withCAString r $ \cr  ->+  useAsCString l $ \cl  ->+  useAsCString r $ \cr  ->   alloca         $ \ptr -> do   d <- duplexfold_p ptr cl cr >> peek ptr   return d

@@ -1,6 +1,7 @@  module BioInf.ViennaRNA.Bindings.FFI.Fold where +import Data.ByteString.Char8 as BS import Foreign.C.String import Foreign.C.Types import Foreign.Marshal.Alloc@@ -14,50 +15,50 @@  #include "ViennaRNA/fold.h" -ffiFold :: String -> IO (Double,String)-ffiFold inp = withCAString inp $ \cinp ->-              withCAString inp $ \struc -> do-  e <- {#call fold #} cinp struc-  s <- peekCAString struc+ffiFold :: ByteString -> IO (Double,ByteString)+ffiFold inp = useAsCString inp $ \cinp ->+              useAsCString inp $ \struc -> do+  e <- if BS.null inp then return 0 else {#call fold #} cinp struc+  s <- packCString struc   return (cf2d e, s) -ffiEnergyOfStructure :: String -> String -> Int -> IO Double+ffiEnergyOfStructure :: ByteString -> ByteString -> Int -> IO Double ffiEnergyOfStructure inp struc verb =-  withCAString inp   $ \i ->-  withCAString struc $ \s ->+  useAsCString inp   $ \i ->+  useAsCString struc $ \s ->     setCutPoint (-1)     >>  {#call energy_of_structure #} i s (fromIntegral verb :: CInt)     >>= (return . cf2d) -ffiEnergyOfCircStructure :: String -> String -> Int -> IO Double+ffiEnergyOfCircStructure :: ByteString -> ByteString -> Int -> IO Double ffiEnergyOfCircStructure inp struc verb =-  withCAString inp   $ \i ->-  withCAString struc $ \s ->+  useAsCString inp   $ \i ->+  useAsCString struc $ \s ->     setCutPoint (-1)     >>  {#call energy_of_circ_structure #} i s (fromIntegral verb :: CInt)     >>= (return . cf2d) -ffiCircFold :: String -> IO (Double,String)-ffiCircFold inp = withCAString inp $ \cinp ->-                  withCAString inp $ \struc -> do+ffiCircFold :: ByteString -> IO (Double,ByteString)+ffiCircFold inp = useAsCString inp $ \cinp ->+                  useAsCString inp $ \struc -> do   e <- {#call circfold #} cinp struc-  s <- peekCAString struc+  s <- packCString struc   return (cf2d e, s)   -ffiFoldTemp :: Double -> String -> IO (Double,String)+ffiFoldTemp :: Double -> ByteString -> IO (Double,ByteString) ffiFoldTemp t inp =-  withCAString inp $ \cinp ->-  withCAString inp $ \struc -> do+  useAsCString inp $ \cinp ->+  useAsCString inp $ \struc -> do   e <- fold_temp_p (realToFrac t) cinp struc-  s <- peekCAString struc+  s <- packCString struc   return (cf2d e, s) -ffiEnergyOfStructureTemp :: Double -> String -> String -> Int -> IO Double+ffiEnergyOfStructureTemp :: Double -> ByteString -> ByteString -> Int -> IO Double ffiEnergyOfStructureTemp t inp struc verb =-  withCAString inp   $ \i ->-  withCAString struc $ \s ->+  useAsCString inp   $ \i ->+  useAsCString struc $ \s ->     setCutPoint (-1)     >>  eos_temp_p (realToFrac t) i s (fromIntegral verb :: CInt)     >>= (return . cf2d)

@@ -6,6 +6,8 @@   , ffi_pf_circ_fold_constrained   ) where +import           Data.ByteString.Char8 (ByteString, packCString, useAsCString)+import qualified Data.ByteString.Char8 as BS import           Foreign.C.String import           Foreign.C.Types import           Foreign.Marshal.Alloc@@ -21,53 +23,53 @@  #include "ViennaRNA/part_func.h" -ffi_pf_fold :: String -> IO (Double,String,A.Array (Int,Int) Double)+ffi_pf_fold :: ByteString -> IO (Double,ByteString,A.Array (Int,Int) Double) ffi_pf_fold i =-  withCAString i $ \ci ->-  withCAString i $ \cs -> do-  let n = length i+  useAsCString i $ \ci ->+  useAsCString i $ \cs -> do+  let n = BS.length i   let z = n * (n+1) `div` 2 +1   e  <- {#call ffiwrap_pf_fold_constrained #} ci cs 0-  s  <- peekCAString cs+  s  <- packCString cs   bp <- {#call export_bppm #}   xs <- peekArray z (bp :: Ptr CDouble)   let ar = A.accumArray (const id) 0 ((1,1),(n,n)) $ zip [ (ii,jj) | ii <- [n,n-1..1], jj <- [n,n-1..ii]] (drop 1 $ map unsafeCoerce xs)   return (cf2d e, s, ar) -ffi_pf_circ_fold :: String -> IO (Double,String,A.Array (Int,Int) Double)+ffi_pf_circ_fold :: ByteString -> IO (Double,ByteString,A.Array (Int,Int) Double) ffi_pf_circ_fold i =-  withCAString i $ \ci -> do-  withCAString i $ \cs -> do-  let n = length i+  useAsCString i $ \ci -> do+  useAsCString i $ \cs -> do+  let n = BS.length i   let z = n * (n+1) `div` 2 +1   e  <- {#call pf_circ_fold #} ci cs-  s  <- peekCAString cs+  s  <- packCString cs   bp <- {#call export_bppm #}   xs <- peekArray z (bp :: Ptr CDouble)   let ar = A.accumArray (const id) 0 ((1,1),(n,n)) $ zip [ (ii,jj) | ii <- [n,n-1..1], jj <- [n,n-1..ii]] (drop 1 $ map unsafeCoerce xs)   return (cf2d e, s, ar) -ffi_pf_fold_constrained :: String -> String -> IO (Double,String,A.Array (Int,Int) Double)+ffi_pf_fold_constrained :: ByteString -> ByteString -> IO (Double,ByteString,A.Array (Int,Int) Double) ffi_pf_fold_constrained i s =-  withCAString i $ \ci ->-  withCAString s $ \cs -> do-  let n = length i+  useAsCString i $ \ci ->+  useAsCString s $ \cs -> do+  let n = BS.length i   let z = n * (n+1) `div` 2 +1   e  <- {#call ffiwrap_pf_fold_constrained #} ci cs 1-  s  <- peekCAString cs+  s  <- packCString cs   bp <- {#call export_bppm #}   xs <- peekArray z (bp :: Ptr CDouble)   let ar = A.accumArray (const id) 0 ((1,1),(n,n)) $ zip [ (ii,jj) | ii <- [n,n-1..1], jj <- [n,n-1..ii]] (drop 1 $ map unsafeCoerce xs)   return (cf2d e, s, ar) -ffi_pf_circ_fold_constrained :: String -> String -> IO (Double,String,A.Array (Int,Int) Double)+ffi_pf_circ_fold_constrained :: ByteString -> ByteString -> IO (Double,ByteString,A.Array (Int,Int) Double) ffi_pf_circ_fold_constrained i s =-  withCAString i $ \ci -> do-  withCAString i $ \cs -> do-  let n = length i+  useAsCString i $ \ci -> do+  useAsCString i $ \cs -> do+  let n = BS.length i   let z = n * (n+1) `div` 2 +1   e  <- {#call ffiwrap_pf_circ_fold_constrained #} ci cs 1-  s  <- peekCAString cs+  s  <- packCString cs   bp <- {#call export_bppm #}   xs <- peekArray z (bp :: Ptr CDouble)   let ar = A.accumArray (const id) 0 ((1,1),(n,n)) $ zip [ (ii,jj) | ii <- [n,n-1..1], jj <- [n,n-1..ii]] (drop 1 $ map unsafeCoerce xs)

@@ -13,9 +13,9 @@ #include "ViennaRNA/alifold.h" #include "ViennaRNA/fold.h" -double ffiwrap_centroid_temp (double temp, const char *sequence, char *structure)+double ffiwrap_centroid_temp (double temp, const char *sequence, char *structure, double *dist) {-  double                dist, e;+  double                e;   char*                 cent;   char*                 pf_struc;   double                cent_en;@@ -29,7 +29,7 @@   md.temperature = temp;   vc  = vrna_fold_compound(sequence, &md, 0);   e = vrna_pf(vc, pf_struc);-  cent = vrna_centroid(vc, &dist);+  cent = vrna_centroid(vc, dist);   cent_en = vrna_eval_structure(vc, (const char*) cent);   strcpy (structure, cent);   free (cent);

@@ -1,5 +1,5 @@ name:           ViennaRNA-bindings-version:        0.233.1.2+version:        0.233.2.0 maintainer:     choener@tbi.univie.ac.at homepage:       https://github.com/choener/ViennaRNA-bindings bug-reports:    https://github.com/choener/ViennaRNA-bindings/issues@@ -10,7 +10,7 @@ category:       Bioinformatics, Bindings, FFI build-type:     Simple cabal-version:  >=1.10-tested-with:    GHC == 7.8.4, GHC == 7.10.3, GHC == 8.0.1, GHC == 8.0.2+tested-with:    GHC == 8.0.2, GHC == 8.2.1 synopsis:       ViennaRNA v2 bindings description:    Bindings to the ViennaRNA package, version 2.3.3.                 .@@ -58,11 +58,14 @@     BioInf.ViennaRNA.Bindings.FFI.Utils   build-depends: base == 4.*                , array+               , bytestring   build-tools:     c2hs   extra-libraries:   default-language:     Haskell2010+  ghc-options:+    -O2   default-extensions: CPP                     , ForeignFunctionInterface                     , NondecreasingIndentation@@ -136,6 +139,7 @@                     , TemplateHaskell   build-depends: base                , array+               , bytestring                , QuickCheck                , tasty                >= 0.11                , tasty-hunit          >= 0.9

@@ -1,3 +1,8 @@+0.233.2.0+---------++- use ByteString.Char8 instead of String+ 0.233.1.2  - included C/$ALL.c C/config.h in distribution

@@ -1,6 +1,13 @@+{-# Language OverloadedStrings #-} +-- |+--+-- NOTE Remember that all calculations are done via @RNAfold -p --noLP@.+ module Main where +import Data.ByteString.Char8+ import Test.Tasty import Test.Tasty.HUnit import Test.Tasty.Silver as S@@ -102,15 +109,18 @@  case_centroidTemp_37_001 :: Assertion case_centroidTemp_37_001 = do-  (e,s) <- V.centroidTemp 37 "cccaaaggg"+  (e,s,d) <- V.centroidTemp 37 "cccaaaggg"   assertBool "energy" $ e =~ (-1.2)   assertBool "structure" $ s == "(((...)))"+  assertBool "avg distance" $ d =~ 1.06  case_centroidTemp_37_003 :: Assertion case_centroidTemp_37_003 = do-  (e,s) <- V.centroidTemp 37 "GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA"+  (e,s,d) <- V.centroidTemp 37 "GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCCCA"   assertBool "energy" $ e =~ (-28.10)   assertBool "structure" $ s == "(((((((..((((.........)))).(((((.(....)))))).....(((((.......))))))))))))."+  -- using @--noLP@+  assertBool "avg distance" $ d =~ 11.86