RNAlien 1.3.1 → 1.3.7

raw patch · 10 files changed

+580/−633 lines, 10 files

Files

• RNAlien.cabal +8/−14
• src/Bio/InfernalParser.hs +79/−79
• src/Bio/RNAcentralHTTP.hs +18/−19
• src/Bio/RNAcentralHTTPRequest.hs +7/−7
• src/Bio/RNAlien.hs +70/−59
• src/Bio/RNAlienData.hs +23/−23
• src/Bio/RNAlienLibrary.hs +276/−279
• src/Bio/RNAlienStatistics.hs +69/−69
• src/Bio/SelectSequences.hs +0/−54
• src/Bio/cmsearchToBED.hs +30/−30

@@ -1,5 +1,5 @@ name:                RNAlien-version:             1.3.1+version:             1.3.7 synopsis:            Unsupervized construction of RNA family models description:         RNAlien is a tool for automatic construction of RNAfamily models from a single sequence.                      .@@ -50,42 +50,36 @@  source-repository this   type:     git-  location: https://github.com/eggzilla/RNAlien/tree/1.3.1-  tag:      1.3.1+  location: https://github.com/eggzilla/RNAlien/tree/1.3.7+  tag:      1.3.7                       executable RNAlien   Hs-Source-Dirs:      ./src/Bio/   main-is:	       RNAlien.hs   -  ghc-options:         -Wall -O2+  ghc-options:         -Wall    build-depends:       base >=4.5 && <5, cmdargs, directory, biofasta, random, biocore, containers, RNAlien, time, either-unwrap, filepath  executable RNAlienStatistics   Hs-Source-Dirs:      ./src/Bio/   main-is:             RNAlienStatistics.hs-  ghc-options:         -Wall -O2+  ghc-options:         -Wall    build-depends:       base >=4.5 && <5, cmdargs, cassava, vector, process, bytestring, either-unwrap, RNAlien, directory, biofasta, biocore, split, filepath, ViennaRNAParser>=1.3.2 -executable SelectSequences-  Hs-Source-Dirs:      ./src/Bio/-  main-is:             SelectSequences.hs-  ghc-options:         -Wall -O2-  build-depends:       base >=4.5 && <5, cmdargs, either-unwrap, RNAlien- executable cmsearchToBed   Hs-Source-Dirs:      ./src/Bio/   main-is:             cmsearchToBED.hs-  ghc-options:         -Wall -O2+  ghc-options:         -Wall    build-depends:       base >=4.5 && <5, cmdargs, either-unwrap, RNAlien, bytestring, text  executable RNAcentralHTTPRequest   Hs-Source-Dirs:      ./src/Bio/   main-is:             RNAcentralHTTPRequest.hs-  ghc-options:         -Wall -O2+  ghc-options:         -Wall    build-depends:       base >=4.5 && <5, cmdargs, either-unwrap, RNAlien    Library   Hs-Source-Dirs:      ./src/-  ghc-options:         -Wall -O2 -fno-warn-unused-do-bind+  ghc-options:         -Wall -fno-warn-unused-do-bind   build-depends:       base >=4.5 && <5, cmdargs, ViennaRNAParser>=1.3.2, process, directory, blastxml>=0.3.2, biofasta, parsec, random, BlastHTTP>=1.2.1, biocore, bytestring, Taxonomy >= 1.0.2, either-unwrap, containers, ClustalParser>=1.2.1, EntrezHTTP>=1.0.3, vector, edit-distance, cassava, matrix, hierarchical-clustering, filepath, HTTP, http-conduit, hxt, network, aeson, text, transformers, pureMD5, http-types, text-metrics   Exposed-Modules:     Bio.RNAlienData                        Bio.RNAlienLibrary

@@ -1,7 +1,7 @@ -- | This module contains parsing functions for Infernal programs  module Bio.InfernalParser (-                           module Bio.RNAlienData,                          +                           module Bio.RNAlienData,                            readCMSearch,                            readCMSearches,                            parseCMSearch,@@ -11,30 +11,30 @@                            ) where -import Text.ParserCombinators.Parsec +import Text.ParserCombinators.Parsec import Bio.RNAlienData import qualified Data.ByteString.Lazy.Char8 as L import qualified Control.Exception.Base as CE  -- | parse from input filePath               parseCMSearch :: String -> Either ParseError CMsearch-parseCMSearch = parse genParserCMSearch "parseCMsearch" +parseCMSearch = parse genParserCMSearch "parseCMsearch"  -- | parse from input filePath               parseCMSearches :: String -> Either ParseError CMsearch parseCMSearches = parse genParserCMSearches "parseCMsearch"  -- | parse from input filePath                      -readCMSearch :: String -> IO (Either ParseError CMsearch)             -readCMSearch filePath = do +readCMSearch :: String -> IO (Either ParseError CMsearch)+readCMSearch filePath = do   parsedFile <- parseFromFile genParserCMSearch filePath-  CE.evaluate parsedFile +  CE.evaluate parsedFile  -- | parse from input filePath                      -readCMSearches :: String -> IO (Either ParseError CMsearch)             -readCMSearches filePath = do +readCMSearches :: String -> IO (Either ParseError CMsearch)+readCMSearches filePath = do   parsedFile <- parseFromFile genParserCMSearches filePath-  CE.evaluate parsedFile +  CE.evaluate parsedFile  genParserCMSearches :: GenParser Char st CMsearch genParserCMSearches = do@@ -42,12 +42,12 @@   newline   string "# INFERNAL "   many1 (noneOf "\n")-  newline       +  newline   string "# Copyright (C) 201"   many1 (noneOf "\n")-  newline       +  newline   string "# Freely distributed under the GNU General Public License (GPLv3)."-  newline       +  newline   string "# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -"   newline   string "# query CM file:"@@ -55,7 +55,7 @@   queryCMfile' <- many1 (noneOf "\n")   newline   string "# target sequence database:"-  many1 space      +  many1 space   targetSequenceDatabase' <- many1 (noneOf "\n")   newline   optional (try (genParserCMsearchHeaderField "# CM configuration"))@@ -72,19 +72,19 @@   optional (string "[ok]\n")   eof   return $ CMsearch queryCMfile' targetSequenceDatabase' numberOfWorkerThreads' (concat cmSearchesHits)-    + genParserCMSearch :: GenParser Char st CMsearch genParserCMSearch = do   string "# cmsearch :: search CM(s) against a sequence database"   newline   string "# INFERNAL "   many1 (noneOf "\n")-  newline       +  newline   string "# Copyright (C) 201"   many1 (noneOf "\n")-  newline       +  newline   string "# Freely distributed under the GNU General Public License (GPLv3)."-  newline       +  newline   string "# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -"   newline   string "# query CM file:"@@ -92,7 +92,7 @@   queryCMfile' <- many1 (noneOf "\n")   newline   string "# target sequence database:"-  many1 space      +  many1 space   targetSequenceDatabase' <- many1 (noneOf "\n")   newline   optional (try (genParserCMsearchHeaderField "# CM configuration"))@@ -106,32 +106,32 @@   newline   optional newline   string "Query:"-  many1 (noneOf "\n")       +  many1 (noneOf "\n")   newline   optional (try (genParserCMsearchHeaderField "Accession"))   optional (try (genParserCMsearchHeaderField "Description"))   string "Hit scores:"   newline   choice  [try (string " rank"), try (string "  rank") , try (string "   rank"), try (string "    rank"),try (string "     rank"),try (string "      rank")]-  many1 space +  many1 space   string "E-value"-  many1 space        +  many1 space   string "score"-  many1 space +  many1 space   string "bias"-  many1 space +  many1 space   string "sequence"-  many1 space  +  many1 space   string "start"-  many1 space +  many1 space   string "end"-  many1 space +  many1 space   string "mdl"-  many1 space +  many1 space   string "trunc"-  many1 space +  many1 space   string "gc"-  many1 space +  many1 space   string "description"   newline   string " -"@@ -152,32 +152,32 @@   --optional newline   --optional string "//"   string "Query:"-  many1 (noneOf "\n")       +  many1 (noneOf "\n")   newline   optional (try (genParserCMsearchHeaderField "Accession"))   optional (try (genParserCMsearchHeaderField "Description"))   string "Hit scores:"   newline   choice  [try (string " rank"), try (string "  rank") , try (string "   rank"), try (string "    rank"),try (string "     rank"),try (string "      rank")]-  many1 space +  many1 space   string "E-value"-  many1 space        +  many1 space   string "score"-  many1 space +  many1 space   string "bias"-  many1 space +  many1 space   string "sequence"-  many1 space  +  many1 space   string "start"-  many1 space +  many1 space   string "end"-  many1 space +  many1 space   string "mdl"-  many1 space +  many1 space   string "trunc"-  many1 space +  many1 space   string "gc"-  many1 space +  many1 space   string "description"   newline   string " -"@@ -210,33 +210,33 @@ genParserCMsearchHit :: GenParser Char st CMsearchHit genParserCMsearchHit = do   many1 space-  string "("     +  string "("   hitRank' <- many1 digit   string ")"   many1 space   hitSignificant' <- choice [char '!', char '?']-  many1 space                  +  many1 space   hitEValue' <- many1 (oneOf "0123456789.e-")-  many1 space             +  many1 space   hitScore'  <- many1 (oneOf "0123456789.e-")-  many1 space   +  many1 space   hitBias' <- many1 (oneOf "0123456789.e-")   many1 space   hitSequenceHeader' <- many1 (noneOf " ")-  many1 space                +  many1 space   hitStart' <- many1 digit   many1 space   hitEnd' <- many1 digit-  many1 space            +  many1 space   hitStrand' <- choice [char '+', char '-', char '.']-  many1 space              +  many1 space   hitModel' <- many1 letter-  many1 space          +  many1 space   hitTruncation' <- many1 (choice [alphaNum, char '\''])-  many1 space                   +  many1 space   hitGCcontent' <- many1 (oneOf "0123456789.e-")-  many1 space                -  hitDescription' <- many1 (noneOf "\n")     +  many1 space+  hitDescription' <- many1 (noneOf "\n")   newline   optional (try (string " ------ inclusion threshold ------"))   optional (try newline)@@ -247,23 +247,23 @@ parseCMstat = parse genParserCMstat "parseCMstat"  -- | parse from input filePath                      -readCMstat :: String -> IO (Either ParseError CMstat)             -readCMstat filePath = do +readCMstat :: String -> IO (Either ParseError CMstat)+readCMstat filePath = do   parsedFile <- parseFromFile genParserCMstat filePath-  CE.evaluate parsedFile -                      +  CE.evaluate parsedFile+ genParserCMstat :: GenParser Char st CMstat genParserCMstat = do   string "# cmstat :: display summary statistics for CMs"   newline   string "# INFERNAL "   many1 (noneOf "\n")-  newline       +  newline   string "# Copyright (C) 201"   many1 (noneOf "\n")-  newline       +  newline   string "# Freely distributed under the GNU General Public License (GPLv3)."-  newline       +  newline   string "# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -"   newline   char '#'@@ -275,27 +275,27 @@   many1 (char '-')   newline   char '#'-  many1 space +  many1 space   string "idx"-  many1 space        +  many1 space   string "name"-  many1 space +  many1 space   string "accession"-  many1 space +  many1 space   string "nseq"-  many1 space  +  many1 space   string "eff_nseq"-  many1 space +  many1 space   string "clen"-  many1 space +  many1 space   string "W"-  many1 space +  many1 space   string "bps"-  many1 space +  many1 space   string "bifs"-  many1 space +  many1 space   string "model"-  many1 space +  many1 space   string "cm"   many1 space   string "hmm"@@ -303,34 +303,34 @@   string "#"   many1 (try (oneOf " -"))   newline-  many1 space     +  many1 space   _statIndex <- many1 digit   many1 space   _statName <- many1 letter-  many1 space                  +  many1 space   _statAccession <- many1 (noneOf " ")-  many1 space             +  many1 space   _statSequenceNumber <- many1 digit-  many1 space   +  many1 space   _statEffectiveSequences <- many1 (oneOf "0123456789.e-")   many1 space   _statConsensusLength <- many digit-  many1 space                +  many1 space   _statW <- many1 digit   many1 space   _statBasepaires <- many1 digit-  many1 space            +  many1 space   _statBifurcations <- many1 digit-  many1 space              +  many1 space   _statModel <- many1 letter-  many1 space          +  many1 space   _relativeEntropyCM <- many1 (oneOf "0123456789.e-")-  many1 space                   +  many1 space   _relativeEntropyHMM <- many1 (oneOf "0123456789.e-")   newline   char '#'   newline-  eof  +  eof   return $ CMstat (readInt _statIndex) _statName _statAccession (readInt _statSequenceNumber) (readDouble _statEffectiveSequences) (readInt _statConsensusLength) (readInt _statW) (readInt _statBasepaires) (readInt _statBifurcations) _statModel (readDouble _relativeEntropyCM) (readDouble _relativeEntropyHMM) --    readInt :: String -> Int

@@ -1,27 +1,27 @@ {-# LANGUAGE OverloadedStrings #-}-{-# LANGUAGE Arrows #-}+ {-# LANGUAGE DeriveGeneric #-}  -- | Interface for the RNAcentral REST webservice. --    module Bio.RNAcentralHTTP (rnaCentralHTTP,                       buildSequenceViaMD5Query,-                      buildStringViaMD5Query,                        +                      buildStringViaMD5Query,                       getRNACentralEntries,                       showRNAcentralAlienEvaluation,                       RNAcentralEntryResponse(..),                       RNAcentralEntry(..)                       ) where -import Network.HTTP.Conduit    -import qualified Data.ByteString.Lazy.Char8 as L8    +import Network.HTTP.Conduit+import qualified Data.ByteString.Lazy.Char8 as L8 import Network import Control.Concurrent import Data.Text import Data.Aeson import GHC.Generics import qualified Data.Digest.Pure.MD5 as M-import Bio.Core.Sequence +import Bio.Core.Sequence import Bio.Sequence.Fasta import Data.Either @@ -40,7 +40,7 @@   toJSON = genericToJSON defaultOptions   --toEncoding = genericToEncoding defaultOptions -instance FromJSON RNAcentralEntryResponse +instance FromJSON RNAcentralEntryResponse  data RNAcentralEntry = RNAcentralEntry   {@@ -58,7 +58,7 @@   toJSON = genericToJSON defaultOptions   --toEncoding = genericToEncoding defaultOptions -instance FromJSON RNAcentralEntry +instance FromJSON RNAcentralEntry  -- | Send query and parse return XML  startSession :: String -> IO (Either String RNAcentralEntryResponse)@@ -68,7 +68,7 @@   --putStr (L8.unpack requestXml)   let eitherErrorResponse = eitherDecode requestXml :: Either String RNAcentralEntryResponse   return eitherErrorResponse-  + -- | Send query and return response XML sendQuery :: String -> IO L8.ByteString sendQuery query' = do@@ -76,10 +76,10 @@    let request = address ++ query'    --putStrLn request    simpleHttp request-   + -- | Function for querying the RNAcentral REST interface. rnaCentralHTTP :: String -> IO (Either String RNAcentralEntryResponse)-rnaCentralHTTP query' = do+rnaCentralHTTP query' =   startSession query'  -- | Function for delayed queries to the RNAcentral REST interface. Enforces the maximum 20 requests per second policy.@@ -88,17 +88,16 @@   threadDelay 55000   startSession query' -getRNACentralEntries :: [String] -> IO [(Either String RNAcentralEntryResponse)]+getRNACentralEntries :: [String] -> IO [Either String RNAcentralEntryResponse] getRNACentralEntries queries = do-  responses <- mapM delayedRNACentralHTTP queries-  return responses+  mapM delayedRNACentralHTTP queries  --Build a query from a input sequence buildSequenceViaMD5Query :: Sequence -> String buildSequenceViaMD5Query s = qString   where querySequence = unSD (seqdata s)         querySequenceUreplacedwithT = L8.map bsreplaceUT querySequence-        querySequenceU2Twolb = L8.filter (\a -> a /= '\n') querySequenceUreplacedwithT+        querySequenceU2Twolb = L8.filter ((/= '\n')) querySequenceUreplacedwithT         md5Sequence = M.md5 querySequenceU2Twolb         qString = "?md5=" ++ show md5Sequence @@ -106,17 +105,17 @@ buildStringViaMD5Query :: String -> String buildStringViaMD5Query s = qString   where querySequenceUreplacedwithT = L8.map bsreplaceUT (L8.pack s)-        querySequenceU2Twolb = L8.filter (\a -> a /= '\n') querySequenceUreplacedwithT+        querySequenceU2Twolb = L8.filter ((/= '\n')) querySequenceUreplacedwithT         md5Sequence = M.md5 querySequenceU2Twolb         qString = "?md5=" ++ show md5Sequence-                  -showRNAcentralAlienEvaluation :: [(Either String RNAcentralEntryResponse)] -> String++showRNAcentralAlienEvaluation :: [Either String RNAcentralEntryResponse] -> String showRNAcentralAlienEvaluation responses = output   where resultEntries = Prelude.concatMap results (rights responses)         resulthead = "rnacentral_id\tmd5\tlength\n"         resultentries = Prelude.concatMap showRNAcentralAlienEvaluationLine resultEntries-        output = if resultentries == [] then "No matching sequences found in RNAcentral\n" else resulthead ++ resultentries-        +        output = if Prelude.null resultentries then "No matching sequences found in RNAcentral\n" else resulthead ++ resultentries+ showRNAcentralAlienEvaluationLine :: RNAcentralEntry -> String showRNAcentralAlienEvaluationLine entry = unpack (rnacentral_id entry) ++ "\t" ++ unpack (md5 entry) ++ "\t" ++ show (Bio.RNAcentralHTTP.length entry) ++"\n" 

@@ -4,23 +4,23 @@ -- | RNAcentralHTTPRequest --   Testcommand: dist/build/RNAcentralHTTPRequest/RNAcentralHTTPRequest -i ATACTTACCTGGCACAGGGGATACCACGATCACCAAGGTGGTTCCCCCAAGACGAGGCTCACCATTGCACTCCGGTGGCGCTGACCCTTGCAATGACCCCAAATGTGGGTTACTCGGGTGTGTAATTTCTGTTAGCTGGGGACTGCGTTCGCGCTTTCCCCTT module Main where-    -import System.Console.CmdArgs    ++import System.Console.CmdArgs import Bio.RNAcentralHTTP -data Options = Options            +data Options = Options   { inputSequence :: String   } deriving (Show,Data,Typeable)  options :: Options options = Options   { inputSequence = def &= name "i" &= help "input sequence"-  } &= summary "RNAcentralHTTPRequest" &= help "Florian Eggenhofer 2016" &= verbosity       -                +  } &= summary "RNAcentralHTTPRequest" &= help "Florian Eggenhofer 2016" &= verbosity+ main :: IO () main = do   Options{..} <- cmdArgs options-  let query = buildStringViaMD5Query inputSequence             +  let query = buildStringViaMD5Query inputSequence   rnacentralentries <- getRNACentralEntries [query]   print rnacentralentries- +

@@ -5,10 +5,10 @@ --   For more information on RNA family models consult <http://> --   Testcommand: dist/build/RNAlien/RNAlien -i ~egg/initialfasta/RybB.fa -c 3 -o /scr/kronos/egg/temp/ > ~egg/Desktop/alieninitialtest module Main where-    -import System.Console.CmdArgs    -import System.Directory -import Bio.Sequence.Fasta ++import System.Console.CmdArgs+import System.Directory+import Bio.Sequence.Fasta import Bio.RNAlienData import Bio.RNAlienLibrary import Data.Maybe@@ -18,8 +18,8 @@ import Paths_RNAlien (version) import Data.Version (showVersion) -data Options = Options            -  { inputFastaFilePath :: String,     +data Options = Options+  { inputFastaFilePath :: String,     outputPath :: String,     inputTaxId :: Maybe Int,     inputnSCICutoff :: Maybe Double,@@ -34,17 +34,18 @@     threads :: Int,     taxonomyRestriction :: Maybe String,     sessionIdentificator :: Maybe String,-    performEvaluation :: Bool+    performEvaluation :: Bool,+    checkSetup :: Bool   } deriving (Show,Data,Typeable)  options :: Options options = Options-  { inputFastaFilePath = def &= name "i" &= help "Path to input fasta file",                       -    outputPath = def &= name "o" &= help "Path to output directory",+  { inputFastaFilePath = def &= name "i" &= help "Path to input fasta file",+    outputPath = def &= name "o" &= help "Path to output directory. Default: current working directory",     inputTaxId = Nothing &= name "t" &= help "NCBI taxonomy ID number of input RNA organism",-    inputnSCICutoff = (Just (1 :: Double)) &= name "z" &= help "Only candidate sequences with a normalized structure conservation index (nSCI) higher than this value are accepted. Default: 1",-    inputEvalueCutoff = (Just (0.001 :: Double)) &= name "e" &= help "Evalue cutoff for cmsearch filtering. Default: 0.001",-    inputBlastDatabase = Just "nt" &= name "b" &= help "Specify name of blast database to use. Default: nt",                    +    inputnSCICutoff = Just (1 :: Double) &= name "z" &= help "Only candidate sequences with a normalized structure conservation index (nSCI) higher than this value are accepted. Default: 1",+    inputEvalueCutoff = Just (0.001 :: Double) &= name "e" &= help "Evalue cutoff for cmsearch filtering. Default: 0.001",+    inputBlastDatabase = Just "nt" &= name "b" &= help "Specify name of blast database to use. Default: nt",     lengthFilter = True &= name "l" &= help "Filter blast hits per genomic length. Default: True",     coverageFilter = True &= name "a" &= help "Filter blast hits by coverage of at least 80%. Default: True",     singleHitperTax = False &= name "s" &= help "Only the best blast hit per taxonomic entry is considered. Default: False",@@ -54,64 +55,74 @@     threads = 1 &= name "c" &= help "Number of available cpu slots/cores. Default: 1",     taxonomyRestriction = Nothing &= name "r" &= help "Restrict search space to taxonomic kingdom (bacteria,archea,eukaryia). Default: not set",     sessionIdentificator = Nothing &= name "d" &= help "Optional session id that is used instead of automatically generated one.",-    performEvaluation = True &= name "x" &= help "Perform evaluation step. Default: True"-  } &= summary ("RNAlien " ++ alienVersion) &= help "Florian Eggenhofer, Ivo L. Hofacker, Christian Höner zu Siederdissen - 2013 - 2017" &= verbosity       -                +    performEvaluation = True &= name "x" &= help "Perform evaluation step. Default: True",+    checkSetup = False &= name "g" &= help "Just prints installed tool versions and performs connection check. Default: False"+  } &= summary ("RNAlien " ++ alienVersion) &= help "Florian Eggenhofer, Ivo L. Hofacker, Christian Hoener zu Siederdissen - 2013 - 2017" &= verbosity+ main :: IO () main = do   Options{..} <- cmdArgs options   verboseLevel <- getVerbosity+  let tools = if inputQuerySelectionMethod == "clustering" then ["clustalo","mlocarna","RNAfold","RNAalifold","cmcalibrate","cmstat","cmbuild","RNAz","RNAcode"] else ["mlocarna","RNAfold","RNAalifold","cmcalibrate","cmstat","cmbuild","RNAz","RNAcode"]   -- Generate SessionID   sessionId <- createSessionID sessionIdentificator   timestamp <- getCurrentTime-  let temporaryDirectoryPath = FP.addTrailingPathSeparator outputPath ++ sessionId ++ "/"            +  currentWorkDirectory <- getCurrentDirectory+  let selectedOutputPath = if null outputPath then currentWorkDirectory else outputPath+  let temporaryDirectoryPath = FP.addTrailingPathSeparator selectedOutputPath ++ sessionId ++ "/"   createDirectoryIfMissing False temporaryDirectoryPath-  createDirectoryIfMissing False (temporaryDirectoryPath ++ "log")-  -- Create Log files-  writeFile (temporaryDirectoryPath ++ "Log") ("RNAlien " ++ alienVersion ++ "\n")-  writeFile (temporaryDirectoryPath ++ "log/warnings") ("")-  logMessage ("Timestamp: " ++ (show timestamp) ++ "\n") temporaryDirectoryPath-  logMessage ("Temporary Directory: " ++ temporaryDirectoryPath ++ "\n") temporaryDirectoryPath-  inputFasta <- readFasta inputFastaFilePath   networkCheck <- checkNCBIConnection-  if isLeft networkCheck+  if checkSetup     then do-      putStrLn ("Error - Could not contact NCBI server: " ++ fromLeft networkCheck ++ "\n")-      logMessage ("Error - Could not contact NCBI server: " ++ fromLeft networkCheck ++ "\n") temporaryDirectoryPath-    else do-      if null inputFasta+      toolsCheck <- checkTools tools inputQuerySelectionMethod temporaryDirectoryPath+      let setupCheckPath = temporaryDirectoryPath ++ "setupCheck"+      let toolCheckResult = either id id toolsCheck+      let networkCheckResult = either id id networkCheck+      writeFile setupCheckPath (toolCheckResult ++ "\n" ++ networkCheckResult ++ "\n")+    else+      if isLeft networkCheck         then do-          putStrLn "Error: Input fasta file is empty."-          logMessage "Error: Input fasta file is empty.\n" temporaryDirectoryPath-        else do-          let iterationNumber = 0-          let tools = if inputQuerySelectionMethod == "clustering" then ["clustalo","mlocarna","RNAfold","RNAalifold","cmcalibrate","cmstat","cmbuild","RNAz","RNAcode"] else ["mlocarna","RNAfold","RNAalifold","cmcalibrate","cmstat","cmbuild","RNAz","RNAcode"]-          toolsCheck <- checkTools tools inputQuerySelectionMethod temporaryDirectoryPath-          -- Check required commandline tools-          if isLeft toolsCheck-            then do -              putStrLn ("Error - Not all required tools could be found in $PATH: " ++ fromLeft toolsCheck ++ "\n")-              logMessage ("Error - Not all required tools could be found in $PATH: " ++ fromLeft toolsCheck ++ "\n") temporaryDirectoryPath-            else do-              logToolVersions inputQuerySelectionMethod temporaryDirectoryPath-              let inputSequence = reformatFasta (head inputFasta)-              initialTaxId <- setInitialTaxId inputBlastDatabase temporaryDirectoryPath inputTaxId inputSequence-              let checkedTaxonomyRestriction = checkTaxonomyRestriction taxonomyRestriction-              let staticOptions = StaticOptions temporaryDirectoryPath sessionId (fromJust inputnSCICutoff) inputTaxId singleHitperTax inputQuerySelectionMethod inputQueryNumber lengthFilter coverageFilter blastSoftmasking threads inputBlastDatabase checkedTaxonomyRestriction (setVerbose verboseLevel)-              let initialization = ModelConstruction iterationNumber inputSequence [] initialTaxId Nothing (fromJust inputEvalueCutoff) False [] []-              logMessage (show initialization) temporaryDirectoryPath-              modelConstructionResults <- modelConstructer staticOptions initialization-              let resultTaxonomyRecordsCSVTable = constructTaxonomyRecordsCSVTable modelConstructionResults-              writeFile (temporaryDirectoryPath ++ "result.csv") resultTaxonomyRecordsCSVTable-              if performEvaluation-                then do-                  resultEvaluation <- evaluateConstructionResult staticOptions modelConstructionResults-                  appendFile (temporaryDirectoryPath ++ "Log") resultEvaluation-                  resultSummary modelConstructionResults staticOptions-                  writeFile (temporaryDirectoryPath ++ "done") ""-                else do-                  resultSummary modelConstructionResults staticOptions-                  writeFile (temporaryDirectoryPath ++ "done") ""+          putStrLn ("Error - Could not contact NCBI server: " ++ fromLeft networkCheck ++ "\n")+          logMessage ("Error - Could not contact NCBI server: " ++ fromLeft networkCheck ++ "\n") temporaryDirectoryPath+       else do+           createDirectoryIfMissing False (temporaryDirectoryPath ++ "log")+           -- Create Log files+           writeFile (temporaryDirectoryPath ++ "Log") ("RNAlien " ++ alienVersion ++ "\n")+           writeFile (temporaryDirectoryPath ++ "log/warnings") ("")+           logMessage ("Timestamp: " ++ (show timestamp) ++ "\n") temporaryDirectoryPath+           logMessage ("Temporary Directory: " ++ temporaryDirectoryPath ++ "\n") temporaryDirectoryPath+           inputFasta <- readFasta inputFastaFilePath+           if null inputFasta+             then do+               putStrLn "Error: Input fasta file is empty."+               logMessage "Error: Input fasta file is empty.\n" temporaryDirectoryPath+             else do+               let iterationNumber = 0+               toolsCheck <- checkTools tools inputQuerySelectionMethod temporaryDirectoryPath+               if isLeft toolsCheck+                 then do+                   putStrLn ("Error - Not all required tools could be found in $PATH: " ++ fromLeft toolsCheck ++ "\n")+                   logMessage ("Error - Not all required tools could be found in $PATH: " ++ fromLeft toolsCheck ++ "\n") temporaryDirectoryPath+                 else do+                   logToolVersions inputQuerySelectionMethod temporaryDirectoryPath+                   let inputSequence = reformatFasta (head inputFasta)+                   initialTaxId <- setInitialTaxId inputBlastDatabase temporaryDirectoryPath inputTaxId inputSequence+                   let checkedTaxonomyRestriction = checkTaxonomyRestriction taxonomyRestriction+                   let staticOptions = StaticOptions temporaryDirectoryPath sessionId (fromJust inputnSCICutoff) inputTaxId singleHitperTax inputQuerySelectionMethod inputQueryNumber lengthFilter coverageFilter blastSoftmasking threads inputBlastDatabase checkedTaxonomyRestriction (setVerbose verboseLevel)+                   let initialization = ModelConstruction iterationNumber inputSequence [] initialTaxId Nothing (fromJust inputEvalueCutoff) False [] []+                   logMessage (show initialization) temporaryDirectoryPath+                   modelConstructionResults <- modelConstructer staticOptions initialization+                   let resultTaxonomyRecordsCSVTable = constructTaxonomyRecordsCSVTable modelConstructionResults+                   writeFile (temporaryDirectoryPath ++ "result.csv") resultTaxonomyRecordsCSVTable+                   if performEvaluation+                     then do+                       resultEvaluation <- evaluateConstructionResult staticOptions modelConstructionResults+                       appendFile (temporaryDirectoryPath ++ "Log") resultEvaluation+                       resultSummary modelConstructionResults staticOptions+                       writeFile (temporaryDirectoryPath ++ "done") ""+                     else do+                       resultSummary modelConstructionResults staticOptions+                       writeFile (temporaryDirectoryPath ++ "done") ""  alienVersion :: String alienVersion = showVersion version

@@ -4,7 +4,7 @@  import qualified Data.ByteString.Lazy.Char8 as L import Bio.Core.Sequence-import Bio.Sequence.Fasta +import Bio.Sequence.Fasta import Bio.Taxonomy  -- | Static construction options@@ -23,26 +23,26 @@     blastDatabase :: Maybe String,     taxRestriction :: Maybe String,     verbositySwitch :: Bool-  } deriving (Show)  +  } deriving (Show)  -- | Keeps track of model construction  data ModelConstruction = ModelConstruction   { iterationNumber :: Int,-    inputFasta :: Sequence,  +    inputFasta :: Sequence,     taxRecords :: [TaxonomyRecord],     --Taxonomy ID of the highest node in taxonomic subtree used in search     upperTaxonomyLimit :: Maybe Int,     taxonomicContext :: Maybe Taxon,-    evalueThreshold :: Double,                     +    evalueThreshold :: Double,     alignmentModeInfernal :: Bool,     selectedQueries :: [Sequence],     potentialMembers :: [SearchResult]-  } +  }  instance Show ModelConstruction where   show (ModelConstruction _iterationNumber _inputFasta _taxRecords _upperTaxonomyLimit _taxonomicContext _evalueThreshold _alignmentModeInfernal _selectedQueries _potentialMembers) = a ++ b ++ c ++ d ++ e ++ g ++ h ++ i-    where a = "Modelconstruction iteration: " ++ show _iterationNumber ++ "\n" -          b = "Input fasta:\n" ++ L.unpack (unSL (seqheader _inputFasta))  ++ "\n" ++ L.unpack (unSD (seqdata _inputFasta)) ++ "\n" +    where a = "Modelconstruction iteration: " ++ show _iterationNumber ++ "\n"+          b = "Input fasta:\n" ++ L.unpack (unSL (seqheader _inputFasta))  ++ "\n" ++ L.unpack (unSD (seqdata _inputFasta)) ++ "\n"           c = show _taxRecords           d = "Upper taxonomy limit: " ++ maybe "not set" show _upperTaxonomyLimit ++ "\n"           e = "Taxonomic Context: " ++  maybe "not set" show _taxonomicContext ++ "\n"@@ -57,7 +57,7 @@  instance Show TaxonomyRecord where   show (TaxonomyRecord _recordTaxonomyId _sequenceRecords) = a ++ b-    where a = "TaxonomyRecord TaxonomyId: " ++ show _recordTaxonomyId ++ "\n" +    where a = "TaxonomyRecord TaxonomyId: " ++ show _recordTaxonomyId ++ "\n"           b = show _sequenceRecords  data SequenceRecord = SequenceRecord@@ -65,14 +65,14 @@     nucleotideSequence :: Sequence,     -- 0 is unaligned, number is the iteration the sequence has been included into the alignment     aligned  :: Int,-    recordDescription :: L.ByteString   -  } +    recordDescription :: L.ByteString+  }  instance Show SequenceRecord where-  show (SequenceRecord _nucleotideSequence _aligned _recordDescription) = a ++ b ++ c -    where a = "Record Description: " ++ (L.unpack _recordDescription) ++ "\n" -          b = "Aligned in iteration: " ++ show _aligned ++ "\n" -          c = "Sequence:" ++ show _nucleotideSequence ++ "\n" +  show (SequenceRecord _nucleotideSequence _aligned _recordDescription) = a ++ b ++ c+    where a = "Record Description: " ++ L.unpack _recordDescription ++ "\n"+          b = "Aligned in iteration: " ++ show _aligned ++ "\n"+          c = "Sequence:" ++ show _nucleotideSequence ++ "\n" -- |   data CMsearch = CMsearch   { queryCMfile :: String,@@ -81,7 +81,7 @@     cmsearchHits :: [CMsearchHit] --    hitAlignments :: [CMsearchHitAlignment] --    internalCMPipelineStatisticsSummary                 -  } deriving (Show, Eq, Read) +  } deriving (Show, Eq, Read)  -- |   data CMsearchHit = CMsearchHit@@ -98,7 +98,7 @@     hitTruncation :: L.ByteString,     hitGCContent :: Double,     hitDescription :: L.ByteString-  } deriving (Show, Eq, Read) +  } deriving (Show, Eq, Read)  data SearchResult = SearchResult   { candidates :: [(Sequence,Int,L.ByteString)],@@ -106,9 +106,9 @@   }  instance Show SearchResult where-  show (SearchResult _candidates _blastDatabaseSize) = a ++ b -    where a = "SearchResults :\n " ++ concatMap show _candidates ++ "\n" -          b = "BlastDb Size: " ++ show _blastDatabaseSize ++ "\n" +  show (SearchResult _candidates _blastDatabaseSize) = a ++ b+    where a = "SearchResults :\n " ++ concatMap show _candidates ++ "\n"+          b = "BlastDb Size: " ++ show _blastDatabaseSize ++ "\n"  -- |   data CMstat = CMstat@@ -125,12 +125,12 @@     statModel :: String,     relativeEntropyCM :: Double,     relativeEntropyHMM :: Double-  } deriving (Eq, Read) +  } deriving (Eq, Read)  instance Show CMstat where   show (CMstat _statIndex _statName _statAccession _statSequenceNumber _statEffectiveSequences _statConsensusLength _statW _statBasepairs _statBifurcations _statModel _relativeEntropyCM _relativeEntropyHMM) = a ++ b ++ c ++ d ++ e ++ f ++ g ++ h ++ i ++ j ++ k ++ l-    where a = "CMstat - covariance model statistics:\nIndex: " ++ show _statIndex ++ "\n" -          b = "Name: " ++ show _statName ++ "\n" +    where a = "CMstat - covariance model statistics:\nIndex: " ++ show _statIndex ++ "\n"+          b = "Name: " ++ show _statName ++ "\n"           c = "Accession: " ++ show _statAccession ++ "\n"           d = "Sequence Number: " ++ show _statSequenceNumber ++ "\n"           e = "Effective Sequences: " ++ show _statEffectiveSequences ++ "\n"@@ -141,4 +141,4 @@           j = "Modeltype: " ++ show _statModel ++ "\n"           k = "Relative Entropy CM: " ++ show _relativeEntropyCM ++ "\n"           l = "Relative Entropy HMM: " ++ show _relativeEntropyHMM ++ "\n"-       +

@@ -31,33 +31,33 @@                            evaluePartitionTrimCMsearchHits                            ) where-   -import System.Process ++import System.Process import qualified System.FilePath as FP-import Text.ParserCombinators.Parsec +import Text.ParserCombinators.Parsec import Data.List import Data.Char-import Bio.Core.Sequence -import Bio.Sequence.Fasta +import Bio.Core.Sequence+import Bio.Sequence.Fasta import Bio.BlastXML import Bio.ClustalParser import Data.Int (Int16) import Bio.RNAlienData import qualified Data.ByteString.Lazy.Char8 as L import qualified Data.ByteString.Char8 as B-import Bio.Taxonomy +import Bio.Taxonomy import Data.Either.Unwrap import Data.Maybe-import Bio.EntrezHTTP +import Bio.EntrezHTTP import System.Exit import Data.Either (lefts,rights,Either)-import qualified Text.EditDistance as ED   +import qualified Text.EditDistance as ED import qualified Data.Vector as V-import Control.Concurrent +import Control.Concurrent import System.Random import Data.Csv import Data.Matrix-import Bio.BlastHTTP +import Bio.BlastHTTP import Data.Clustering.Hierarchical import System.Directory import System.Console.CmdArgs@@ -78,55 +78,57 @@ import qualified Data.Text.Lazy.IO as TIO import Text.Printf import qualified Data.Text.Metrics as TM+import Control.Monad+import Control.Arrow  -- | Initial RNA family model construction - generates iteration number, seed alignment and model modelConstructer :: StaticOptions -> ModelConstruction -> IO ModelConstruction modelConstructer staticOptions modelConstruction = do   logMessage ("Iteration: " ++ show (iterationNumber modelConstruction) ++ "\n") (tempDirPath staticOptions)   iterationSummary modelConstruction staticOptions-  let currentIterationNumber = (iterationNumber modelConstruction)+  let currentIterationNumber = iterationNumber modelConstruction   let foundSequenceNumber = length (concatMap sequenceRecords (taxRecords modelConstruction))   --extract queries   let queries = extractQueries foundSequenceNumber modelConstruction   logVerboseMessage (verbositySwitch staticOptions) ("Queries:" ++ show queries ++ "\n") (tempDirPath staticOptions)-  let iterationDirectory = (tempDirPath staticOptions) ++ (show currentIterationNumber) ++ "/"+  let iterationDirectory = tempDirPath staticOptions ++ show currentIterationNumber ++ "/"   let maybeLastTaxId = extractLastTaxId (taxonomicContext modelConstruction)-  if (isNothing maybeLastTaxId) then logMessage ("Lineage: Could not extract last tax id \n") (tempDirPath staticOptions) else (return ())+  Control.Monad.when (isNothing maybeLastTaxId) $ logMessage ("Lineage: Could not extract last tax id \n") (tempDirPath staticOptions)   --If highest node in linage was used as upper taxonomy limit, taxonomic tree is exhausted-  if (maybe True (\uppertaxlimit -> maybe True (\lastTaxId -> uppertaxlimit /= lastTaxId) maybeLastTaxId) (upperTaxonomyLimit modelConstruction))+  if maybe True (\uppertaxlimit -> maybe True (\lastTaxId -> uppertaxlimit /= lastTaxId) maybeLastTaxId) (upperTaxonomyLimit modelConstruction)      then do-       createDirectory (iterationDirectory) +       createDirectory iterationDirectory        let (upperTaxLimit,lowerTaxLimit) = setTaxonomicContextEntrez currentIterationNumber (taxonomicContext modelConstruction) (upperTaxonomyLimit modelConstruction)-       logVerboseMessage (verbositySwitch staticOptions) ("Upper taxonomy limit: " ++ (show upperTaxLimit) ++ "\n " ++ "Lower taxonomy limit: "++ show lowerTaxLimit ++ "\n") (tempDirPath staticOptions)+       logVerboseMessage (verbositySwitch staticOptions) ("Upper taxonomy limit: " ++ show upperTaxLimit ++ "\n " ++ "Lower taxonomy limit: "++ show lowerTaxLimit ++ "\n") (tempDirPath staticOptions)        --search queries        let expectThreshold = setBlastExpectThreshold modelConstruction-       searchResults <- catchAll (searchCandidates staticOptions Nothing currentIterationNumber upperTaxLimit lowerTaxLimit expectThreshold queries) +       searchResults <- catchAll (searchCandidates staticOptions Nothing currentIterationNumber upperTaxLimit lowerTaxLimit expectThreshold queries)                         (\e -> do logWarning ("Warning: Search results iteration" ++ show (iterationNumber modelConstruction) ++ " - exception: " ++ show e) (tempDirPath staticOptions)                                   return (SearchResult [] Nothing))        currentTaxonomicContext <- getTaxonomicContextEntrez upperTaxLimit (taxonomicContext modelConstruction)        if null (candidates searchResults)-         then do+         then             alignmentConstructionWithoutCandidates currentTaxonomicContext upperTaxLimit staticOptions modelConstruction-         else do            +         else             alignmentConstructionWithCandidates currentTaxonomicContext upperTaxLimit searchResults staticOptions modelConstruction      else do-       logMessage ("Message: Modelconstruction complete: Out of queries or taxonomic tree exhausted\n") (tempDirPath staticOptions)+       logMessage "Message: Modelconstruction complete: Out of queries or taxonomic tree exhausted\n" (tempDirPath staticOptions)        modelConstructionResult staticOptions modelConstruction  catchAll :: IO a -> (CE.SomeException -> IO a) -> IO a catchAll = CE.catch  setInitialTaxId :: Maybe String -> String -> Maybe Int -> Sequence -> IO (Maybe Int)-setInitialTaxId inputBlastDatabase tempdir inputTaxId inputSequence = do+setInitialTaxId inputBlastDatabase tempdir inputTaxId inputSequence =   if (isNothing inputTaxId)     then do       initialTaxId <- findTaxonomyStart inputBlastDatabase tempdir inputSequence       return (Just initialTaxId)-    else do +    else do         return inputTaxId  extractLastTaxId :: Maybe Taxon -> Maybe Int-extractLastTaxId taxon +extractLastTaxId taxon   | isNothing taxon = Nothing   | V.null lineageExVector = Nothing   | otherwise = Just (lineageTaxId (V.head lineageExVector))@@ -144,8 +146,8 @@   let queries = extractQueries foundSequenceNumber modelConstruction ---   --let alignedSequences' = map nucleotideSequence (concatMap sequenceRecords (taxRecords modelConstruction)) ---   logVerboseMessage (verbositySwitch staticOptions) ("Queries:" ++ show queries ++ "\n") outputDirectory-  let iterationDirectory = outputDirectory ++ (show currentIterationNumber) ++ "/"-  createDirectory (iterationDirectory)+  let iterationDirectory = outputDirectory ++ show currentIterationNumber ++ "/"+  createDirectory iterationDirectory   let logFileDirectoryPath = iterationDirectory ++ "log"   createDirectoryIfMissing False logFileDirectoryPath   let expectThreshold = setBlastExpectThreshold modelConstruction@@ -168,7 +170,7 @@       candidates1 <- catchAll  (searchCandidates staticOptions (Just "archea") currentIterationNumber upperTaxLimit1 lowerTaxLimit1 expectThreshold queries)                      (\e -> do logWarning ("Warning: Search results iteration" ++ show currentIterationNumber ++ " - exception: " ++ show e) outputDirectory                                return (SearchResult [] Nothing))-      let uniqueCandidates1 = filterDuplicates modelConstruction candidates1 +      let uniqueCandidates1 = filterDuplicates modelConstruction candidates1       (alignmentResults1,potentialMembers1) <- catchAll (alignCandidates staticOptions modelConstruction "archea" uniqueCandidates1)                            (\e -> do logWarning ("Warning: Alignment results iteration" ++ show currentIterationNumber ++ " - exception: " ++ show e) outputDirectory                                      return  ([],[]))@@ -198,10 +200,10 @@   let preliminaryAlignmentPath = iterationDirectory ++ "model.stockholm"   let preliminaryCMLogPath = iterationDirectory ++ "model.cm.log"   let nextModelConstructionInput = constructNext currentIterationNumber modelConstruction alignmentResults Nothing Nothing [] currentPotentialMembers (alignmentModeInfernal modelConstruction)-  if (length alignmentResults == 0) && (not (alignmentModeInfernal modelConstruction))+  if (null alignmentResults) && not (alignmentModeInfernal modelConstruction)     then do-      logVerboseMessage (verbositySwitch staticOptions) ("Alignment result initial mode\n") outputDirectory-      logMessage ("Message: No sequences found that statisfy filters. Try to reconstruct model with less strict cutoff parameters.") outputDirectory+      logVerboseMessage (verbositySwitch staticOptions) "Alignment result initial mode\n" outputDirectory+      logMessage "Message: No sequences found that statisfy filters. Try to reconstruct model with less strict cutoff parameters." outputDirectory       let alignedSequences = extractAlignedSequences (iterationNumber modelConstruction) modelConstruction       let alignmentSequences = map snd (V.toList (V.concat [alignedSequences]))       writeFasta preliminaryFastaPath alignmentSequences@@ -216,9 +218,8 @@       writeFile preliminaryAlignmentPath stockholAlignment       _ <- systemCMbuild cmBuildOptions preliminaryAlignmentPath preliminaryCMPath cmBuildFilepath       _ <- systemCMcalibrate "fast" (cpuThreads staticOptions) preliminaryCMPath preliminaryCMLogPath-      resultModelConstruction <- reevaluatePotentialMembers staticOptions nextModelConstructionInput-      return resultModelConstruction-    else do     +      reevaluatePotentialMembers staticOptions nextModelConstructionInput+    else       if (alignmentModeInfernal modelConstruction)         then do           logVerboseMessage (verbositySwitch staticOptions) ("Alignment construction with candidates - infernal mode\n") outputDirectory@@ -245,8 +246,8 @@   let outputDirectory = tempDirPath staticOptions   iterationSummary modelConstruction staticOptions   logMessage ("Reevaluation of potential members iteration: " ++ show currentIterationNumber ++ "\n") outputDirectory-  let iterationDirectory = outputDirectory ++ (show currentIterationNumber) ++ "/"-  createDirectory (iterationDirectory)+  let iterationDirectory = outputDirectory ++ show currentIterationNumber ++ "/"+  createDirectory iterationDirectory   let indexedPotentialMembers = V.indexed (V.fromList (potentialMembers modelConstruction))   potentialMembersAlignmentResultVector <- V.mapM (\(i,searchresult) -> (alignCandidates staticOptions modelConstruction (show i ++ "_") searchresult)) indexedPotentialMembers   let potentialMembersAlignmentResults = V.toList potentialMembersAlignmentResultVector@@ -256,6 +257,7 @@   let resultFastaPath = outputDirectory  ++ "result.fa"   let resultCMPath = outputDirectory ++ "result.cm"   let resultAlignmentPath = outputDirectory ++ "result.stockholm"+  let resultClustalFilepath = outputDirectory ++ "result.clustal"   let resultCMLogPath = outputDirectory ++ "log/result.cm.log"   if null alignmentResults     then do@@ -267,13 +269,14 @@       copyFile lastIterationFastaPath resultFastaPath       copyFile lastIterationAlignmentPath resultAlignmentPath       _ <- systemCMcalibrate "standard" (cpuThreads staticOptions) resultCMPath resultCMLogPath+      systemCMalign ("--outformat=Clustal --cpu " ++ show (cpuThreads staticOptions)) resultCMPath resultFastaPath resultClustalFilepath       writeFile (iterationDirectory ++ "done") ""       return modelConstruction     else do       let lastIterationFastaPath = outputDirectory ++ show currentIterationNumber ++ "/model.fa"       let lastIterationAlignmentPath = outputDirectory ++ show currentIterationNumber  ++ "/model.stockholm"       let lastIterationCMPath = outputDirectory ++ show currentIterationNumber ++ "/model.cm"-      logVerboseMessage (verbositySwitch staticOptions) ("Alignment construction with candidates - infernal mode\n") outputDirectory+      logVerboseMessage (verbositySwitch staticOptions) "Alignment construction with candidates - infernal mode\n" outputDirectory       let nextModelConstructionInput = constructNext currentIterationNumber modelConstruction alignmentResults Nothing Nothing [] [] (alignmentModeInfernal modelConstruction)       constructModel nextModelConstructionInput staticOptions       copyFile lastIterationCMPath resultCMPath@@ -284,42 +287,42 @@       logMessage (iterationSummaryLog nextModelConstructionInput) outputDirectory       logVerboseMessage (verbositySwitch staticOptions) (show nextModelConstructionInput) outputDirectory       _ <- systemCMcalibrate "standard" (cpuThreads staticOptions) resultCMPath resultCMLogPath+      systemCMalign ("--outformat=Clustal --cpu " ++ show (cpuThreads staticOptions)) resultCMPath resultFastaPath resultClustalFilepath       writeFile (iterationDirectory ++ "done") ""       return nextModelConstructionInput-  + ----------------------------------------------------------                  + alignmentConstructionWithCandidates :: Maybe Taxon -> Maybe Int -> SearchResult -> StaticOptions -> ModelConstruction -> IO ModelConstruction alignmentConstructionWithCandidates currentTaxonomicContext currentUpperTaxonomyLimit searchResults staticOptions modelConstruction = do     --candidates usedUpperTaxonomyLimit blastDatabaseSize -    let currentIterationNumber = (iterationNumber modelConstruction)-    let iterationDirectory = (tempDirPath staticOptions) ++ (show currentIterationNumber) ++ "/"                             +    let currentIterationNumber = iterationNumber modelConstruction+    let iterationDirectory = tempDirPath staticOptions ++ show currentIterationNumber ++ "/"     --let usedUpperTaxonomyLimit = (snd (head candidates))                                    --align search result     (alignmentResults,potentialMemberEntries) <- catchAll (alignCandidates staticOptions modelConstruction "" searchResults)                         (\e -> do logWarning ("Warning: Alignment results iteration" ++ show (iterationNumber modelConstruction) ++ " - exception: " ++ show e) (tempDirPath staticOptions)                                   return ([],[]))     let currentPotentialMembers = [SearchResult potentialMemberEntries (blastDatabaseSize searchResults)]-    if (length alignmentResults == 0) && (not (alignmentModeInfernal modelConstruction))+    if (null alignmentResults) && not (alignmentModeInfernal modelConstruction)       then do         logVerboseMessage (verbositySwitch staticOptions) ("Alignment construction with candidates - length 1 - inital mode" ++ "\n") (tempDirPath staticOptions)         --too few sequences for alignment. because of lack in sequences no cm was constructed before         --reusing previous modelconstruction with increased upperTaxonomyLimit but include found sequence         --prepare next iteration-        let newTaxEntries = (taxRecords modelConstruction) ++ (buildTaxRecords alignmentResults currentIterationNumber)-        let nextModelConstructionInputWithThreshold = modelConstruction {iterationNumber = (currentIterationNumber + 1),upperTaxonomyLimit = currentUpperTaxonomyLimit, taxRecords = newTaxEntries,taxonomicContext = currentTaxonomicContext}+        let newTaxEntries = taxRecords modelConstruction ++ buildTaxRecords alignmentResults currentIterationNumber+        let nextModelConstructionInputWithThreshold = modelConstruction {iterationNumber = currentIterationNumber + 1,upperTaxonomyLimit = currentUpperTaxonomyLimit, taxRecords = newTaxEntries,taxonomicContext = currentTaxonomicContext}         logMessage (iterationSummaryLog nextModelConstructionInputWithThreshold) (tempDirPath staticOptions)         logVerboseMessage (verbositySwitch staticOptions)  (show nextModelConstructionInputWithThreshold) (tempDirPath staticOptions)     ----               writeFile (iterationDirectory ++ "done") ""-        nextModelConstruction <- modelConstructer staticOptions nextModelConstructionInputWithThreshold           -        return nextModelConstruction -      else do+        modelConstructer staticOptions nextModelConstructionInputWithThreshold+      else         if (alignmentModeInfernal modelConstruction)           then do             logVerboseMessage (verbositySwitch staticOptions) ("Alignment construction with candidates - infernal mode\n") (tempDirPath staticOptions)             --prepare next iteration-            let nextModelConstructionInput = constructNext currentIterationNumber modelConstruction alignmentResults currentUpperTaxonomyLimit currentTaxonomicContext [] currentPotentialMembers True        -            constructModel nextModelConstructionInput staticOptions               +            let nextModelConstructionInput = constructNext currentIterationNumber modelConstruction alignmentResults currentUpperTaxonomyLimit currentTaxonomicContext [] currentPotentialMembers True+            constructModel nextModelConstructionInput staticOptions             writeFile (iterationDirectory ++ "done") ""             logMessage (iterationSummaryLog nextModelConstructionInput) (tempDirPath staticOptions)             logVerboseMessage (verbositySwitch staticOptions)  (show nextModelConstructionInput) (tempDirPath staticOptions)@@ -332,7 +335,7 @@             logVerboseMessage (verbositySwitch staticOptions) ("Alignment construction with candidates - initial mode\n") (tempDirPath staticOptions)             --First round enough candidates are available for modelconstruction, alignmentModeInfernal is set to true after this iteration             --prepare next iteration-            let nextModelConstructionInput = constructNext currentIterationNumber modelConstruction alignmentResults currentUpperTaxonomyLimit currentTaxonomicContext [] currentPotentialMembers False       +            let nextModelConstructionInput = constructNext currentIterationNumber modelConstruction alignmentResults currentUpperTaxonomyLimit currentTaxonomicContext [] currentPotentialMembers False             constructModel nextModelConstructionInput staticOptions             currentSelectedQueries <- selectQueries staticOptions modelConstruction alignmentResults             --select queries@@ -340,104 +343,101 @@             logMessage (iterationSummaryLog  nextModelConstructionInputWithInfernalMode) (tempDirPath staticOptions)             logVerboseMessage (verbositySwitch staticOptions)  (show  nextModelConstructionInputWithInfernalMode) (tempDirPath staticOptions)             writeFile (iterationDirectory ++ "done") ""-            nextModelConstruction <- modelConstructer staticOptions nextModelConstructionInputWithInfernalMode        +            nextModelConstruction <- modelConstructer staticOptions nextModelConstructionInputWithInfernalMode             return nextModelConstruction-               + alignmentConstructionWithoutCandidates :: Maybe Taxon -> Maybe Int ->  StaticOptions -> ModelConstruction -> IO ModelConstruction alignmentConstructionWithoutCandidates currentTaxonomicContext upperTaxLimit staticOptions modelConstruction = do-    let currentIterationNumber = (iterationNumber modelConstruction)-    let iterationDirectory = (tempDirPath staticOptions) ++ (show currentIterationNumber) ++ "/"   +    let currentIterationNumber = iterationNumber modelConstruction+    let iterationDirectory = tempDirPath staticOptions ++ show currentIterationNumber ++ "/"     --Found no new candidates in this iteration, reusing previous modelconstruction with increased upperTaxonomyLimit-    let nextModelConstructionInputWithThreshold = modelConstruction  {iterationNumber = (currentIterationNumber + 1),upperTaxonomyLimit = upperTaxLimit,taxonomicContext = currentTaxonomicContext}+    let nextModelConstructionInputWithThreshold = modelConstruction  {iterationNumber = currentIterationNumber + 1,upperTaxonomyLimit = upperTaxLimit,taxonomicContext = currentTaxonomicContext}     --copy model and alignment from last iteration in place if present-    let previousIterationCMPath = (tempDirPath staticOptions) ++ (show (currentIterationNumber - 1)) ++ "/model.cm"+    let previousIterationCMPath = tempDirPath staticOptions ++ show (currentIterationNumber - 1) ++ "/model.cm"     previousIterationCMexists <- doesFileExist previousIterationCMPath     if previousIterationCMexists       then do-        logVerboseMessage (verbositySwitch staticOptions) ("Alignment construction no candidates - previous cm\n") (tempDirPath staticOptions)-        let previousIterationFastaPath = (tempDirPath staticOptions) ++ (show (currentIterationNumber - 1)) ++ "/model.fa"-        let previousIterationAlignmentPath = (tempDirPath staticOptions) ++ (show (currentIterationNumber - 1)) ++ "/model.stockholm"-        let thisIterationFastaPath = (tempDirPath staticOptions) ++ (show (currentIterationNumber)) ++ "/model.fa"-        let thisIterationAlignmentPath = (tempDirPath staticOptions) ++ (show (currentIterationNumber)) ++ "/model.stockholm"-        let thisIterationCMPath = (tempDirPath staticOptions) ++ (show (currentIterationNumber)) ++ "/model.cm"+        logVerboseMessage (verbositySwitch staticOptions) "Alignment construction no candidates - previous cm\n" (tempDirPath staticOptions)+        let previousIterationFastaPath = tempDirPath staticOptions ++ show (currentIterationNumber - 1) ++ "/model.fa"+        let previousIterationAlignmentPath = tempDirPath staticOptions ++ show (currentIterationNumber - 1) ++ "/model.stockholm"+        let thisIterationFastaPath = tempDirPath staticOptions ++ show (currentIterationNumber) ++ "/model.fa"+        let thisIterationAlignmentPath = tempDirPath staticOptions ++ show (currentIterationNumber) ++ "/model.stockholm"+        let thisIterationCMPath = tempDirPath staticOptions ++ show (currentIterationNumber) ++ "/model.cm"         copyFile previousIterationFastaPath thisIterationFastaPath         copyFile previousIterationAlignmentPath thisIterationAlignmentPath         copyFile previousIterationCMPath thisIterationCMPath         logMessage (iterationSummaryLog nextModelConstructionInputWithThreshold) (tempDirPath staticOptions)         logVerboseMessage (verbositySwitch staticOptions) (show nextModelConstructionInputWithThreshold) (tempDirPath staticOptions)         writeFile (iterationDirectory ++ "done") ""-        nextModelConstruction <- modelConstructer staticOptions nextModelConstructionInputWithThreshold           -        return nextModelConstruction+        modelConstructer staticOptions nextModelConstructionInputWithThreshold       else do-        logVerboseMessage (verbositySwitch staticOptions) ("Alignment construction no candidates - no previous iteration cm\n") (tempDirPath staticOptions)+        logVerboseMessage (verbositySwitch staticOptions) "Alignment construction no candidates - no previous iteration cm\n" (tempDirPath staticOptions)         logMessage (iterationSummaryLog nextModelConstructionInputWithThreshold) (tempDirPath staticOptions)         logVerboseMessage (verbositySwitch staticOptions) (show nextModelConstructionInputWithThreshold) (tempDirPath staticOptions)    ----                writeFile (iterationDirectory ++ "done") ""-        nextModelConstruction <- modelConstructer staticOptions nextModelConstructionInputWithThreshold           -        return nextModelConstruction-           +        modelConstructer staticOptions nextModelConstructionInputWithThreshold+ findTaxonomyStart :: Maybe String -> String -> Sequence -> IO Int findTaxonomyStart inputBlastDatabase temporaryDirectory querySequence = do   let queryIndexString = "1"-  let hitNumberQuery = buildHitNumberQuery "&HITLIST_SIZE=10" +  let hitNumberQuery = buildHitNumberQuery "&HITLIST_SIZE=10"   let registrationInfo = buildRegistration "RNAlien" "florian.eggenhofer@univie.ac.at"   let blastQuery = BlastHTTPQuery (Just "ncbi") (Just "blastn") inputBlastDatabase [querySequence] (Just (hitNumberQuery ++ registrationInfo)) (Just (5400000000 :: Int))-  logMessage ("No tax id provided - Sending find taxonomy start blast query \n") temporaryDirectory+  logMessage "No tax id provided - Sending find taxonomy start blast query \n" temporaryDirectory   blastOutput <- CE.catch (blastHTTP blastQuery)                        (\e -> do let err = show (e :: CE.IOException)                                  logWarning ("Warning: Blast attempt failed:" ++ " " ++ err) temporaryDirectory                                  error "findTaxonomyStart: Blast attempt failed"                                  return (Left ""))-  let logFileDirectoryPath =  temporaryDirectory ++ "taxonomystart" ++ "/" +  let logFileDirectoryPath =  temporaryDirectory ++ "taxonomystart" ++ "/"   createDirectory logFileDirectoryPath   writeFile (logFileDirectoryPath ++ "/" ++ queryIndexString  ++ "_1blastOutput") (show blastOutput)-  logEither blastOutput temporaryDirectory -  let blastHitsArePresent = either (\_ -> False) blastMatchesPresent blastOutput-  if (blastHitsArePresent)+  logEither blastOutput temporaryDirectory+  let blastHitsArePresent = either (const False) blastMatchesPresent blastOutput+  if blastHitsArePresent      then do        let rightBlast = fromRight blastOutput        let bestHit = getBestHit rightBlast        bestBlastHitTaxIdOutput <- retrieveBlastHitTaxIdEntrez [bestHit]        let taxIdFromEntrySummaries = extractTaxIdFromEntrySummaries (snd bestBlastHitTaxIdOutput)-       if (null taxIdFromEntrySummaries) then (error "findTaxonomyStart: - head: empty list of taxonomy entry summary for best hit")  else return ()+       Control.Monad.when (null taxIdFromEntrySummaries) (error "findTaxonomyStart: - head: empty list of taxonomy entry summary for best hit")        let rightBestTaxIdResult = head taxIdFromEntrySummaries-       logMessage ("Initial TaxId: " ++ (show rightBestTaxIdResult) ++ "\n") temporaryDirectory+       logMessage ("Initial TaxId: " ++ show rightBestTaxIdResult ++ "\n") temporaryDirectory        CE.evaluate rightBestTaxIdResult      else error "Find taxonomy start: Could not find blast hits to use as a taxonomic starting point"  searchCandidates :: StaticOptions -> Maybe String -> Int ->  Maybe Int -> Maybe Int -> Double -> [Sequence] -> IO SearchResult searchCandidates staticOptions finaliterationprefix iterationnumber upperTaxLimit lowerTaxLimit expectThreshold inputQuerySequences = do   --let fastaSeqData = seqdata _querySequence-  if (null inputQuerySequences) then error "searchCandidates: - head: empty list of query sequences" else return ()+  Control.Monad.when (null inputQuerySequences) $ error "searchCandidates: - head: empty list of query sequences"   let queryLength = fromIntegral (seqlength (head inputQuerySequences))   let queryIndexString = "1"-  let entrezTaxFilter = buildTaxFilterQuery upperTaxLimit lowerTaxLimit +  let entrezTaxFilter = buildTaxFilterQuery upperTaxLimit lowerTaxLimit   logVerboseMessage (verbositySwitch staticOptions) ("entrezTaxFilter" ++ show entrezTaxFilter ++ "\n") (tempDirPath staticOptions)   let hitNumberQuery = buildHitNumberQuery "&HITLIST_SIZE=5000&EXPECT=" ++ show expectThreshold   let registrationInfo = buildRegistration "RNAlien" "florian.eggenhofer@univie.ac.at"-  let softmaskFilter = if (blastSoftmaskingToggle staticOptions) then "&FILTER=True&FILTER=m" else ""+  let softmaskFilter = if blastSoftmaskingToggle staticOptions then "&FILTER=True&FILTER=m" else ""   let blastQuery = BlastHTTPQuery (Just "ncbi") (Just "blastn") (blastDatabase staticOptions) inputQuerySequences  (Just (hitNumberQuery ++ entrezTaxFilter ++ softmaskFilter ++ registrationInfo)) (Just (5400000000 :: Int))   --appendFile "/scratch/egg/blasttest/queries" ("\nBlast query:\n"  ++ show blastQuery ++ "\n") -  logVerboseMessage (verbositySwitch staticOptions) ("Sending blast query " ++ (show iterationnumber) ++ "\n") (tempDirPath staticOptions)+  logVerboseMessage (verbositySwitch staticOptions) ("Sending blast query " ++ show iterationnumber ++ "\n") (tempDirPath staticOptions)   blastOutput <- CE.catch (blastHTTP blastQuery)                        (\e -> do let err = show (e :: CE.IOException)                                  logWarning ("Warning: Blast attempt failed:" ++ " " ++ err) (tempDirPath staticOptions)                                  return (Left ""))-  let logFileDirectoryPath = (tempDirPath staticOptions) ++ (show iterationnumber) ++ "/" ++ (fromMaybe "" finaliterationprefix) ++ "log"-  logDirectoryPresent <- doesDirectoryExist logFileDirectoryPath                      -  if (not logDirectoryPresent)-    then createDirectory (logFileDirectoryPath) else return ()+  let logFileDirectoryPath = tempDirPath staticOptions ++ show iterationnumber ++ "/" ++ fromMaybe "" finaliterationprefix ++ "log"+  logDirectoryPresent <- doesDirectoryExist logFileDirectoryPath+  Control.Monad.when (not logDirectoryPresent) $ createDirectory (logFileDirectoryPath)   writeFile (logFileDirectoryPath ++ "/" ++ queryIndexString  ++ "_1blastOutput") (show blastOutput)-  logEither blastOutput (tempDirPath staticOptions) +  logEither blastOutput (tempDirPath staticOptions)   let blastHitsArePresent = either (const False) blastMatchesPresent blastOutput   if blastHitsArePresent      then do        let rightBlast = fromRight blastOutput-      -- bestBlastHitTaxIdOutput <- retrieveBlastHitTaxIdEntrez [bestHit]-      -- let taxIdFromEntrySummaries = extractTaxIdFromEntrySummaries bestBlastHitTaxIdOutput-      -- if (null taxIdFromEntrySummaries) then (error "searchCandidates: - head: empty list of taxonomy entry summary for best hit")  else return ()-      -- let rightBestTaxIdResult = head taxIdFromEntrySummaries-      -- logVerboseMessage (verbositySwitch staticOptions) ("rightbestTaxIdResult: " ++ (show rightBestTaxIdResult) ++ "\n") (tempDirPath staticOptions)+       -- bestBlastHitTaxIdOutput <- retrieveBlastHitTaxIdEntrez [bestHit]+       -- let taxIdFromEntrySummaries = extractTaxIdFromEntrySummaries bestBlastHitTaxIdOutput+       -- if (null taxIdFromEntrySummaries) then (error "searchCandidates: - head: empty list of taxonomy entry summary for best hit")  else return ()+       -- let rightBestTaxIdResult = head taxIdFromEntrySummaries+       -- logVerboseMessage (verbositySwitch staticOptions) ("rightbestTaxIdResult: " ++ (show rightBestTaxIdResult) ++ "\n") (tempDirPath staticOptions)        let blastHits = concatMap hits (results rightBlast)        writeFile (logFileDirectoryPath ++ "/" ++ queryIndexString  ++ "_2blastHits") (showlines blastHits)        --filter by length@@ -447,7 +447,7 @@        writeFile (logFileDirectoryPath ++ "/" ++ queryIndexString  ++ "_3ablastHitsFilteredByLength") (showlines blastHitsFilteredByCoverage)        --tag BlastHits with TaxId        blastHitsWithTaxIdOutput <- retrieveBlastHitsTaxIdEntrez blastHitsFilteredByCoverage-       let uncheckedBlastHitsWithTaxIdList = map (\(blasthits,taxIdout) -> (blasthits,extractTaxIdFromEntrySummaries taxIdout)) blastHitsWithTaxIdOutput+       let uncheckedBlastHitsWithTaxIdList = map (Control.Arrow.second extractTaxIdFromEntrySummaries) blastHitsWithTaxIdOutput        let checkedBlastHitsWithTaxId = filter (\(_,taxids) -> not (null taxids)) uncheckedBlastHitsWithTaxIdList        --todo checked blasthittaxidswithblasthits need to be merged as taxid blasthit pairs        let blastHitsWithTaxId = zip (concatMap fst checkedBlastHitsWithTaxId) (concatMap snd checkedBlastHitsWithTaxId)@@ -479,15 +479,15 @@            writeFile (logFileDirectoryPath ++ "/" ++ queryIndexString ++ "_10fullSequences") (showlines fullSequences)            let maybeFractionEvalueMatch = getHitWithFractionEvalue rightBlast            if isNothing maybeFractionEvalueMatch-             then CE.evaluate (SearchResult [] Nothing) +             then CE.evaluate (SearchResult [] Nothing)              else do                let fractionEvalueMatch = fromJust maybeFractionEvalueMatch                let dbSize = computeDataBaseSize (e_val fractionEvalueMatch) (bits fractionEvalueMatch) (fromIntegral queryLength ::Double)                CE.evaluate (SearchResult fullSequences (Just dbSize))-     else CE.evaluate (SearchResult [] Nothing)  +     else CE.evaluate (SearchResult [] Nothing)  -- |Computes size of blast db in Mb -computeDataBaseSize :: Double -> Double -> Double -> Double +computeDataBaseSize :: Double -> Double -> Double -> Double computeDataBaseSize evalue bitscore querylength = ((evalue * 2 ** bitscore) / querylength)/10^(6 :: Integer)  alignCandidates :: StaticOptions -> ModelConstruction -> String -> SearchResult -> IO ([(Sequence,Int,L.ByteString)],[(Sequence,Int,L.ByteString)])@@ -496,7 +496,7 @@   createDirectoryIfMissing False (iterationDirectory ++ "log")   if null (candidates searchResults)     then do-      writeFile (iterationDirectory ++ "log" ++ "/11candidates") ("No candidates to align")+      writeFile (iterationDirectory ++ "log" ++ "/11candidates") "No candidates to align"       return ([],[])     else do       --refilter for similarity@@ -511,26 +511,26 @@ alignCandidatesInfernalMode :: StaticOptions -> ModelConstruction -> String -> Maybe Double -> [(Sequence,Int,L.ByteString)] -> IO ([(Sequence,Int,L.ByteString)],[(Sequence,Int,L.ByteString)]) alignCandidatesInfernalMode staticOptions modelConstruction multipleSearchResultPrefix blastDbSize filteredCandidates = do   let iterationDirectory = tempDirPath staticOptions ++ show (iterationNumber modelConstruction) ++ "/" ++ multipleSearchResultPrefix-  let candidateSequences = extractCandidateSequences filteredCandidates +  let candidateSequences = extractCandidateSequences filteredCandidates   logVerboseMessage (verbositySwitch staticOptions) "Alignment Mode Infernal\n" (tempDirPath staticOptions)-  let indexedCandidateSequenceList = (V.toList candidateSequences)+  let indexedCandidateSequenceList = V.toList candidateSequences   let cmSearchFastaFilePaths = map (constructFastaFilePaths iterationDirectory) indexedCandidateSequenceList   let cmSearchFilePaths = map (constructCMsearchFilePaths iterationDirectory) indexedCandidateSequenceList   let covarianceModelPath = tempDirPath staticOptions ++ show (iterationNumber modelConstruction - 1) ++ "/" ++ "model.cm"   mapM_ (\(number,_nucleotideSequence) -> writeFasta (iterationDirectory ++ show number ++ ".fa") [_nucleotideSequence]) indexedCandidateSequenceList-  let zippedFastaCMSearchResultPaths = zip cmSearchFastaFilePaths cmSearchFilePaths  +  let zippedFastaCMSearchResultPaths = zip cmSearchFastaFilePaths cmSearchFilePaths   --check with cmSearch   mapM_ (uncurry (systemCMsearch (cpuThreads staticOptions) ("-Z " ++ show (fromJust blastDbSize)) covarianceModelPath)) zippedFastaCMSearchResultPaths-  cmSearchResults <- mapM readCMSearch cmSearchFilePaths +  cmSearchResults <- mapM readCMSearch cmSearchFilePaths   writeFile (iterationDirectory ++ "cm_error") (concatMap show (lefts cmSearchResults))-  let rightCMSearchResults = rights cmSearchResults -  let cmSearchCandidatesWithSequences = zip rightCMSearchResults filteredCandidates    +  let rightCMSearchResults = rights cmSearchResults+  let cmSearchCandidatesWithSequences = zip rightCMSearchResults filteredCandidates   let (trimmedSelectedCandidates,potentialCandidates,rejectedCandidates) = evaluePartitionTrimCMsearchHits (evalueThreshold modelConstruction) cmSearchCandidatesWithSequences   createDirectoryIfMissing False (iterationDirectory ++ "log")   writeFile (iterationDirectory ++ "log" ++ "/13selectedCandidates'") (showlines trimmedSelectedCandidates)   writeFile (iterationDirectory ++ "log" ++ "/14rejectedCandidates'") (showlines rejectedCandidates)-  writeFile (iterationDirectory ++ "log" ++ "/15potentialCandidates'") (showlines potentialCandidates)                                         -  CE.evaluate (map snd trimmedSelectedCandidates,map snd potentialCandidates)+  writeFile (iterationDirectory ++ "log" ++ "/15potentialCandidates'") (showlines potentialCandidates)+  return (map snd trimmedSelectedCandidates,map snd potentialCandidates)  alignCandidatesInitialMode :: StaticOptions -> ModelConstruction -> String -> [(Sequence,Int,L.ByteString)] -> IO ([(Sequence,Int,L.ByteString)],[(Sequence,Int,L.ByteString)]) alignCandidatesInitialMode staticOptions modelConstruction multipleSearchResultPrefix filteredCandidates = do@@ -543,7 +543,7 @@   --write Fasta sequences   let inputFastaFilepath = iterationDirectory ++ "input.fa"   let inputFoldFilepath = iterationDirectory ++ "input.fold"-  writeFasta (iterationDirectory ++ "input.fa") ([inputFasta modelConstruction])+  writeFasta (iterationDirectory ++ "input.fa") [inputFasta modelConstruction]   logMessage (showlines (V.toList candidateSequences)) (tempDirPath staticOptions)   V.mapM_ (\(number,nucleotideSequence') -> writeFasta (iterationDirectory ++ show number ++ ".fa") [nucleotideSequence']) candidateSequences   let candidateFastaFilepath = V.toList (V.map (\(number,_) -> iterationDirectory ++ show number ++ ".fa") candidateSequences)@@ -567,21 +567,21 @@   let consensusMFE = map (alignmentConsensusMinimumFreeEnergy . fromRight) alifoldResults   let sciidfraction = map (\(consMFE,averMFE,seqId) -> (consMFE/averMFE)/seqId) (zip3 consensusMFE averageMFEs (V.toList sequenceIdentities))   let idlog = concatMap (\(sciidfraction',consMFE,averMFE,seqId) -> show sciidfraction' ++ "," ++ show consMFE ++ "," ++ show averMFE ++ "," ++ show seqId ++ "\n")(zip4 sciidfraction consensusMFE averageMFEs (V.toList sequenceIdentities))-  writeFile (iterationDirectory ++ "log" ++ "/idlog") (idlog)+  writeFile (iterationDirectory ++ "log" ++ "/idlog") idlog   let alignedCandidates = zip sciidfraction filteredCandidates   writeFile (iterationDirectory ++ "log" ++ "/zscores") (showlines alignedCandidates)   let (selectedCandidates,rejectedCandidates) = partition (\(sciidfraction',_) -> sciidfraction' > nSCICutoff staticOptions) alignedCandidates   mapM_ print (zip3 consensusMFE averageMFEs (V.toList sequenceIdentities))   writeFile (iterationDirectory ++ "log" ++ "/13selectedCandidates") (showlines selectedCandidates)   writeFile (iterationDirectory ++ "log" ++ "/14rejectedCandidates") (showlines rejectedCandidates)-  CE.evaluate (map snd selectedCandidates,[])+  return (map snd selectedCandidates,[])  setClusterNumber :: Int -> Int setClusterNumber x-  | x <= 5 = x -  | otherwise = 5 +  | x <= 5 = x+  | otherwise = 5 -findCutoffforClusterNumber :: Dendrogram a -> Int -> Distance -> Distance                +findCutoffforClusterNumber :: Dendrogram a -> Int -> Distance -> Distance findCutoffforClusterNumber clustaloDendrogram numberOfClusters currentCutoff   | currentClusterNumber >= numberOfClusters = currentCutoff   | otherwise = findCutoffforClusterNumber clustaloDendrogram numberOfClusters (currentCutoff-0.01)@@ -592,20 +592,20 @@ selectQueries staticOptions modelConstruction selectedCandidates = do   logVerboseMessage (verbositySwitch staticOptions) "SelectQueries\n" (tempDirPath staticOptions)   --Extract sequences from modelconstruction-  let alignedSequences = extractAlignedSequences (iterationNumber modelConstruction) modelConstruction +  let alignedSequences = extractAlignedSequences (iterationNumber modelConstruction) modelConstruction   let candidateSequences = extractQueryCandidates selectedCandidates   let iterationDirectory = tempDirPath staticOptions ++ show (iterationNumber modelConstruction) ++ "/"   let stockholmFilepath = iterationDirectory ++ "model" ++ ".stockholm"   let alignmentSequences = map snd (V.toList (V.concat [candidateSequences,alignedSequences]))   if length alignmentSequences > 3-    then do+    then       if (querySelectionMethod staticOptions) == "clustering"         then do           --write Fasta sequences           writeFasta (iterationDirectory ++ "query" ++ ".fa") alignmentSequences           let fastaFilepath = iterationDirectory ++ "query" ++ ".fa"           let clustaloFilepath = iterationDirectory ++ "query" ++ ".clustalo"-          let clustaloDistMatrixPath = iterationDirectory ++ "query" ++ ".matrix" +          let clustaloDistMatrixPath = iterationDirectory ++ "query" ++ ".matrix"           alignSequences "clustalo" ("--full --distmat-out=" ++ clustaloDistMatrixPath ++ " ") [fastaFilepath] [] [clustaloFilepath] []           idsDistancematrix <- readClustaloDistMatrix clustaloDistMatrixPath           logEither idsDistancematrix (tempDirPath staticOptions)@@ -630,7 +630,7 @@           --Stockholm sequnces contain conservation annotation from cmalign in infernal mode           let currentSelectedSequences = if (blastSoftmaskingToggle staticOptions) then stockholmSelectedSequences else fastaSelectedSequences           --let currentSelectedQueries = concatMap (\querySeqId -> filter (\alignedSeq -> L.unpack (unSL (seqid alignedSeq)) == querySeqId) alignmentSequences) querySeqIds-          logVerboseMessage (verbositySwitch staticOptions) ("SelectedQueries: " ++ show currentSelectedSequences ++ "\n") (tempDirPath staticOptions)                       +          logVerboseMessage (verbositySwitch staticOptions) ("SelectedQueries: " ++ show currentSelectedSequences ++ "\n") (tempDirPath staticOptions)           writeFile (tempDirPath staticOptions ++ show (iterationNumber modelConstruction) ++ "/log" ++ "/13selectedQueries") (showlines currentSelectedSequences)           CE.evaluate currentSelectedSequences         else do@@ -663,7 +663,7 @@   let stockholmFilepath = outputDirectory ++ "model" ++ ".stockholm"   --- let reformatedClustalFilepath = outputDirectory ++ "model" ++ ".clustal.reformated"   let updatedStructureStockholmFilepath = outputDirectory ++ "newstructuremodel" ++ ".stockholm"-  let cmalignCMFilepath = (tempDirPath staticOptions) ++ show (iterationNumber modelConstruction - 2) ++ "/" ++ "model" ++ ".cm"+  let cmalignCMFilepath = tempDirPath staticOptions ++ show (iterationNumber modelConstruction - 2) ++ "/" ++ "model" ++ ".cm"   let cmFilepath = outputDirectory ++ "model" ++ ".cm"   let cmCalibrateFilepath = outputDirectory ++ "model" ++ ".cmcalibrate"   let cmBuildFilepath = outputDirectory ++ "model" ++ ".cmbuild"@@ -703,7 +703,7 @@   inputAln <- readFile stockholmFilepath   inputRNAalifold <- readRNAalifold alifoldFilepath   if isLeft inputRNAalifold-    then do+    then      return (show (fromLeft inputRNAalifold))     else do      let alifoldstructure = alignmentConsensusDotBracket (fromRight inputRNAalifold)@@ -711,7 +711,7 @@      let structureIndices = V.toList (V.findIndices isStructureLine seedLinesVector)      let updatedStructureElements = updateStructureElements seedLinesVector alifoldstructure structureIndices      let newVector = seedLinesVector V.// updatedStructureElements-     let newVectorString = concatMap (++ "\n") (V.toList newVector)+     let newVectorString = unlines (V.toList newVector)      writeFile updatedStructureStockholmFilepath newVectorString      return [] @@ -736,14 +736,14 @@ iterationSummaryLog mC = output   where upperTaxonomyLimitOutput = maybe "not set" show (upperTaxonomyLimit mC)         output = "Upper taxonomy id limit: " ++ upperTaxonomyLimitOutput ++ ", Collected members: " ++ show (length (concatMap sequenceRecords (taxRecords mC))) ++ "\n"-             + -- | Used for passing progress to Alien server  iterationSummary :: ModelConstruction -> StaticOptions -> IO() iterationSummary mC sO = do   --iteration -- tax limit -- bitscore cutoff -- blastresult -- aligned seqs --queries --fa link --aln link --cm link   let upperTaxonomyLimitOutput = maybe "not set" show (upperTaxonomyLimit mC)   let output = show (iterationNumber mC) ++ "," ++ upperTaxonomyLimitOutput ++ "," ++ show (length (concatMap sequenceRecords (taxRecords mC)))-  writeFile ((tempDirPath sO) ++ "/log/" ++ show (iterationNumber mC) ++ ".log") output        +  writeFile (tempDirPath sO ++ "/log/" ++ show (iterationNumber mC) ++ ".log") output  -- | Used for passing progress to Alien server  resultSummary :: ModelConstruction -> StaticOptions -> IO()@@ -751,16 +751,16 @@   --iteration -- tax limit -- bitscore cutoff -- blastresult -- aligned seqs --queries --fa link --aln link --cm link   let upperTaxonomyLimitOutput = maybe "not set" show (upperTaxonomyLimit mC)   let output = show (iterationNumber mC) ++ "," ++ upperTaxonomyLimitOutput ++ "," ++ show (length (concatMap sequenceRecords (taxRecords mC)))-  writeFile (tempDirPath sO ++ "/log/result" ++ ".log") output        -                       -readClustaloDistMatrix :: String -> IO (Either ParseError ([String],Matrix Double))             -readClustaloDistMatrix = parseFromFile genParserClustaloDistMatrix -                      +  writeFile (tempDirPath sO ++ "/log/result" ++ ".log") output++readClustaloDistMatrix :: String -> IO (Either ParseError ([String],Matrix Double))+readClustaloDistMatrix = parseFromFile genParserClustaloDistMatrix+ genParserClustaloDistMatrix :: GenParser Char st ([String],Matrix Double) genParserClustaloDistMatrix = do   _ <- many1 digit   newline-  clustaloDistRow <- many1 (try genParserClustaloDistRow) +  clustaloDistRow <- many1 (try genParserClustaloDistRow)   eof   return (map fst clustaloDistRow,fromLists (map snd clustaloDistRow)) @@ -801,21 +801,21 @@ --filterIdenticalSequencesWithOrigin [] _ = []  -- | Filter a list of similar extended blast hits   -filterIdenticalSequences :: [(Sequence,Int,L.ByteString)] -> Double -> [(Sequence,Int,L.ByteString)] +filterIdenticalSequences :: [(Sequence,Int,L.ByteString)] -> Double -> [(Sequence,Int,L.ByteString)] filterIdenticalSequences (headSequence:rest) identitycutoff = result-  where filteredSequences = filter (\x -> sequenceIdentity (firstOfTriple headSequence) (firstOfTriple x) < identitycutoff) rest +  where filteredSequences = filter (\x -> sequenceIdentity (firstOfTriple headSequence) (firstOfTriple x) < identitycutoff) rest         result = headSequence:filterIdenticalSequences filteredSequences identitycutoff filterIdenticalSequences [] _ = []  -- | Filter sequences too similar to already aligned sequences-filterWithCollectedSequences :: [(Sequence,Int,L.ByteString)] -> [Sequence] -> Double -> [(Sequence,Int,L.ByteString)]                            -filterWithCollectedSequences inputCandidates collectedSequences identitycutoff = filter (isUnSimilarSequence collectedSequences identitycutoff . firstOfTriple) inputCandidates +filterWithCollectedSequences :: [(Sequence,Int,L.ByteString)] -> [Sequence] -> Double -> [(Sequence,Int,L.ByteString)]+filterWithCollectedSequences inputCandidates collectedSequences identitycutoff = filter (isUnSimilarSequence collectedSequences identitycutoff . firstOfTriple) inputCandidates --filterWithCollectedSequences [] [] _ = []  -- | Filter alignment entries by similiarity   filterIdenticalSequences' :: [Sequence] -> Double -> [Sequence] filterIdenticalSequences' (headEntry:rest) identitycutoff = result-  where filteredEntries = filter (\ x -> (sequenceIdentity headEntry x) < identitycutoff) rest+  where filteredEntries = filter (\ x -> sequenceIdentity headEntry x < identitycutoff) rest         result = headEntry:filterIdenticalSequences' filteredEntries identitycutoff filterIdenticalSequences' [] _ = [] @@ -827,14 +827,14 @@ --filterIdenticalAlignmentEntry [] _ = []  isUnSimilarSequence :: [Sequence] -> Double -> Sequence -> Bool-isUnSimilarSequence collectedSequences identitycutoff checkSequence = any (\ x -> (sequenceIdentity checkSequence x) < identitycutoff) collectedSequences-                +isUnSimilarSequence collectedSequences identitycutoff checkSequence = any (\ x -> sequenceIdentity checkSequence x < identitycutoff) collectedSequences+ firstOfTriple :: (t, t1, t2) -> t-firstOfTriple (a,_,_) = a +firstOfTriple (a,_,_) = a  -- | Check if the result field of BlastResult is filled and if hits are present blastMatchesPresent :: BlastResult -> Bool-blastMatchesPresent blastResult +blastMatchesPresent blastResult   | null resultList = False   | otherwise = True   where resultList = concatMap matches (concatMap hits (results blastResult))@@ -848,8 +848,8 @@          maximumDistance = maximum [T.length text1, T.length text2]          distanceDouble = toInteger ( fromJust distance )          identityPercent = 1 - (fromIntegral distanceDouble/fromIntegral maximumDistance)- -                     ++ -- | Compute identity of sequences -- stringIdentity :: String -> String -> Double -- stringIdentity string1 string2 = identityPercent@@ -869,7 +869,7 @@         identityPercent = 100 - ((fromIntegral distance/fromIntegral maximumDistance) * (read "100" ::Double))  getTaxonomicContextEntrez :: Maybe Int -> Maybe Taxon -> IO (Maybe Taxon)-getTaxonomicContextEntrez upperTaxLimit currentTaxonomicContext = do+getTaxonomicContextEntrez upperTaxLimit currentTaxonomicContext =   if isJust upperTaxLimit       then if isJust currentTaxonomicContext         then return currentTaxonomicContext@@ -878,12 +878,12 @@     else return Nothing  setTaxonomicContextEntrez :: Int -> Maybe Taxon -> Maybe Int -> (Maybe Int, Maybe Int)-setTaxonomicContextEntrez currentIterationNumber currentTaxonomicContext subTreeTaxId +setTaxonomicContextEntrez currentIterationNumber currentTaxonomicContext subTreeTaxId   | currentIterationNumber == 0 = (subTreeTaxId, Nothing)   | otherwise = setUpperLowerTaxLimitEntrez (fromJust subTreeTaxId) (fromJust currentTaxonomicContext)-                          + -- setTaxonomic Context for next candidate search, the upper bound of the last search become the lower bound of the next-setUpperLowerTaxLimitEntrez :: Int -> Taxon -> (Maybe Int, Maybe Int) +setUpperLowerTaxLimitEntrez :: Int -> Taxon -> (Maybe Int, Maybe Int) setUpperLowerTaxLimitEntrez subTreeTaxId currentTaxonomicContext = (upperLimit,lowerLimit)   where upperLimit = raiseTaxIdLimitEntrez subTreeTaxId currentTaxonomicContext         lowerLimit = Just subTreeTaxId@@ -895,7 +895,7 @@         lineageExVector = V.fromList (lineageEx taxon)         --the input taxid is not part of the lineage, therefor we look for further taxids in the lineage after we used the parent tax id of the input node         parentNodeTaxId = if subTreeTaxId == taxonTaxId taxon then Just (taxonParentTaxId taxon) else linageNodeTaxId-       + constructNext :: Int -> ModelConstruction -> [(Sequence,Int,L.ByteString)] -> Maybe Int -> Maybe Taxon  -> [Sequence] -> [SearchResult] -> Bool -> ModelConstruction constructNext currentIterationNumber modelconstruction alignmentResults upperTaxLimit inputTaxonomicContext inputSelectedQueries inputPotentialMembers toggleInfernalAlignmentModeTrue = nextModelConstruction   where newIterationNumber = currentIterationNumber + 1@@ -903,11 +903,11 @@         potMembers = potentialMembers modelconstruction ++ inputPotentialMembers         currentAlignmentMode = toggleInfernalAlignmentModeTrue || alignmentModeInfernal modelconstruction         nextModelConstruction = ModelConstruction newIterationNumber (inputFasta modelconstruction) taxEntries upperTaxLimit inputTaxonomicContext (evalueThreshold modelconstruction) currentAlignmentMode inputSelectedQueries potMembers-         + buildTaxRecords :: [(Sequence,Int,L.ByteString)] -> Int -> [TaxonomyRecord] buildTaxRecords alignmentResults currentIterationNumber = taxonomyRecords   where taxIdGroups = groupBy sameTaxIdAlignmentResult alignmentResults-        taxonomyRecords = map (buildTaxRecord currentIterationNumber) taxIdGroups    +        taxonomyRecords = map (buildTaxRecord currentIterationNumber) taxIdGroups  sameTaxIdAlignmentResult :: (Sequence,Int,L.ByteString) -> (Sequence,Int,L.ByteString) -> Bool sameTaxIdAlignmentResult (_,taxId1,_) (_,taxId2,_) = taxId1 == taxId2@@ -918,8 +918,8 @@         seqRecords = map (buildSeqRecord currentIterationNumber)  entries         taxRecord = TaxonomyRecord recordTaxId seqRecords -buildSeqRecord :: Int -> (Sequence,Int,L.ByteString) -> SequenceRecord -buildSeqRecord currentIterationNumber (parsedFasta,_,seqSubject) = SequenceRecord parsedFasta currentIterationNumber seqSubject    +buildSeqRecord :: Int -> (Sequence,Int,L.ByteString) -> SequenceRecord+buildSeqRecord currentIterationNumber (parsedFasta,_,seqSubject) = SequenceRecord parsedFasta currentIterationNumber seqSubject  -- | Partitions sequences by containing a cmsearch hit and extracts the hit region as new sequence evaluePartitionTrimCMsearchHits :: Double -> [(CMsearch,(Sequence, Int, L.ByteString))] -> ([(CMsearch,(Sequence, Int, L.ByteString))],[(CMsearch,(Sequence, Int, L.ByteString))],[(CMsearch,(Sequence, Int, L.ByteString))])@@ -928,8 +928,8 @@         (prefilteredCandidates,rejectedCandidates) = partition (\(cmSearchResult,_) -> any (\hitScore' -> potentialMemberseValueThreshold >= hitEvalue hitScore') (cmsearchHits cmSearchResult)) cmSearchCandidatesWithSequences         (selectedCandidates,potentialCandidates) = partition (\(cmSearchResult,_) -> any (\hitScore' -> eValueThreshold >= hitEvalue hitScore') (cmsearchHits cmSearchResult)) prefilteredCandidates         trimmedSelectedCandidates = map (\(cmSearchResult,inputSequence) -> (cmSearchResult,trimCMsearchHit cmSearchResult inputSequence)) selectedCandidates-        -        ++ trimCMsearchHit :: CMsearch -> (Sequence, Int, L.ByteString) -> (Sequence, Int, L.ByteString) trimCMsearchHit cmSearchResult (inputSequence,b,c) = (subSequence,b,c)   where hitScoreEntry = head (cmsearchHits cmSearchResult)@@ -941,21 +941,21 @@  -- | Extract a substring with coordinates from cmsearch, first nucleotide has index 1 cmSearchsubString :: Int -> Int -> String -> String-cmSearchsubString startSubString endSubString inputString +cmSearchsubString startSubString endSubString inputString   | startSubString < endSubString = take (endSubString - (startSubString -1))(drop (startSubString - 1) inputString)   | startSubString > endSubString = take (reverseEnd - (reverseStart - 1))(drop (reverseStart - 1 ) (reverse inputString))   | otherwise = take (endSubString - (startSubString -1))(drop (startSubString - 1) inputString)   where stringLength = length inputString         reverseStart = stringLength - (startSubString + 1)         reverseEnd = stringLength - (endSubString - 1)-                     -extractQueries :: Int -> ModelConstruction -> [Sequence] ++extractQueries :: Int -> ModelConstruction -> [Sequence] extractQueries foundSequenceNumber modelconstruction-  | foundSequenceNumber < 3 = [fastaSeqData] -  | otherwise = querySequences' +  | foundSequenceNumber < 3 = [fastaSeqData]+  | otherwise = querySequences'   where fastaSeqData = inputFasta modelconstruction         querySequences' = selectedQueries modelconstruction-        + extractQueryCandidates :: [(Sequence,Int,L.ByteString)] -> V.Vector (Int,Sequence) extractQueryCandidates querycandidates = indexedSeqences   where sequences = map (\(candidateSequence,_,_) -> candidateSequence) querycandidates@@ -966,7 +966,7 @@   | isNothing upperTaxLimit = ""   | isNothing lowerTaxLimit =  "&ENTREZ_QUERY=" ++ encodedTaxIDQuery (fromJust upperTaxLimit)   | otherwise = "&ENTREZ_QUERY=" ++ "%28txid" ++ show (fromJust upperTaxLimit)  ++ "%5BORGN%5D%29" ++ "NOT" ++ "%28txid" ++ show (fromJust lowerTaxLimit) ++ "%5BORGN%5D&EQ_OP%29"- + buildHitNumberQuery :: String -> String buildHitNumberQuery hitNumber   | hitNumber == "" = ""@@ -981,14 +981,14 @@  -- | Create session id for RNAlien createSessionID :: Maybe String -> IO String-createSessionID sessionIdentificator = do+createSessionID sessionIdentificator =   if isJust sessionIdentificator     then return (fromJust sessionIdentificator)     else do       randomNumber <- randomIO :: IO Int16       let sessionId = randomid (abs (randomNumber))       return sessionId-                           + -- | Run external locarna command and read the output into the corresponding datatype systemlocarna :: String -> (String,String,String,String) -> IO ExitCode systemlocarna options (inputFilePath1, inputFilePath2, clustalformatoutputFilePath, outputFilePath) = system ("locarna " ++ options ++ " --clustal=" ++ clustalformatoutputFilePath  ++ " " ++ inputFilePath1  ++ " " ++ inputFilePath2 ++ " > " ++ outputFilePath)@@ -996,11 +996,11 @@ -- | Run external mlocarna command and read the output into the corresponding datatype, there is also a folder created at the location of the input fasta file systemMlocarna :: String -> (String,String) -> IO ExitCode systemMlocarna options (inputFilePath, outputFilePath) = system ("mlocarna " ++ options ++ " " ++ inputFilePath ++ " > " ++ outputFilePath)- + -- | Run external mlocarna command and read the output into the corresponding datatype, there is also a folder created at the location of the input fasta file, the job is terminated after the timeout provided in seconds systemMlocarnaWithTimeout :: String -> String -> (String,String) -> IO ExitCode systemMlocarnaWithTimeout timeout options (inputFilePath, outputFilePath) = system ("timeout " ++ timeout ++"s "++ "mlocarna " ++ options ++ " " ++ inputFilePath ++ " > " ++ outputFilePath)-       + -- | Run external clustalo command and return the Exitcode systemClustalw2 :: String -> (String,String,String) -> IO ExitCode systemClustalw2 options (inputFilePath, outputFilePath, summaryFilePath) = system ("clustalw2 " ++ options ++ "-INFILE=" ++ inputFilePath ++ " -OUTFILE=" ++ outputFilePath ++ ">" ++ summaryFilePath)@@ -1011,8 +1011,8 @@  -- | Run external CMbuild command and read the output into the corresponding datatype  systemCMbuild ::  String -> String -> String -> String -> IO ExitCode-systemCMbuild options alignmentFilepath modelFilepath outputFilePath = system ("cmbuild " ++ options ++ " " ++ modelFilepath ++ " " ++ alignmentFilepath  ++ " > " ++ outputFilePath)  -                                       +systemCMbuild options alignmentFilepath modelFilepath outputFilePath = system ("cmbuild " ++ options ++ " " ++ modelFilepath ++ " " ++ alignmentFilepath  ++ " > " ++ outputFilePath)+ -- | Run CMCompare and read the output into the corresponding datatype systemCMcompare ::  String -> String -> String -> IO ExitCode systemCMcompare model1path model2path outputFilePath = system ("CMCompare -q " ++ model1path ++ " " ++ model2path ++ " >" ++ outputFilePath)@@ -1026,14 +1026,14 @@ systemCMstat covarianceModelPath outputPath = system ("cmstat " ++ covarianceModelPath ++ " > " ++ outputPath)  -- | Run CMcalibrate and return exitcode-systemCMcalibrate :: String -> Int -> String -> String -> IO ExitCode -systemCMcalibrate mode cpus covarianceModelPath outputPath +systemCMcalibrate :: String -> Int -> String -> String -> IO ExitCode+systemCMcalibrate mode cpus covarianceModelPath outputPath   | mode == "fast" = system ("cmcalibrate --beta 1E-4 --cpu " ++ show cpus ++ " " ++ covarianceModelPath ++ "> " ++ outputPath)   | otherwise = system ("cmcalibrate --cpu " ++ show cpus ++ " " ++ covarianceModelPath ++ "> " ++ outputPath)   -- | Run CMcalibrate and return exitcode-systemCMalign :: String -> String -> String -> String -> IO ExitCode +systemCMalign :: String -> String -> String -> String -> IO ExitCode systemCMalign options filePathCovarianceModel filePathSequence filePathAlignment = system ("cmalign " ++ options ++ " " ++ filePathCovarianceModel ++ " " ++ filePathSequence ++ "> " ++ filePathAlignment)  compareCM :: String -> String -> String -> IO (Either String Double)@@ -1053,18 +1053,18 @@   let bitscore2 = read (decodedCmCompareOutput !! 3) :: Double   let minmax = minimum [bitscore1,bitscore2]   return (Right minmax)-                                                                 + readInt :: String -> Int readInt = read  readDouble :: String -> Double readDouble = read- + extractCandidateSequences :: [(Sequence,Int,L.ByteString)] -> V.Vector (Int,Sequence) extractCandidateSequences candidates' = indexedSeqences   where sequences = map (\(inputSequence,_,_) -> inputSequence) candidates'         indexedSeqences = V.map (\(number,inputSequence) -> (number + 1,inputSequence))(V.indexed (V.fromList sequences))-        + extractAlignedSequences :: Int -> ModelConstruction ->  V.Vector (Int,Sequence) extractAlignedSequences iterationnumber modelconstruction   | iterationnumber == 0 =  V.map (\(number,seq') -> (number + 1,seq')) (V.indexed (V.fromList [inputSequence]))@@ -1076,7 +1076,7 @@         indexedSeqRecords = V.map (\(number,seq') -> (number + 1,seq')) (V.indexed (V.fromList (inputSequence : map nucleotideSequence seqRecords)))  filterByParentTaxId :: [(BlastHit,Int)] -> Bool -> [(BlastHit,Int)]-filterByParentTaxId blastHitsWithParentTaxId singleHitPerParentTaxId   +filterByParentTaxId blastHitsWithParentTaxId singleHitPerParentTaxId   |  singleHitPerParentTaxId = singleBlastHitperParentTaxId   |  otherwise = blastHitsWithParentTaxId   where blastHitsWithParentTaxIdSortedByParentTaxId = sortBy compareTaxId blastHitsWithParentTaxId@@ -1084,7 +1084,7 @@         singleBlastHitperParentTaxId = map (maximumBy compareHitEValue) blastHitsWithParentTaxIdGroupedByParentTaxId  filterByHitLength :: [BlastHit] -> Int -> Bool -> [BlastHit]-filterByHitLength blastHits queryLength filterOn +filterByHitLength blastHits queryLength filterOn   | filterOn = filteredBlastHits   | otherwise = blastHits   where filteredBlastHits = filter (hitLengthCheck queryLength) blastHits@@ -1099,13 +1099,13 @@          maxHtoHSP = fromJust (find (\hsp -> maxHto == h_to hsp) blastMatches)          minHonQuery = q_from minHfromHSP          maxHonQuery = q_to maxHtoHSP-         startCoordinate = minHfrom - minHonQuery -         endCoordinate = maxHto + (queryLength - maxHonQuery) +         startCoordinate = minHfrom - minHonQuery+         endCoordinate = maxHto + (queryLength - maxHonQuery)          fullSeqLength = endCoordinate - startCoordinate          lengthStatus = fullSeqLength < (queryLength * 3)  filterByCoverage :: [BlastHit] -> Int -> Bool -> [BlastHit]-filterByCoverage blastHits queryLength filterOn +filterByCoverage blastHits queryLength filterOn   | filterOn = filteredBlastHits   | otherwise = blastHits   where filteredBlastHits = filter (coverageCheck queryLength) blastHits@@ -1115,8 +1115,8 @@ coverageCheck queryLength blastHit = coverageStatus   where  blastMatches = matches blastHit          maxIdentity = fromIntegral (maximum (map (snd . Bio.BlastXML.identity) blastMatches))-         coverageStatus = (maxIdentity/(fromIntegral queryLength))* (100 :: Double) >= (80 :: Double)-         +         coverageStatus = (maxIdentity/fromIntegral queryLength)* (100 :: Double) >= (80 :: Double)+ -- | Wrapper for retrieveFullSequence that rerequests incomplete return sequees retrieveFullSequences :: StaticOptions -> [(String,Int,Int,String,T.Text,Int,L.ByteString)] -> IO [(Sequence,Int,L.ByteString)] retrieveFullSequences staticOptions requestedSequences = do@@ -1133,21 +1133,21 @@       let unwrappedRetrievals = map (\(x,y,z) -> (fromJust x,y,z))  (map fst successfulRetrievals ++ reRetrievedSequences)       CE.evaluate unwrappedRetrievals     else CE.evaluate (map (\(x,y,z) -> (fromJust x,y,z)) fullSequences)-        + retrieveFullSequence :: String -> (String,Int,Int,String,T.Text,Int,L.ByteString) -> IO (Maybe Sequence,Int,L.ByteString) retrieveFullSequence temporaryDirectoryPath (nucleotideId,seqStart,seqStop,strand,_,taxid,subject') = do   let program' = Just "efetch"   let database' = Just "nucleotide"   let registrationInfo = buildRegistration "RNAlien" "florian.eggenhofer@univie.ac.at"   let queryString = "id=" ++ nucleotideId ++ "&seq_start=" ++ show seqStart ++ "&seq_stop=" ++ show seqStop ++ "&rettype=fasta" ++ "&strand=" ++ strand ++ registrationInfo-  let entrezQuery = EntrezHTTPQuery program' database' queryString +  let entrezQuery = EntrezHTTPQuery program' database' queryString   result <- CE.catch (entrezHTTP entrezQuery)               (\e -> do let err = show (e :: CE.IOException)                         logWarning ("Warning: Full sequence retrieval failed:" ++ " " ++ err) temporaryDirectoryPath                         return [])   if null result     then return (Nothing,taxid,subject')-    else do+    else       if null ((mkSeqs . L.lines) (L.pack result))         then return (Nothing,taxid,subject')         else do@@ -1155,9 +1155,9 @@           if L.null (unSD (seqdata parsedFasta))             then return (Nothing,taxid,subject')             else CE.evaluate (Just parsedFasta,taxid,subject')- + getRequestedSequenceElement :: Int -> (BlastHit,Int) -> (String,Int,Int,String,T.Text,Int,L.ByteString)-getRequestedSequenceElement queryLength (blastHit,taxid) +getRequestedSequenceElement queryLength (blastHit,taxid)   | blastHitIsReverseComplement (blastHit,taxid) = getReverseRequestedSequenceElement queryLength (blastHit,taxid)   | otherwise = getForwardRequestedSequenceElement queryLength (blastHit,taxid) @@ -1180,10 +1180,10 @@             minHonQuery = q_from blastMatch             maxHonQuery = q_to blastMatch             --unsafe coordinates may exceed length of available sequence-            unsafestartcoordinate = minHfrom - minHonQuery -            unsafeendcoordinate = maxHto + (queryLength - maxHonQuery) +            unsafestartcoordinate = minHfrom - minHonQuery+            unsafeendcoordinate = maxHto + (queryLength - maxHonQuery)             startcoordinate = lowerBoundryCoordinateSetter 0 unsafestartcoordinate-            endcoordinate = upperBoundryCoordinateSetter blastHitOriginSequenceLength unsafeendcoordinate +            endcoordinate = upperBoundryCoordinateSetter blastHitOriginSequenceLength unsafeendcoordinate             strand = "1"             ----              --blastMatches = matches blastHit@@ -1214,19 +1214,19 @@ getReverseRequestedSequenceElement :: Int -> (BlastHit,Int) -> (String,Int,Int,String,T.Text,Int,L.ByteString) getReverseRequestedSequenceElement queryLength (blastHit,taxid) = (geneIdentifier',startcoordinate,endcoordinate,strand,accession',taxid,subjectBlast)    where   accession' = extractAccession blastHit-           subjectBlast = unSL (subject blastHit)        +           subjectBlast = unSL (subject blastHit)            geneIdentifier' = extractGeneId blastHit            blastMatch = head (matches blastHit)-           blastHitOriginSequenceLength = slength blastHit               -           maxHfrom = h_from blastMatch      +           blastHitOriginSequenceLength = slength blastHit+           maxHfrom = h_from blastMatch            minHto = h_to blastMatch            minHonQuery = q_from blastMatch            maxHonQuery = q_to blastMatch            --unsafe coordinates may exceed length of avialable sequence-           unsafestartcoordinate = maxHfrom + minHonQuery -           unsafeendcoordinate = minHto - (queryLength - maxHonQuery) -           startcoordinate = lowerBoundryCoordinateSetter 0 unsafeendcoordinate -           endcoordinate = upperBoundryCoordinateSetter blastHitOriginSequenceLength unsafestartcoordinate +           unsafestartcoordinate = maxHfrom + minHonQuery+           unsafeendcoordinate = minHto - (queryLength - maxHonQuery)+           startcoordinate = lowerBoundryCoordinateSetter 0 unsafeendcoordinate+           endcoordinate = upperBoundryCoordinateSetter blastHitOriginSequenceLength unsafestartcoordinate            strand = "2"            --            --blastMatches = matches blastHit@@ -1252,7 +1252,7 @@ alignSequences :: String -> String -> [String] -> [String] -> [String] -> [String] -> IO () alignSequences program' options fastaFilepaths fastaFilepaths2 alignmentFilepaths summaryFilepaths = do   let zipped4Filepaths = zip4 fastaFilepaths fastaFilepaths2 alignmentFilepaths summaryFilepaths-  let zipped3Filepaths = zip3 fastaFilepaths alignmentFilepaths summaryFilepaths +  let zipped3Filepaths = zip3 fastaFilepaths alignmentFilepaths summaryFilepaths   let zippedFilepaths = zip fastaFilepaths alignmentFilepaths   let timeout = "3600"   case program' of@@ -1267,32 +1267,32 @@  constructCMsearchFilePaths :: String -> (Int, Sequence) -> String constructCMsearchFilePaths currentDirectory (fastaIdentifier, _) = currentDirectory ++ show fastaIdentifier ++".cmsearch"-                                                                                  + -- Smaller e-Values are greater, the maximum function is applied-compareHitEValue :: (BlastHit,Int) -> (BlastHit,Int) -> Ordering                    +compareHitEValue :: (BlastHit,Int) -> (BlastHit,Int) -> Ordering compareHitEValue (hit1,_) (hit2,_)   | hitEValue hit1 > hitEValue hit2 = LT   | hitEValue hit1 < hitEValue hit2 = GT   -- in case of equal evalues the first hit is selected-  | hitEValue hit1 == hitEValue hit2 = GT                                           +  | hitEValue hit1 == hitEValue hit2 = GT -- comparing (hitEValue . Down . fst)-compareHitEValue (_,_) (_,_) = EQ +compareHitEValue (_,_) (_,_) = EQ -compareTaxId :: (BlastHit,Int) -> (BlastHit,Int) -> Ordering            +compareTaxId :: (BlastHit,Int) -> (BlastHit,Int) -> Ordering compareTaxId (_,taxId1) (_,taxId2)   | taxId1 > taxId2 = LT   | taxId1 < taxId2 = GT   -- in case of equal evalues the first hit is selected   | taxId1 == taxId2 = EQ compareTaxId (_,_)  (_,_) = EQ-                       + sameTaxId :: (BlastHit,Int) -> (BlastHit,Int) -> Bool sameTaxId (_,taxId1) (_,taxId2) = taxId1 == taxId2  -- | NCBI uses the e-Value of the best HSP as the Hits e-Value hitEValue :: BlastHit -> Double hitEValue hit = minimum (map e_val (matches hit))-                          + convertFastaFoldStockholm :: Sequence -> String -> String convertFastaFoldStockholm fastasequence foldedStructure = stockholmOutput   where alnHeader = "# STOCKHOLM 1.0\n\n"@@ -1306,7 +1306,7 @@         structureString = "#=GC SS_cons" ++ replicate (spacerLength' - 12) ' ' ++ foldedStructure ++ "\n"         bottom = "//"         stockholmOutput = alnHeader ++ entrystring ++ structureString ++ bottom-                   + convertClustaltoStockholm :: StructuralClustalAlignment -> T.Text convertClustaltoStockholm parsedMlocarnaAlignment = stockholmOutput   where alnHeader = T.pack "# STOCKHOLM 1.0\n\n"@@ -1316,21 +1316,21 @@         maxIdentifierLenght = maximum (map (T.length . entrySequenceIdentifier) clustalAlignment)         spacerLength' = maxIdentifierLenght + 2         stockholmEntries = T.concat (map (buildStockholmAlignmentEntries spacerLength') mergedEntries)-        structureString = (T.pack "#=GC SS_cons") `T.append` T.replicate (spacerLength' - 12) (T.pack " ")  `T.append` secondaryStructureTrack parsedMlocarnaAlignment `T.append` (T.pack "\n")+        structureString = T.pack "#=GC SS_cons" `T.append` T.replicate (spacerLength' - 12) (T.pack " ")  `T.append` secondaryStructureTrack parsedMlocarnaAlignment `T.append` T.pack "\n"         bottom = T.pack "//"         stockholmOutput = alnHeader `T.append` stockholmEntries `T.append` structureString `T.append` bottom  mergeEntry :: [ClustalAlignmentEntry] -> T.Text -> ClustalAlignmentEntry mergeEntry clustalAlignment uniqueId = mergedEntry   where idEntries = filter (\entry -> entrySequenceIdentifier entry==uniqueId) clustalAlignment-        mergedSeq = foldr ((T.append) . entryAlignedSequence) (T.pack "") idEntries+        mergedSeq = foldr (T.append . entryAlignedSequence) (T.pack "") idEntries         mergedEntry = ClustalAlignmentEntry uniqueId mergedSeq  buildStockholmAlignmentEntries :: Int -> ClustalAlignmentEntry -> T.Text buildStockholmAlignmentEntries inputSpacerLength entry = entrystring   where idLength = T.length (T.filter (/= '\n') (entrySequenceIdentifier entry))         spacer = T.replicate (inputSpacerLength - idLength) (T.pack " ")-        entrystring = entrySequenceIdentifier entry `T.append` spacer `T.append` entryAlignedSequence entry `T.append` (T.pack "\n")+        entrystring = entrySequenceIdentifier entry `T.append` spacer `T.append` entryAlignedSequence entry `T.append` T.pack "\n"  retrieveTaxonomicContextEntrez :: Int -> IO (Maybe Taxon) retrieveTaxonomicContextEntrez inputTaxId = do@@ -1339,7 +1339,7 @@        let taxIdString = show inputTaxId        let registrationInfo = buildRegistration "RNAlien" "florian.eggenhofer@univie.ac.at"        let queryString = "id=" ++ taxIdString ++ registrationInfo-       let entrezQuery = EntrezHTTPQuery program' database' queryString +       let entrezQuery = EntrezHTTPQuery program' database' queryString        result <- entrezHTTP entrezQuery        if null result           then do@@ -1350,10 +1350,10 @@             --print taxon             if null (lineageEx taxon)               then error "Retrieved taxonomic context taxon from NCBI Entrez with empty lineage, cannot proceed."-              else CE.evaluate (Just taxon)+              else return (Just taxon)  retrieveParentTaxIdEntrez :: [(BlastHit,Int)] -> IO [(BlastHit,Int)]-retrieveParentTaxIdEntrez blastHitsWithHitTaxids = do+retrieveParentTaxIdEntrez blastHitsWithHitTaxids =   if not (null blastHitsWithHitTaxids)      then do        let program' = Just "efetch"@@ -1364,7 +1364,7 @@        let taxIdQuery = intercalate "," taxIdStrings        let registrationInfo = buildRegistration "RNAlien" "florian.eggenhofer@univie.ac.at"        let queryString = "id=" ++ taxIdQuery ++ registrationInfo-       let entrezQuery = EntrezHTTPQuery program' database' queryString +       let entrezQuery = EntrezHTTPQuery program' database' queryString        result <- entrezHTTP entrezQuery        let parentTaxIds = readEntrezParentIds result        if null parentTaxIds@@ -1384,10 +1384,10 @@ retrieveBlastHitsTaxIdEntrez blastHits = do   let splits = portionListElements blastHits 20   mapM retrieveBlastHitTaxIdEntrez splits-   + retrieveBlastHitTaxIdEntrez :: [BlastHit] -> IO ([BlastHit],String)-retrieveBlastHitTaxIdEntrez blastHits = do+retrieveBlastHitTaxIdEntrez blastHits =   if not (null blastHits)      then do        let geneIds = map extractGeneId blastHits@@ -1395,7 +1395,7 @@        let registrationInfo = buildRegistration "RNAlien" "florian.eggenhofer@univie.ac.at"        let query' = "id=" ++ idList ++ registrationInfo        let entrezQuery = EntrezHTTPQuery (Just "esummary") (Just "nucleotide") query'-       threadDelay 10000000                  +       threadDelay 10000000        result <- entrezHTTP entrezQuery        CE.evaluate (blastHits,result)      else return (blastHits,"")@@ -1415,7 +1415,7 @@ extractAccession currentBlastHit = accession'   where splitedFields = T.splitOn (T.pack "|") (DTE.decodeUtf8 (L.toStrict (hitId currentBlastHit)))         accession' =  splitedFields !! 3-        + extractGeneId :: BlastHit -> String extractGeneId currentBlastHit = nucleotideId   where truncatedId = drop 3 (L.unpack (hitId currentBlastHit))@@ -1426,18 +1426,18 @@ extractTaxIdfromDocumentSummary documentSummary = itemContent (fromJust (find (\item -> "TaxId" == itemName item) (summaryItems documentSummary)))  getBestHit :: BlastResult -> BlastHit-getBestHit blastResult +getBestHit blastResult   | null (concatMap hits (results blastResult)) = error "getBestHit - head: empty list"   | otherwise = head (hits (head (results blastResult)))  -- Blast returns low evalues with zero instead of the exact number getHitWithFractionEvalue :: BlastResult -> Maybe BlastMatch-getHitWithFractionEvalue blastResult +getHitWithFractionEvalue blastResult   | null (concatMap hits (results blastResult)) = Nothing   | otherwise = find (\match -> e_val match /= (0 ::Double)) (concatMap matches (concatMap hits (results blastResult)))  showlines :: Show a => [a] -> String-showlines = concatMap (\x -> show x ++ "\n") +showlines = concatMap (\x -> show x ++ "\n")  logMessage :: String -> String -> IO () logMessage logoutput temporaryDirectoryPath = appendFile (temporaryDirectoryPath ++ "Log") logoutput@@ -1446,10 +1446,10 @@ logWarning logoutput temporaryDirectoryPath = appendFile (temporaryDirectoryPath ++ "log/warnings") logoutput  logVerboseMessage :: Bool -> String -> String -> IO ()-logVerboseMessage verboseTrue logoutput temporaryDirectoryPath +logVerboseMessage verboseTrue logoutput temporaryDirectoryPath   | verboseTrue = appendFile (temporaryDirectoryPath ++ "Log") (show logoutput)   | otherwise = return ()-                  + logEither :: (Show a) => Either a b -> String -> IO () logEither (Left logoutput) temporaryDirectoryPath = appendFile (temporaryDirectoryPath ++ "Log") (show logoutput) logEither  _ _ = return ()@@ -1462,7 +1462,7 @@   checks <- mapM checkTool additionaltools   if not (null (lefts checks))     then return (Left (concat (lefts checks)))-    else do  +    else do       logMessage ("Tools : " ++ intercalate "," tools ++ "\n") temporaryDirectoryPath       return (Right "Tools ok") @@ -1475,11 +1475,11 @@   --_ <- system ("clustalo --version >" ++ clustaloversionpath)   _ <- system ("mlocarna --version >" ++ mlocarnaversionpath)   _ <- system ("RNAfold --version >" ++ rnafoldversionpath)-  _ <- system ("cmcalibrate -h >" ++ infernalversionpath)  +  _ <- system ("cmcalibrate -h >" ++ infernalversionpath)   -- _ <- system ("RNAz" ++ rnazversionpath)   -- _ <- system ("CMCompare >" ++ infernalversionpath)   mlocarnaversion <- readFile mlocarnaversionpath-  rnafoldversion <- readFile rnafoldversionpath +  rnafoldversion <- readFile rnafoldversionpath   infernalversionOutput <- readFile infernalversionpath   let infernalversion = lines infernalversionOutput !! 1   if inputQuerySelectionMethod == "clustering"@@ -1499,7 +1499,7 @@   if isJust toolcheck     then return (Right (fromJust toolcheck))     else return (Left ("RNAlien could not find "++ tool ++ " in your $PATH and has to abort.\n"))-  + constructTaxonomyRecordsCSVTable :: ModelConstruction -> String constructTaxonomyRecordsCSVTable modelconstruction = csvtable   where tableheader = "Taxonomy Id;Added in Iteration Step;Entry Header\n"@@ -1528,36 +1528,33 @@ evaluateConstructionResult staticOptions mCResult = do   let evaluationDirectoryFilepath = tempDirPath staticOptions ++ "evaluation/"   createDirectoryIfMissing False evaluationDirectoryFilepath-  let fastaFilepath = tempDirPath staticOptions ++ "result.fa"-  let clustalFilepath = evaluationDirectoryFilepath ++ "result.clustal"   let reformatedClustalPath = evaluationDirectoryFilepath ++ "result.clustal.reformated"   let cmFilepath = tempDirPath staticOptions ++ "result.cm"-  let resultSequences = (inputFasta mCResult):map nucleotideSequence (concatMap sequenceRecords (taxRecords mCResult))-  let resultNumber = length resultSequences -  let rnaCentralQueries = map RCH.buildSequenceViaMD5Query resultSequences    +  let resultSequences = inputFasta mCResult:map nucleotideSequence (concatMap sequenceRecords (taxRecords mCResult))+  let resultNumber = length resultSequences+  let rnaCentralQueries = map RCH.buildSequenceViaMD5Query resultSequences   rnaCentralEntries <- RCH.getRNACentralEntries rnaCentralQueries   let rnaCentralEvaluationResult = RCH.showRNAcentralAlienEvaluation rnaCentralEntries   writeFile (tempDirPath staticOptions ++ "result.rnacentral") rnaCentralEvaluationResult-  systemCMalign ("--outformat=Clustal --cpu " ++ show (cpuThreads staticOptions)) cmFilepath fastaFilepath clustalFilepath   let resultModelStatistics = tempDirPath staticOptions ++ "result.cmstat"   systemCMstat cmFilepath resultModelStatistics   inputcmStat <- readCMstat resultModelStatistics   let cmstatString = cmstatEvalOutput inputcmStat   if resultNumber > 1-    then do +    then do       let resultRNAz = tempDirPath staticOptions ++ "result.rnaz"       let resultRNAcode = tempDirPath staticOptions ++ "result.rnacode"+      let resultClustalFilepath = tempDirPath staticOptions ++ "result.clustal"       let seqNumber = 6 :: Int       let optimalIdentity = 80 :: Double       let maximalIdentity = 99 :: Double       let referenceSequence = True-      --rnazClustalpath <- preprocessClustalForRNAcodeExternal clustalFilepath reformatedClustalPath seqNumber (truncate optimalIdentity) (truncate maximalIdentity) referenceSequence-      preprocessingOutput <- preprocessClustalForRNAz clustalFilepath reformatedClustalPath seqNumber optimalIdentity maximalIdentity referenceSequence                        +      preprocessingOutput <- preprocessClustalForRNAz resultClustalFilepath reformatedClustalPath seqNumber optimalIdentity maximalIdentity referenceSequence       if isRight preprocessingOutput         then do           let rightPreprocessingOutput = fromRight preprocessingOutput           let rnazClustalpath = snd rightPreprocessingOutput-          systemRNAz "-l" rnazClustalpath resultRNAz +          systemRNAz "-l" rnazClustalpath resultRNAz           inputRNAz <- readRNAz resultRNAz           let rnaZString = rnaZEvalOutput inputRNAz           RC.systemRNAcode " -t " rnazClustalpath resultRNAcode@@ -1565,29 +1562,29 @@           let rnaCodeString = rnaCodeEvalOutput inputRNAcode           return ("\nEvaluation of RNAlien result :\nCMstat statistics for result.cm\n" ++ cmstatString ++ "\nRNAz statistics for result alignment: " ++ rnaZString ++ "\nRNAcode output for result alignment:\n" ++ rnaCodeString ++ "\nSequences found by RNAlien with RNAcentral entry:\n" ++ rnaCentralEvaluationResult)         else do-          logWarning ("Running RNAz for result evalution encountered a problem:" ++ fromLeft preprocessingOutput) (tempDirPath staticOptions) +          logWarning ("Running RNAz for result evalution encountered a problem:" ++ fromLeft preprocessingOutput) (tempDirPath staticOptions)           return ("\nEvaluation of RNAlien result :\nCMstat statistics for result.cm\n" ++ cmstatString ++ "\nRNAz statistics for result alignment: Running RNAz for result evalution encountered a problem\n" ++ fromLeft preprocessingOutput ++ "\n" ++ "Sequences found by RNAlien with RNAcentral entry:\n" ++ rnaCentralEvaluationResult)     else do-      logWarning "Message: RNAlien could not find additional covariant sequences\n Could not run RNAz statistics. Could not run RNAz statistics with a single sequence.\n" (tempDirPath staticOptions) +      logWarning "Message: RNAlien could not find additional covariant sequences\n Could not run RNAz statistics. Could not run RNAz statistics with a single sequence.\n" (tempDirPath staticOptions)       return ("\nEvaluation of RNAlien result :\nCMstat statistics for result.cm\n" ++ cmstatString ++ "\nRNAlien could not find additional covariant sequences. Could not run RNAz statistics with a single sequence.\n\nSequences found by RNAlien with RNAcentral entry:\n" ++ rnaCentralEvaluationResult)  -cmstatEvalOutput :: Either ParseError CMstat -> String +cmstatEvalOutput :: Either ParseError CMstat -> String cmstatEvalOutput inputcmstat   | isRight inputcmstat = cmstatString   | otherwise = show (fromLeft inputcmstat)-    where cmStat = fromRight inputcmstat  +    where cmStat = fromRight inputcmstat           cmstatString = "  Sequence Number: " ++ show (statSequenceNumber cmStat)++ "\n" ++ "  Effective Sequences: " ++ show (statEffectiveSequences cmStat)++ "\n" ++ "  Consensus length: " ++ show (statConsensusLength cmStat) ++ "\n" ++ "  Expected maximum hit-length: " ++ show (statW cmStat) ++ "\n" ++ "  Basepairs: " ++ show (statBasepairs cmStat)++ "\n" ++ "  Bifurcations: " ++ show (statBifurcations cmStat) ++ "\n" ++ "  Modeltype: " ++ show (statModel cmStat) ++ "\n" ++ "  Relative Entropy CM: " ++ show (relativeEntropyCM cmStat) ++ "\n" ++ "  Relative Entropy HMM: " ++ show (relativeEntropyHMM cmStat) ++ "\n" -rnaZEvalOutput :: Either ParseError RNAz -> String -rnaZEvalOutput inputRNAz +rnaZEvalOutput :: Either ParseError RNAz -> String+rnaZEvalOutput inputRNAz   | isRight inputRNAz = rnazString   | otherwise = show (fromLeft inputRNAz)     where rnaZ = fromRight inputRNAz           rnazString = "  Mean pairwise identity: " ++ show (meanPairwiseIdentity rnaZ) ++ "\n  Shannon entropy: " ++ show (shannonEntropy rnaZ) ++  "\n  GC content: " ++ show (gcContent rnaZ) ++ "\n  Mean single sequence minimum free energy: " ++ show (meanSingleSequenceMinimumFreeEnergy rnaZ) ++ "\n  Consensus minimum free energy: " ++ show (consensusMinimumFreeEnergy rnaZ) ++ "\n  Energy contribution: " ++ show (energyContribution rnaZ) ++ "\n  Covariance contribution: " ++ show (covarianceContribution rnaZ) ++ "\n  Combinations pair: " ++ show (combinationsPair rnaZ) ++ "\n  Mean z-score: " ++ show (meanZScore rnaZ) ++ "\n  Structure conservation index: " ++ show (structureConservationIndex rnaZ) ++ "\n  Background model: " ++ backgroundModel rnaZ ++ "\n  Decision model: " ++ decisionModel rnaZ ++ "\n  SVM decision value: " ++ show (svmDecisionValue rnaZ) ++ "\n  SVM class propability: " ++ show (svmRNAClassProbability rnaZ) ++ "\n  Prediction: " ++ prediction rnaZ -rnaCodeEvalOutput :: Either ParseError RC.RNAcode -> String -rnaCodeEvalOutput inputRNAcode +rnaCodeEvalOutput :: Either ParseError RC.RNAcode -> String+rnaCodeEvalOutput inputRNAcode   | isRight inputRNAcode = rnaCodeString   | otherwise = show (fromLeft inputRNAcode)     where rnaCode = fromRight inputRNAcode@@ -1595,7 +1592,7 @@           rnaCodeEntries = concatMap showRNACodeHits (RC.rnacodeHits rnaCode)  showRNACodeHits :: RC.RNAcodeHit -> String-showRNACodeHits rnacodeHit = show (RC.hss rnacodeHit) ++ "\t" ++ show (RC.frame rnacodeHit) ++ "\t" ++ show (RC.hitLength rnacodeHit) ++ "\t"++ show (RC.from rnacodeHit) ++ "\t" ++ show (RC.to rnacodeHit) ++ "\t" ++ (RC.name rnacodeHit) ++ "\t" ++ show (RC.start rnacodeHit) ++ "\t" ++ show (RC.end rnacodeHit) ++ "\t" ++ show (RC.score rnacodeHit) ++ show (RC.pvalue rnacodeHit) ++ "\n"+showRNACodeHits rnacodeHit = show (RC.hss rnacodeHit) ++ "\t" ++ show (RC.frame rnacodeHit) ++ "\t" ++ show (RC.hitLength rnacodeHit) ++ "\t"++ show (RC.from rnacodeHit) ++ "\t" ++ show (RC.to rnacodeHit) ++ "\t" ++ RC.name rnacodeHit ++ "\t" ++ show (RC.start rnacodeHit) ++ "\t" ++ show (RC.end rnacodeHit) ++ "\t" ++ show (RC.score rnacodeHit) ++ show (RC.pvalue rnacodeHit) ++ "\n"  -- | Call for external preprocessClustalForRNAz preprocessClustalForRNAzExternal :: String -> String -> Int -> Int -> Int -> Bool -> IO (Either String (String,String))@@ -1610,7 +1607,7 @@   let optimalIdentityOption = " -i "  ++ show optimalIdentity  ++ " "   let maximalIdentityOption = " --max-id="  ++ show maximalIdenity  ++ " "   let referenceSequenceOption = if referenceSequence then " " else " -x "-  let syscall = ("rnazSelectSeqs.pl " ++ reformatedClustalPath ++ " " ++ sequenceNumberOption ++ optimalIdentityOption ++ maximalIdentityOption ++ referenceSequenceOption ++  " >" ++ selectedClustalpath)+  let syscall = "rnazSelectSeqs.pl " ++ reformatedClustalPath ++ " " ++ sequenceNumberOption ++ optimalIdentityOption ++ maximalIdentityOption ++ referenceSequenceOption ++  " >" ++ selectedClustalpath   --putStrLn syscall   system syscall   selectedClustalText <- readFile selectedClustalpath@@ -1625,14 +1622,14 @@   let headerClustalTextLines = T.unlines (take 2 clustalTextLines)   let headerlessClustalTextLines = T.unlines (drop 2 clustalTextLines)   let reformatedClustalText = T.map reformatRNACodeAln headerlessClustalTextLines-  TI.writeFile reformatedClustalPath (headerClustalTextLines `T.append` (T.singleton '\n') `T.append` reformatedClustalText)+  TI.writeFile reformatedClustalPath (headerClustalTextLines `T.append` T.singleton '\n' `T.append` reformatedClustalText)   --select representative entries from result.Clustal with select_sequences   let selectedClustalpath = clustalFilepath ++ ".selected"   let sequenceNumberOption = " -n "  ++ show seqenceNumber  ++ " "   let optimalIdentityOption = " -i "  ++ show optimalIdentity  ++ " "   let maximalIdentityOption = " --max-id="  ++ show maximalIdenity  ++ " "   let referenceSequenceOption = if referenceSequence then " " else " -x "-  let syscall = ("rnazSelectSeqs.pl " ++ reformatedClustalPath ++ " " ++ sequenceNumberOption ++ optimalIdentityOption ++ maximalIdentityOption ++ referenceSequenceOption ++  " >" ++ selectedClustalpath)+  let syscall = "rnazSelectSeqs.pl " ++ reformatedClustalPath ++ " " ++ sequenceNumberOption ++ optimalIdentityOption ++ maximalIdentityOption ++ referenceSequenceOption ++  " >" ++ selectedClustalpath   --putStrLn syscall   system syscall   selectedClustalText <- readFile selectedClustalpath@@ -1641,14 +1638,14 @@ preprocessClustalForRNAz :: String -> String -> Int -> Double -> Double -> Bool -> IO (Either String (String,String)) preprocessClustalForRNAz clustalFilepath _ seqenceNumber optimalIdentity maximalIdenity referenceSequence = do   clustalText <- TI.readFile clustalFilepath-  let clustalTextLines = T.lines clustalText                        +  let clustalTextLines = T.lines clustalText   parsedClustalInput <- readClustalAlignment clustalFilepath-  let selectedClustalpath = clustalFilepath ++ ".selected"                      +  let selectedClustalpath = clustalFilepath ++ ".selected"   if length clustalTextLines > 5-    then do +    then       if isRight parsedClustalInput         then do-          let (idMatrix,filteredClustalInput) = rnaCodeSelectSeqs2 (fromRight parsedClustalInput) seqenceNumber optimalIdentity maximalIdenity referenceSequence         +          let (idMatrix,filteredClustalInput) = rnaCodeSelectSeqs2 (fromRight parsedClustalInput) seqenceNumber optimalIdentity maximalIdenity referenceSequence           writeFile selectedClustalpath (show filteredClustalInput)           let formatedIdMatrix = show (fmap formatIdMatrix idMatrix)           return (Right (formatedIdMatrix,selectedClustalpath))@@ -1658,7 +1655,7 @@       let headerClustalTextLines = T.unlines (take 2 clustalLines)       let headerlessClustalTextLines = T.unlines (drop 2 clustalLines)       let reformatedClustalText = T.map reformatRNACodeAln headerlessClustalTextLines-      TI.writeFile selectedClustalpath (headerClustalTextLines `T.append` (T.singleton '\n') `T.append` reformatedClustalText)+      TI.writeFile selectedClustalpath (headerClustalTextLines `T.append` T.singleton '\n' `T.append` reformatedClustalText)       return (Right ([],clustalFilepath))  formatIdMatrix :: Maybe (Int,Int,Double) -> String@@ -1672,7 +1669,7 @@   where entryVector = V.fromList (alignmentEntries currentClustalAlignment)         entrySequences = V.map entryAlignedSequence entryVector         entryReformatedSequences = V.map (T.map reformatRNACodeAln) entrySequences-        totalSeqNumber = (V.length entryVector)+        totalSeqNumber = V.length entryVector         identityMatrix = computeSequenceIdentityMatrix entryReformatedSequences         entryIdentityVector = V.map fromJust (V.filter isJust (getMatrixAsVector identityMatrix))         entryIdentities = V.toList entryIdentityVector@@ -1682,36 +1679,36 @@         prefilteredEntries = allEntries \\ entriesToDiscard         --Optimize mean pairwise similarity (greedily) - remove worst sequence until desired number is reached         costList = map (computeEntryCost optimalIdentity entryIdentityVector) prefilteredEntries-        sortedCostList = (sortBy compareEntryCost2 costList)-        sortedIndices = map fst sortedCostList                +        sortedCostList = sortBy compareEntryCost2 costList+        sortedIndices = map fst sortedCostList         --selectedEntryIndices = [1] ++ map fst (take (targetSeqNumber -1) sortedCostList)-        selectedEntryIndices = selectEntryIndices referenceSequence targetSeqNumber sortedIndices  +        selectedEntryIndices = selectEntryIndices referenceSequence targetSeqNumber sortedIndices         selectedEntries = map (\ind -> entryVector V.! (ind-1)) selectedEntryIndices         selectedEntryHeader = map entrySequenceIdentifier selectedEntries         reformatedSelectedEntryHeader =  map (T.map reformatRNACodeId) selectedEntryHeader         selectedEntrySequences = map (\ind -> entryReformatedSequences V.! (ind-1)) selectedEntryIndices         --gapfreeEntrySequences = T.transpose (T.filter (\a -> not (T.all isGap a)) (T.transpose selectedEntrySequences))-        gapfreeEntrySequences = T.transpose (filter (\a -> not (T.all isGap a)) (T.transpose selectedEntrySequences))                        -        gapfreeEntries = map (\(a,b) -> ClustalAlignmentEntry a  b)(zip reformatedSelectedEntryHeader gapfreeEntrySequences)+        gapfreeEntrySequences = T.transpose (filter (not . T.all isGap) (T.transpose selectedEntrySequences))+        gapfreeEntries = map (uncurry ClustalAlignmentEntry)(zip reformatedSelectedEntryHeader gapfreeEntrySequences)         emptyConservationTrack = setEmptyConservationTrack gapfreeEntries (conservationTrack currentClustalAlignment)         newClustalAlignment = currentClustalAlignment {alignmentEntries = gapfreeEntries, conservationTrack = emptyConservationTrack}  selectEntryIndices :: Bool -> Int -> [Int] -> [Int] selectEntryIndices referenceSequence targetSeqNumber sortedIndices-  | referenceSequence = if elem (1 :: Int) firstX then firstX else 1:firstXm1+  | referenceSequence = if (1 :: Int) `elem` firstX then firstX else 1:firstXm1   | otherwise = firstX     where firstXm1 = take (targetSeqNumber - 1)  sortedIndices           firstX = take targetSeqNumber sortedIndices-    + setEmptyConservationTrack :: [ClustalAlignmentEntry] -> T.Text -> T.Text setEmptyConservationTrack alnentries currentConservationTrack-  | null alnentries = currentConservationTrack -  | otherwise = newConservationTrack +  | null alnentries = currentConservationTrack+  | otherwise = newConservationTrack       where trackLength = T.length (entryAlignedSequence (head alnentries))             newConservationTrack = T.replicate (trackLength + 0) (T.pack " ")-                              + isGap :: Char -> Bool-isGap a +isGap a   | a == '-' = True   | otherwise = False @@ -1721,7 +1718,7 @@         entryIdentities = getEntryIdentities currentIndex allIdentities  getEntryIdentities :: Int -> V.Vector (Int,Int,Double) -> V.Vector (Int,Int,Double)-getEntryIdentities currentIndex allIdentities = (V.filter (isIIdx currentIndex) allIdentities) V.++ (V.filter (isJIdx currentIndex) allIdentities)+getEntryIdentities currentIndex allIdentities = V.filter (isIIdx currentIndex) allIdentities V.++ V.filter (isJIdx currentIndex) allIdentities  isIIdx :: Int -> (Int,Int,Double) -> Bool isIIdx currentIdx (i,_,_) = currentIdx == i@@ -1731,13 +1728,13 @@ computeCost :: Double -> (Int,Int,Double) -> Double computeCost optimalIdentity (_,_,c) = (c - optimalIdentity) * (c - optimalIdentity) -compareEntryCost2 :: (Int, Double) -> (Int, Double) -> Ordering +compareEntryCost2 :: (Int, Double) -> (Int, Double) -> Ordering compareEntryCost2 (_,costA) (_,costB) = compare costA costB  -- TODO change to vector preFilterIdentityMatrix :: Double -> Int -> Int-> [Int] -> [(Int,Int,Double)] -> [Int] preFilterIdentityMatrix identityCutoff minSeqNumber totalSeqNumber filteredIds entryIdentities-    | (totalSeqNumber - (length filteredIds)) <= minSeqNumber = []+    | (totalSeqNumber - length filteredIds) <= minSeqNumber = []     | identityCutoff == (100 :: Double) = []     | Prelude.null entryIdentities  = []     | otherwise = entryresult ++ preFilterIdentityMatrix identityCutoff minSeqNumber totalSeqNumber (filteredIds ++ entryresult) (tail entryIdentities)@@ -1746,46 +1743,46 @@  checkIdentityEntry :: Double -> [Int] -> (Int,Int,Double) -> [Int] checkIdentityEntry identityCutoff filteredIds (i,j,ident)-  | elem i filteredIds = []-  | elem j filteredIds = []+  | i `elem` filteredIds = []+  | j `elem` filteredIds = []   | ident > identityCutoff = [j]   | otherwise = []-                        + computeSequenceIdentityMatrix :: V.Vector T.Text -> Matrix (Maybe (Int,Int,Double)) computeSequenceIdentityMatrix entryVector = matrix (V.length entryVector) (V.length entryVector) (computeSequenceIdentityEntry entryVector)  -- Computes Sequence identity once for each pair and not vs itself computeSequenceIdentityEntry :: V.Vector T.Text -> (Int,Int) -> Maybe (Int,Int,Double) computeSequenceIdentityEntry entryVector (row,col)-  | i < j = Just $ (row,col,ident)+  | i < j = Just (row,col,ident)   | otherwise = Nothing   where i=row-1         j=col-1         --gaps in both sequences need to be removed, because they count as match-        ientry  = (entryVector V.! i)-        jentry = (entryVector V.! j)+        ientry  = entryVector V.! i+        jentry = entryVector V.! j         (gfi,gfj) = unzip (filter notDoubleGap (T.zip ientry jentry))         gfitext = T.pack gfi-        gfjtext = T.pack gfj    +        gfjtext = T.pack gfj         --ident=stringIdentity gfi gfj         ident=textIdentity gfitext gfjtext-               + notDoubleGap :: (Char,Char) -> Bool notDoubleGap (a,b)   | a == '-' && b == '-' = False   | otherwise = True -reformatRNACodeId :: Char -> Char +reformatRNACodeId :: Char -> Char reformatRNACodeId c   | c == ':' = '-'   | c == '|' = '-'   | c == '.' = '-'   | c == '~' = '-'   | c == '_' = '-'-  | c == '/' = '-'             +  | c == '/' = '-'   | otherwise = c-                -reformatRNACodeAln :: Char -> Char ++reformatRNACodeAln :: Char -> Char reformatRNACodeAln c   | c == ':' = '-'   | c == '|' = '-'@@ -1799,7 +1796,7 @@   | c == 'a' = 'A'   | otherwise = c -reformatAln :: Char -> Char +reformatAln :: Char -> Char reformatAln c   | c == '.' = '-'   | c == '~' = '-'@@ -1819,7 +1816,7 @@    response <- N.httpLbs req manager    let sta = N.responseStatus response    if statusIsSuccessful sta-     then return (Right ("Network connection with NCBI server was successful"))+     then return (Right "Network connection with NCBI server was successful")      else return (Left ("Could not connect to NCBI server \"https://www.ncbi.nlm.nih.gov\". Response Code: " ++ show (statusCode sta) ++ " \n" ++ B.unpack (statusMessage sta)))  -- | Blast evalue is set stricter in inital alignment mode@@ -1832,7 +1829,7 @@ reformatFasta input = Seq (seqheader input) updatedSequence Nothing   where updatedSequence = SeqData (L.pack (map reformatFastaSequence (L.unpack (unSD (seqdata input))))) -reformatFastaSequence :: Char -> Char +reformatFastaSequence :: Char -> Char reformatFastaSequence c   | c == '.' = '-'   | c == '~' = '-'@@ -1846,7 +1843,7 @@   | otherwise = c  setRestrictedTaxonomyLimits :: String -> (Maybe Int,Maybe Int)-setRestrictedTaxonomyLimits trestriction +setRestrictedTaxonomyLimits trestriction   | trestriction == "bacteria" = (Just (2 :: Int), Nothing)   | trestriction == "archea" = (Just (2157 :: Int), Nothing)   | trestriction == "eukaryia" = (Just (2759 :: Int), Nothing)@@ -1871,22 +1868,22 @@   --let splitIds = map E.encodeUtf8 (TL.splitOn (TL.pack ",") (TL.pack sequenceIds))   let filteredEntries = concatMap (filterSequencesById alnEntries) sequenceIds   return filteredEntries- + extractAlignmentSequences :: TL.Text -> [Sequence] extractAlignmentSequences  seedFamilyAln = rfamIDAndseedFamilySequences   where seedFamilyAlnLines = TL.lines seedFamilyAln         -- remove empty lines from splitting-        seedFamilyNonEmpty =  filter (\alnline -> not (TL.empty == alnline)) seedFamilyAlnLines+        seedFamilyNonEmpty =  filter (\alnline -> TL.empty /= alnline) seedFamilyAlnLines         -- remove annotation and spacer lines-        seedFamilyIdSeqLines =  filter (\alnline -> ((not ((TL.head alnline) == '#'))) && (not ((TL.head alnline) == ' ')) && (not ((TL.head alnline) == '/'))) seedFamilyNonEmpty +        seedFamilyIdSeqLines =  filter (\alnline -> not ((TL.head alnline) == '#') && not ((TL.head alnline) == ' ') && not ((TL.head alnline) == '/')) seedFamilyNonEmpty         -- put id and corresponding seq of each line into a list and remove whitspaces                 seedFamilyIdandSeqLines = map TL.words seedFamilyIdSeqLines         -- linewise tuples with id and seq without alinment characters - .-        seedFamilyIdandSeqLineTuples = map (\alnline -> ((head alnline),(filterAlnChars (last alnline)))) seedFamilyIdandSeqLines+        seedFamilyIdandSeqLineTuples = map (\alnline -> (head alnline,filterAlnChars (last alnline))) seedFamilyIdandSeqLines         -- line tuples sorted by id         seedFamilyIdandSeqTupleSorted = sortBy (\tuple1 tuple2 -> compare (fst tuple1) (fst tuple2)) seedFamilyIdandSeqLineTuples         -- line tuples grouped by id-        seedFamilyIdandSeqTupleGroups = groupBy (\tuple1 tuple2 -> (fst tuple1) == (fst tuple2)) seedFamilyIdandSeqTupleSorted+        seedFamilyIdandSeqTupleGroups = groupBy (\tuple1 tuple2 -> fst tuple1 == fst tuple2) seedFamilyIdandSeqTupleSorted         seedFamilySequences = map mergeIdSeqTuplestoSequence seedFamilyIdandSeqTupleGroups         rfamIDAndseedFamilySequences = seedFamilySequences @@ -1894,10 +1891,10 @@ filterSequencesById alignmentSequences sequenceId = filter (sequenceHasId sequenceId) alignmentSequences  sequenceHasId :: L.ByteString -> Sequence -> Bool-sequenceHasId sequenceId currentSequence = sequenceId == (unSL (seqid currentSequence))+sequenceHasId sequenceId currentSequence = sequenceId == unSL (seqid currentSequence)  filterAlnChars :: TL.Text -> TL.Text-filterAlnChars cs = TL.filter (\c -> (not (c == '-')) && (not (c == '.'))) cs+filterAlnChars cs = TL.filter (\c -> not (c == '-') && not (c == '.')) cs  mergeIdSeqTuplestoSequence :: [(TL.Text,TL.Text)] -> Sequence mergeIdSeqTuplestoSequence tuplelist = currentSequence

@@ -4,14 +4,14 @@ -- | Statistics for RNAlien Results -- dist/build/RNAlienStatistics/RNAlienStatistics -s bitscore -i /scratch/egg/temp/cm13676/1/model.cm -r /home/mescalin/egg/current/Data/AlienTest/cms/BsrG.cm -g /scratch/egg/temp/AlienSearch/genomes/ -o /scratch/egg/temp/AlienStatistics module Main where-    -import System.Console.CmdArgs      ++import System.Console.CmdArgs import Data.Either.Unwrap import System.Process import qualified Data.ByteString.Lazy.Char8 as L import Bio.RNAlienLibrary import System.Directory-import Bio.Core.Sequence +import Bio.Core.Sequence import Bio.Sequence.Fasta import Data.List import qualified System.FilePath as FP@@ -20,7 +20,7 @@ import Bio.RNAzParser import qualified Bio.RNAcodeParser as RC -data Options = Options            +data Options = Options   { alienCovarianceModelPath  :: String,     alienrnazPath :: String,     alienrnacodePath :: String,@@ -29,7 +29,7 @@     rfamFastaFilePath :: String,     alienFastaFilePath :: String,     rfamModelName :: String,-    rfamModelId :: String,                     +    rfamModelId :: String,     rfamThreshold :: Double,     alienThreshold :: Double,     databaseSize :: Maybe Double,@@ -49,7 +49,7 @@     rfamCovarianceModelPath = def &= name "r" &= help "Path to rfamCovarianceModelPath",     rfamFastaFilePath = def &= name "g" &= help "Path to rfamFastaFile",     rfamModelName = def &= name "n" &= help "Rfam model name",-    rfamModelId = def &= name "d" &= help "Rfam model id",               +    rfamModelId = def &= name "d" &= help "Rfam model id",     alienFastaFilePath = def &= name "a" &= help "Path to alienFastaFile",     outputDirectoryPath = def &= name "o" &= help "Path to output directory",     alienThreshold = 20 &= name "t" &= help "Bitscore threshold for RNAlien model hits on Rfam fasta, default 20",@@ -59,16 +59,16 @@     thresholdSelection = "bitscore" &= name "s" &= help "Selection method, (bitscore, evalue), default bitscore",     linkScores = False &= name "l" &= help "Triggers computation of linkscores via CMCompare",     threads = 1 &= name "c" &= help "Number of available cpu slots/cores, default 1"-  } &= summary "RNAlienStatistics" &= help "Florian Eggenhofer - >2013" &= verbosity       +  } &= summary "RNAlienStatistics" &= help "Florian Eggenhofer - >2013" &= verbosity  --cmSearchFasta threads rfamCovarianceModelPath outputDirectoryPath "Rfam" False genomesDirectoryPath cmSearchFasta :: Int -> String -> Double -> Maybe Double -> Int -> String -> String -> String -> String -> IO [CMsearchHit] cmSearchFasta benchmarkIndex thresholdSelection thresholdScore databaseSize cpuThreads covarianceModelPath outputDirectory modelType fastapath = do   createDirectoryIfMissing False (outputDirectory ++ "/" ++ modelType)-  _ <- systemCMsearch cpuThreads (maybe "" (\dbs -> " -Z " ++ show dbs ++ " ") databaseSize)  covarianceModelPath fastapath (outputDirectory ++ "/" ++ modelType ++ "/" ++ (show benchmarkIndex) ++ ".cmsearch")+  _ <- systemCMsearch cpuThreads (maybe "" (\dbs -> " -Z " ++ show dbs ++ " ") databaseSize)  covarianceModelPath fastapath (outputDirectory ++ "/" ++ modelType ++ "/" ++ show benchmarkIndex ++ ".cmsearch")   --_ <- systemCMsearch cpuThreads " " covarianceModelPath fastapath (outputDirectory ++ "/" ++ modelType ++ "/" ++ (show benchmarkIndex) ++ ".cmsearch")-  result <- readCMSearch (outputDirectory ++ "/" ++ modelType ++ "/" ++ (show benchmarkIndex) ++ ".cmsearch")-  if (isLeft result)+  result <- readCMSearch (outputDirectory ++ "/" ++ modelType ++ "/" ++ show benchmarkIndex ++ ".cmsearch")+  if isLeft result      then do        print (fromLeft result)        return []@@ -82,10 +82,10 @@ cmSearchesFasta :: Int -> String -> Double -> Maybe Double -> Int -> String -> String -> String -> String -> IO [CMsearchHit] cmSearchesFasta benchmarkIndex thresholdSelection thresholdScore databaseSize cpuThreads covarianceModelPath outputDirectory modelType fastapath = do   createDirectoryIfMissing False (outputDirectory ++ "/" ++ modelType)-  _ <- systemCMsearch cpuThreads (maybe "" (\dbs -> " -Z " ++ show dbs ++ " ") databaseSize) covarianceModelPath fastapath (outputDirectory ++ "/" ++ modelType ++ "/" ++ (show benchmarkIndex) ++ ".cmsearch")+  _ <- systemCMsearch cpuThreads (maybe "" (\dbs -> " -Z " ++ show dbs ++ " ") databaseSize) covarianceModelPath fastapath (outputDirectory ++ "/" ++ modelType ++ "/" ++ show benchmarkIndex ++ ".cmsearch")   --_ <- systemCMsearch cpuThreads " " covarianceModelPath fastapath (outputDirectory ++ "/" ++ modelType ++ "/" ++ (show benchmarkIndex) ++ ".cmsearch")-  result <- readCMSearches (outputDirectory ++ "/" ++ modelType ++ "/" ++ (show benchmarkIndex) ++ ".cmsearch")-  if (isLeft result)+  result <- readCMSearches (outputDirectory ++ "/" ++ modelType ++ "/" ++ show benchmarkIndex ++ ".cmsearch")+  if isLeft result      then do        print (fromLeft result)        return []@@ -119,37 +119,37 @@   fastaSequences <- readFasta fastaInputPath   let trimmedSequence = trimCMsearchSequence cmsearch (head fastaSequences)   writeFasta fastaOutputPath [trimmedSequence]-   + trimCMsearchSequence :: CMsearch -> Sequence -> Sequence trimCMsearchSequence cmSearchResult inputSequence = subSequence   where hitScoreEntry = head (cmsearchHits cmSearchResult)         sequenceString = L.unpack (unSD (seqdata inputSequence))         sequenceSubstring = cmSearchsubString (hitStart hitScoreEntry) (hitEnd hitScoreEntry) sequenceString-        newSequenceHeader =  L.pack ((L.unpack (unSL (seqheader inputSequence))) ++ "cmS_" ++ (show (hitStart hitScoreEntry)) ++ "_" ++ (show (hitEnd hitScoreEntry)) ++ "_" ++ (show (hitStrand hitScoreEntry)))-        subSequence = Seq (SeqLabel newSequenceHeader) (SeqData (L.pack sequenceSubstring)) Nothing     +        newSequenceHeader =  L.pack (L.unpack (unSL (seqheader inputSequence)) ++ "cmS_" ++ show (hitStart hitScoreEntry) ++ "_" ++ show (hitEnd hitScoreEntry) ++ "_" ++ show (hitStrand hitScoreEntry))+        subSequence = Seq (SeqLabel newSequenceHeader) (SeqData (L.pack sequenceSubstring)) Nothing  --With paralogs allowed cmSearchSameHit :: CMsearchHit -> CMsearchHit -> Bool cmSearchSameHit hitscore1 hitscore2   | unpackedSeqHeader1 == unpackedSeqHeader2 = True   | otherwise = False-  where unpackedSeqHeader1 = (L.unpack (hitSequenceHeader hitscore1))-        unpackedSeqHeader2 = (L.unpack (hitSequenceHeader hitscore2))+  where unpackedSeqHeader1 = L.unpack (hitSequenceHeader hitscore1)+        unpackedSeqHeader2 = L.unpack (hitSequenceHeader hitscore2)  cmSearchSameOrganism :: CMsearchHit -> CMsearchHit -> Bool cmSearchSameOrganism hitscore1 hitscore2   | hitOrganism1 == hitOrganism2 = True   | otherwise = False-  where unpackedSeqHeader1 = (L.unpack (hitSequenceHeader hitscore1))-        unpackedSeqHeader2 = (L.unpack (hitSequenceHeader hitscore2))+  where unpackedSeqHeader1 = L.unpack (hitSequenceHeader hitscore1)+        unpackedSeqHeader2 = L.unpack (hitSequenceHeader hitscore2)         separationcharacter1 = selectSeparationChar unpackedSeqHeader1         separationcharacter2 = selectSeparationChar unpackedSeqHeader2-        hitOrganism1 = (DS.splitOn separationcharacter1 unpackedSeqHeader1) !! 0-        hitOrganism2 = (DS.splitOn separationcharacter2 unpackedSeqHeader2) !! 0+        hitOrganism1 = head (DS.splitOn separationcharacter1 unpackedSeqHeader1)+        hitOrganism2 = head (DS.splitOn separationcharacter2 unpackedSeqHeader2)  selectSeparationChar :: String -> String selectSeparationChar inputString-  | any (\a -> a == ':') inputString = ":"+  | any ((== ':')) inputString = ":"   | otherwise = "/"  main :: IO ()@@ -171,61 +171,61 @@       _ <- system ("cat " ++ rfamFastaFilePath ++ " | grep '>' | wc -l >" ++ outputDirectoryPath ++ FP.takeFileName rfamFastaFilePath ++ ".entries")       _ <- system ("cat " ++ alienFastaFilePath ++ " | grep '>' | wc -l >" ++ outputDirectoryPath ++ FP.takeFileName alienFastaFilePath ++ ".entries")       rfamFastaEntries <- readFile (outputDirectoryPath ++ FP.takeFileName rfamFastaFilePath ++ ".entries")-      alienFastaEntries <- readFile (outputDirectoryPath ++ FP.takeFileName alienFastaFilePath ++ ".entries")                    +      alienFastaEntries <- readFile (outputDirectoryPath ++ FP.takeFileName alienFastaFilePath ++ ".entries")       let rfamFastaEntriesNumber = read rfamFastaEntries :: Int       let alienFastaEntriesNumber = read alienFastaEntries :: Int-      rfamonAlienResults <- cmSearchesFasta benchmarkIndex thresholdSelection rfamThreshold databaseSize threads rfamCovarianceModelPath outputDirectoryPath "rfamOnAlien" alienFastaFilePath -      alienonRfamResults <- cmSearchFasta benchmarkIndex thresholdSelection alienThreshold databaseSize threads alienCovarianceModelPath outputDirectoryPath "alienOnRfam" rfamFastaFilePath +      rfamonAlienResults <- cmSearchesFasta benchmarkIndex thresholdSelection rfamThreshold databaseSize threads rfamCovarianceModelPath outputDirectoryPath "rfamOnAlien" alienFastaFilePath+      alienonRfamResults <- cmSearchFasta benchmarkIndex thresholdSelection alienThreshold databaseSize threads alienCovarianceModelPath outputDirectoryPath "alienOnRfam" rfamFastaFilePath       let rfamonAlienResultsNumber = length rfamonAlienResults       let alienonRfamResultsNumber = length alienonRfamResults       let rfamonAlienRecovery = (fromIntegral rfamonAlienResultsNumber :: Double) / (fromIntegral alienFastaEntriesNumber :: Double)       let alienonRfamRecovery = (fromIntegral alienonRfamResultsNumber :: Double) / (fromIntegral rfamFastaEntriesNumber :: Double)-      if (verbose == Loud)+      if verbose == Loud         then do           putStrLn ("BenchmarkIndex: " ++ show benchmarkIndex)           putStrLn ("RfamModelName: " ++ rfamModelName)           putStrLn ("RfamModelId: " ++ rfamModelId)-          putStrLn ("Linkscore: " ++ (either id show linkscore))-          putStrLn ("rfamMaxLinkScore: " ++ (either id show rfamMaxLinkScore))-          putStrLn ("alienMaxLinkscore: " ++ (either id show alienMaxLinkscore))+          putStrLn ("Linkscore: " ++ either id show linkscore)+          putStrLn ("rfamMaxLinkScore: " ++ either id show rfamMaxLinkScore)+          putStrLn ("alienMaxLinkscore: " ++ either id show alienMaxLinkscore)           putStrLn ("rfamGatheringThreshold: " ++ show rfamThreshold)-          putStrLn ("alienGatheringThreshold: " ++ show alienThreshold) +          putStrLn ("alienGatheringThreshold: " ++ show alienThreshold)           putStrLn ("rfamFastaEntriesNumber: " ++ show rfamFastaEntriesNumber)-          putStrLn ("alienFastaEntriesNumber: " ++ show alienFastaEntriesNumber) +          putStrLn ("alienFastaEntriesNumber: " ++ show alienFastaEntriesNumber)           putStrLn ("rfamonAlienResultsNumber: " ++ show rfamonAlienResultsNumber)           putStrLn ("alienonRfamResultsNumber: " ++ show alienonRfamResultsNumber)-          putStrLn ("RfamonAlienRecovery: " ++ show rfamonAlienRecovery)   +          putStrLn ("RfamonAlienRecovery: " ++ show rfamonAlienRecovery)           putStrLn ("AlienonRfamRecovery: " ++ show alienonRfamRecovery)           print rnazString           print rnacodeString           print cmStatString-        else do+        else           putStrLn (show benchmarkIndex ++ "\t" ++ rfamModelName ++ "\t" ++ rfamModelId ++ "\t" ++  (either id show linkscore) ++ "\t" ++  (either id show rfamMaxLinkScore) ++ "\t" ++ (either id show alienMaxLinkscore) ++ "\t" ++ show rfamThreshold ++ "\t" ++ show alienThreshold ++ "\t" ++ show rfamFastaEntriesNumber ++ "\t" ++ show alienFastaEntriesNumber ++ "\t" ++ show rfamonAlienResultsNumber ++ "\t" ++ show alienonRfamResultsNumber ++ "\t" ++ printf "%.2f" rfamonAlienRecovery  ++ "\t" ++ printf "%.2f" alienonRfamRecovery ++ "\t" ++ rnazString ++ "\t" ++ rnacodeString ++ "\t" ++ cmStatString)     else do       --compute linkscore       alienMaxLinkscore <- if linkScores then compareCM alienCovarianceModelPath alienCovarianceModelPath outputDirectoryPath else return ( Left "-")       _ <- system ("cat " ++ alienFastaFilePath ++ " | grep '>' | wc -l >" ++ outputDirectoryPath ++ FP.takeFileName alienFastaFilePath ++ ".entries")-      alienFastaEntries <- readFile (outputDirectoryPath ++ FP.takeFileName alienFastaFilePath ++ ".entries")                    -      let alienFastaEntriesNumber = read alienFastaEntries :: Int  -      if (verbose == Loud)+      alienFastaEntries <- readFile (outputDirectoryPath ++ FP.takeFileName alienFastaFilePath ++ ".entries")+      let alienFastaEntriesNumber = read alienFastaEntries :: Int+      if verbose == Loud         then do-          putStrLn ("BenchmarkIndex:")-          putStrLn ("RfamModelName: -")-          putStrLn ("RfamModelId: -")-          putStrLn ("Linkscore: -")-          putStrLn ("rfamMaxLinkScore: -")-          putStrLn ("alienMaxLinkscore: " ++  (either id show alienMaxLinkscore))    -          putStrLn ("rfamGatheringThreshold: -")-          putStrLn ("alienGatheringThreshold: -") -          putStrLn ("rfamFastaEntriesNumber: -")-          putStrLn ("alienFastaEntriesNumber: " ++ show alienFastaEntriesNumber) -          putStrLn ("rfamonAlienResultsNumber: -")-          putStrLn ("alienonRfamResultsNumber: -")-          putStrLn ("RfamonAlienRecovery: -")   -          putStrLn ("AlienonRfamRecovery: -")+          putStrLn "BenchmarkIndex:"+          putStrLn "RfamModelName: -"+          putStrLn "RfamModelId: -"+          putStrLn "Linkscore: -"+          putStrLn "rfamMaxLinkScore: -"+          putStrLn ("alienMaxLinkscore: " ++  either id show alienMaxLinkscore)+          putStrLn "rfamGatheringThreshold: -"+          putStrLn "alienGatheringThreshold: -"+          putStrLn "rfamFastaEntriesNumber: -"+          putStrLn ("alienFastaEntriesNumber: " ++ show alienFastaEntriesNumber)+          putStrLn "rfamonAlienResultsNumber: -"+          putStrLn "alienonRfamResultsNumber: -"+          putStrLn "RfamonAlienRecovery: -"+          putStrLn "AlienonRfamRecovery: -"           print rnazString           print cmStatString-        else do+        else           putStrLn (show benchmarkIndex ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ (either id show alienMaxLinkscore) ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ show alienFastaEntriesNumber ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-"  ++ "\t" ++ "-" ++ "\t" ++ rnazString  ++ "\t" ++ rnacodeString ++ "\t" ++ cmStatString)  rnazOutput :: Verbosity -> String -> IO String@@ -237,14 +237,14 @@       if isRight inputRNAz         then do           let rnaZ = fromRight inputRNAz-          if (verbose == Loud)+          if verbose == Loud             then do-              let output = "Mean pairwise identity: " ++ show (meanPairwiseIdentity rnaZ) ++ "\n  Shannon entropy: " ++ show (shannonEntropy rnaZ) ++  "\n  GC content: " ++ show (gcContent rnaZ) ++ "\n  Mean single sequence minimum free energy: " ++ show (meanSingleSequenceMinimumFreeEnergy rnaZ) ++ "\n  Consensus minimum free energy: " ++ show (consensusMinimumFreeEnergy rnaZ) ++ "\n  Energy contribution: " ++ show (energyContribution rnaZ) ++ "\n  Covariance contribution: " ++ show (covarianceContribution rnaZ) ++ "\n  Combinations pair: " ++ show (combinationsPair rnaZ) ++ "\n  Mean z-score: " ++ show (meanZScore rnaZ) ++ "\n  Structure conservation index: " ++ show (structureConservationIndex rnaZ) ++ "\n  Background model: " ++ backgroundModel rnaZ ++ "\n  Decision model: " ++ decisionModel rnaZ ++ "\n  SVM decision value: " ++ show (svmDecisionValue rnaZ) ++ "\n  SVM class propability: " ++ show (svmRNAClassProbability rnaZ) ++ "\n  Prediction: " ++ (prediction rnaZ)+              let output = "Mean pairwise identity: " ++ show (meanPairwiseIdentity rnaZ) ++ "\n  Shannon entropy: " ++ show (shannonEntropy rnaZ) ++  "\n  GC content: " ++ show (gcContent rnaZ) ++ "\n  Mean single sequence minimum free energy: " ++ show (meanSingleSequenceMinimumFreeEnergy rnaZ) ++ "\n  Consensus minimum free energy: " ++ show (consensusMinimumFreeEnergy rnaZ) ++ "\n  Energy contribution: " ++ show (energyContribution rnaZ) ++ "\n  Covariance contribution: " ++ show (covarianceContribution rnaZ) ++ "\n  Combinations pair: " ++ show (combinationsPair rnaZ) ++ "\n  Mean z-score: " ++ show (meanZScore rnaZ) ++ "\n  Structure conservation index: " ++ show (structureConservationIndex rnaZ) ++ "\n  Background model: " ++ backgroundModel rnaZ ++ "\n  Decision model: " ++ decisionModel rnaZ ++ "\n  SVM decision value: " ++ show (svmDecisionValue rnaZ) ++ "\n  SVM class propability: " ++ show (svmRNAClassProbability rnaZ) ++ "\n  Prediction: " ++ prediction rnaZ               return output             else do-              let output = show (meanPairwiseIdentity rnaZ) ++ "\t" ++ show (shannonEntropy rnaZ) ++  "\t" ++ show (gcContent rnaZ) ++ "\t" ++ show (meanSingleSequenceMinimumFreeEnergy rnaZ) ++ "\t" ++ show (consensusMinimumFreeEnergy rnaZ) ++ "\t" ++ show (energyContribution rnaZ) ++ "\t" ++ show (covarianceContribution rnaZ) ++ "\t" ++ show (combinationsPair rnaZ) ++ "\t" ++ show (meanZScore rnaZ) ++ "\t" ++ show (structureConservationIndex rnaZ) ++ "\t" ++ show (svmDecisionValue rnaZ) ++ "\t" ++ show (svmRNAClassProbability rnaZ) ++ "\t" ++ (prediction rnaZ)+              let output = show (meanPairwiseIdentity rnaZ) ++ "\t" ++ show (shannonEntropy rnaZ) ++  "\t" ++ show (gcContent rnaZ) ++ "\t" ++ show (meanSingleSequenceMinimumFreeEnergy rnaZ) ++ "\t" ++ show (consensusMinimumFreeEnergy rnaZ) ++ "\t" ++ show (energyContribution rnaZ) ++ "\t" ++ show (covarianceContribution rnaZ) ++ "\t" ++ show (combinationsPair rnaZ) ++ "\t" ++ show (meanZScore rnaZ) ++ "\t" ++ show (structureConservationIndex rnaZ) ++ "\t" ++ show (svmDecisionValue rnaZ) ++ "\t" ++ show (svmRNAClassProbability rnaZ) ++ "\t" ++ prediction rnaZ               return output-         else do+         else            if (verbose == Loud)             then do               let output = "Mean pairwise identity: " ++ " - \n  Shannon entropy: " ++ " - \n  GC content: " ++ " - \n  Mean single sequence minimum free energy: " ++ " - \n  Consensus minimum free energy: " ++ " - \n  Energy contribution: " ++ " - \n  Covariance contribution: " ++ " - \n  Combinations pair: " ++ " - \n  Mean z-score: " ++ " - \n  Structure conservation index: " ++ " - \n  Background model: " ++ " - \n  Decision model: " ++ " - \n  SVM decision value: " ++ " - \n  SVM class propability: " ++ " - \n  Prediction: " ++ " - \n"@@ -252,7 +252,7 @@             else do               let output = "-" ++ "\t" ++ "-" ++  "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-" ++ "\t" ++ "-"               return output-    else do+    else        if (verbose == Loud)          then do            let output = "Mean pairwise identity: " ++ " - \n  Shannon entropy: " ++ " - \n  GC content: " ++ " - \n  Mean single sequence minimum free energy: " ++ " - \n  Consensus minimum free energy: " ++ " - \n  Energy contribution: " ++ " - \n  Covariance contribution: " ++ " - \n  Combinations pair: " ++ " - \n  Mean z-score: " ++ " - \n  Structure conservation index: " ++ " - \n  Background model: " ++ " - \n  Decision model: " ++ " - \n  SVM decision value: " ++ " - \n  SVM class propability: " ++ " - \n  Prediction: " ++ " - \n"@@ -270,14 +270,14 @@       if isRight inputCMstat         then do           let cmStat = fromRight inputCMstat-          if (verbose == Loud)+          if verbose == Loud             then do-              let output = "statSequenceNumber: " ++ (show (statSequenceNumber cmStat)) ++ "\nstatEffectiveSequences: " ++ (show (statEffectiveSequences cmStat)) ++ "\nstatConsensusLength: " ++ (show (statConsensusLength cmStat)) ++ "\nstatW: " ++ show (statW cmStat) ++ "\nstatBasepairs: " ++ show (statBasepairs cmStat) ++ "\nstatBifurcations: " ++ (show (statBifurcations cmStat)) ++ "\nstatModel: " ++ (statModel cmStat) ++ "\nrelativeEntropyCM: " ++ show (relativeEntropyCM cmStat) ++ "\nrelativeEntropyHMM: " ++ show (relativeEntropyHMM cmStat)+              let output = "statSequenceNumber: " ++ show (statSequenceNumber cmStat) ++ "\nstatEffectiveSequences: " ++ show (statEffectiveSequences cmStat) ++ "\nstatConsensusLength: " ++ show (statConsensusLength cmStat) ++ "\nstatW: " ++ show (statW cmStat) ++ "\nstatBasepairs: " ++ show (statBasepairs cmStat) ++ "\nstatBifurcations: " ++ show (statBifurcations cmStat) ++ "\nstatModel: " ++ statModel cmStat ++ "\nrelativeEntropyCM: " ++ show (relativeEntropyCM cmStat) ++ "\nrelativeEntropyHMM: " ++ show (relativeEntropyHMM cmStat)               return output             else do-              let output = (show (statSequenceNumber cmStat)) ++ "\t" ++ (show (statEffectiveSequences cmStat)) ++ "\t" ++ (show (statConsensusLength cmStat)) ++ "\t" ++ show (statW cmStat) ++ "\t" ++ show (statBasepairs cmStat) ++ "\t" ++ (show (statBifurcations cmStat)) ++ "\t" ++ (statModel cmStat) ++ "\t" ++ show (relativeEntropyCM cmStat) ++ "\t" ++ show (relativeEntropyHMM cmStat)+              let output = show (statSequenceNumber cmStat) ++ "\t" ++ show (statEffectiveSequences cmStat) ++ "\t" ++ show (statConsensusLength cmStat) ++ "\t" ++ show (statW cmStat) ++ "\t" ++ show (statBasepairs cmStat) ++ "\t" ++ show (statBifurcations cmStat) ++ "\t" ++ statModel cmStat ++ "\t" ++ show (relativeEntropyCM cmStat) ++ "\t" ++ show (relativeEntropyHMM cmStat)               return output-         else do+         else            if (verbose == Loud)             then do               let output = "statSequenceNumber: -" ++ "\nstatEffectiveSequences: -" ++ "\nstatConsensusLength: -" ++ "\nstatW: -" ++ "\nstatBasepairs: -" ++ "\nstatBifurcations: -" ++ "\nstatModel: -" ++ "\nrelativeEntropyCM: -" ++ "\nrelativeEntropyHMM: -"@@ -285,7 +285,7 @@             else do               let output = "-\t" ++ "-\t" ++ "-\t" ++ "-\t" ++ "-\t" ++ "-\t" ++ "-\t" ++ "-\t" ++ "-"               return output-    else do+    else        if (verbose == Loud)          then do            let output = "statSequenceNumber: -" ++ "\nstatEffectiveSequences: -" ++ "\nstatConsensusLength: -" ++ "\nstatW: -" ++ "\nstatBasepairs: -" ++ "\nstatBifurcations: -" ++ "\nstatModel: -" ++ "\nrelativeEntropyCM: -" ++ "\nrelativeEntropyHMM: -"@@ -305,14 +305,14 @@           let rnaCode = fromRight inputRNACode           let lowestPvalue = minimum (map RC.pvalue (RC.rnacodeHits rnaCode))           let rnaCodeClassification = if lowestPvalue < 0.05 then "PROTEIN" else "OTHER"-          if (verbose == Loud)-            then do              -              let output = "RNAcode lowest p-value: " ++ (show lowestPvalue) ++ "\nrnaCodeClassification: " ++ rnaCodeClassification +          if verbose == Loud+            then do+              let output = "RNAcode lowest p-value: " ++ show lowestPvalue ++ "\nrnaCodeClassification: " ++ rnaCodeClassification               return output             else do-              let output = (show lowestPvalue) ++ "\t" ++ rnaCodeClassification+              let output = show lowestPvalue ++ "\t" ++ rnaCodeClassification               return output-         else do+         else            if (verbose == Loud)             then do               let output = "RNAcode lowest p-value: " ++ "-" ++ "\nrnaCodeClassification: " ++ "-"@@ -321,11 +321,11 @@               let output = "-\t" ++ "-"               --let output = show (fromLeft inputRNACode)               return output-    else do+    else        if (verbose == Loud)          then do            let output =  "RNAcode lowest p-value: " ++ "-" ++ "\nrnaCodeClassification: " ++ "-"            return output          else do            let output = "-\t" ++ "-"-           return output      +           return output

@@ -1,54 +0,0 @@-{-# LANGUAGE RecordWildCards #-}-{-# LANGUAGE DeriveDataTypeable #-}---- | Select Sequences---   Testcommand: SelectSequences -i /path/to/test.clustal-module Main where-    -import System.Console.CmdArgs    -import Bio.RNAlienLibrary-import Data.Either.Unwrap--data Options = Options            -  { inputClustalPath :: String,-    toogleExternalSelectSequences :: Bool,-    seqenceNumber :: Int,-    optimalIdentity :: Double,-    maximalIdenity :: Double,-    referenceSequence :: Bool,-    distanceMatrixPath :: String-  } deriving (Show,Data,Typeable)--options :: Options-options = Options-  { inputClustalPath = def &= name "c" &= help "Path to input clustal file",-    toogleExternalSelectSequences = False &= name "e" &= help "Use only replacement of alignment characters and external 'selectSequence.pl'. Default: False",-    seqenceNumber = (6 :: Int) &= name "n" &= help "Number of sequences in the output alignment. (Default: 6)",-    optimalIdentity = (80 :: Double) &= name "i" &= help "Optimize for this percentage of mean pairwise identity (Default: 80)",-    maximalIdenity = (95 :: Double) &= name "m" &= help "Sequences with a higher percentage of pairwise Identity will be removed. (Default: 95)",-    referenceSequence = True &= name "x" &= help "The first sequence (=reference sequence) is always present in the output alignment per default. Default: True",-    distanceMatrixPath = "" &= name "d" &= help "Path to distance matrix output file, only internal for interal sequence selection, e.g. /home/user/distmat (Default: )"                            -  } &= summary "SelectSequences" &= help "Florian Eggenhofer 2016" &= verbosity       -                -main :: IO ()-main = do-  Options{..} <- cmdArgs options-  let reformatedClustalPath = inputClustalPath ++ ".reformated"-  if toogleExternalSelectSequences-    then do-      resultStatus <- preprocessClustalForRNAzExternal inputClustalPath reformatedClustalPath seqenceNumber (truncate optimalIdentity) (truncate maximalIdenity) referenceSequence-      if (isRight resultStatus)-        then do-          let (idMatrix,resultAln) = fromRight resultStatus-          putStr resultAln-          if null distanceMatrixPath-            then return ()-            else (writeFile distanceMatrixPath idMatrix)       -        else (print ("A problem occured selecting sequences: " ++ fromLeft resultStatus))-    else do-      resultStatus <- preprocessClustalForRNAz inputClustalPath reformatedClustalPath seqenceNumber optimalIdentity maximalIdenity referenceSequence-      if (isRight resultStatus)-        then do-          let (_,resultAln) = fromRight resultStatus-          putStr resultAln-        else (print ("A problem occured selecting sequences: " ++ fromLeft resultStatus))

@@ -4,10 +4,10 @@ -- | Convert cmsearch output to Browser Extensible Data (BED) format --   Testcommand: cmsearchToBED -i /path/to/test.clustal module Main where-import Prelude -import System.Console.CmdArgs    +import Prelude+import System.Console.CmdArgs import Bio.RNAlienLibrary-import Data.Either.Unwrap +import Data.Either.Unwrap import qualified Data.ByteString.Lazy.Char8 as L import qualified Data.Text as T import Data.List@@ -24,17 +24,17 @@  instance Show Bed where   show (Bed _browserPostition _browserSettings _bedName _bedDescription _bedVisibility _bedItemRgb _bedEntries) = a ++ b ++ c ++ d ++ e ++ f ++ g-    where a = "browser position " ++ (T.unpack _browserPostition) ++ "\n" -          b = (T.unpack _browserSettings) ++ "\n" +    where a = "browser position " ++ T.unpack _browserPostition ++ "\n"+          b = T.unpack _browserSettings ++ "\n"           c = "track name=\"" ++ T.unpack _bedName  ++ "\" "           d = "description=\"" ++ T.unpack _bedDescription ++ "\" "           e = "visibility=" ++  show _bedVisibility ++ " "           f = "itemRgb=\"" ++ itemRbg ++ "\"\n"           itemRbg = if _bedItemRgb then "On" else "Off"           g = concatMap show _bedEntries-          -  -data BedEntry = BedEntry    +++data BedEntry = BedEntry   { chrom :: T.Text,     chromStart :: Int,     chromEnd  :: Int,@@ -47,24 +47,24 @@     blockCount :: Maybe Int,     blockSizes :: Maybe [Int],     blockStarts :: Maybe [Int]-  } deriving (Eq, Read) +  } deriving (Eq, Read)  instance Show BedEntry where   show (BedEntry _chrom _chromStart _chromEnd _chromName _score _strand _thickStart _thickEnd _color _blockCount _blockSizes _blockStarts) = a ++ b ++ c ++ d ++ e ++ f ++ g ++ h ++ i ++ j ++ k ++ l-    where a = T.unpack _chrom ++ "\t" -          b = show _chromStart ++ "\t" +    where a = T.unpack _chrom ++ "\t"+          b = show _chromStart ++ "\t"           c = show _chromEnd ++ "\t"           d = maybe "" T.unpack _chromName ++ "\t"           e = maybe "" show _score ++ "\t"-          f = maybe "" (\s -> [s])  _strand ++ "\t"+          f = maybe "" ((: []))  _strand ++ "\t"           g = maybe "" show _thickStart ++ "\t"           h = maybe "" show _thickEnd ++ "\t"           i = maybe "" T.unpack _color ++ "\t"-          j = maybe "" show _blockCount ++ "\t" -          k = maybe "" (\sizes -> intercalate "," (map show sizes)) _blockSizes ++ "\t"-          l = maybe "" (\starts -> intercalate "," (map show starts)) _blockStarts ++ "\n"-          -data Options = Options            +          j = maybe "" show _blockCount ++ "\t"+          k = maybe "" (intercalate "," . map show) _blockSizes ++ "\t"+          l = maybe "" (intercalate "," . map show) _blockStarts ++ "\n"++data Options = Options   { cmsearchPath :: String,     inputBrowserSettings :: String,     inputBedVisibility :: Int,@@ -87,16 +87,16 @@     inputTrackColor = "255,0,0" &= name "c" &= help "RGB Color of the track. Default: 255,0,0",     sortBed = True &= name "s" &= help "Sort entries of Bed file by start end end cooridinates. Default: True",     withHeader = True &= name "w" &= help "Output contains bed header. Default: True"-  } &= summary "cmsearchToBED - Converts cmsearch file hits to BED file entries" &= help "Florian Eggenhofer 2016" &= verbosity       -            +  } &= summary "cmsearchToBED - Converts cmsearch file hits to BED file entries" &= help "Florian Eggenhofer 2016" &= verbosity+ main :: IO () main = do   Options{..} <- cmdArgs options   parsedCmsearch <- readCMSearch cmsearchPath-  if (isRight parsedCmsearch)+  if isRight parsedCmsearch      then do        let outputBED = convertcmSearchToBED (fromRight parsedCmsearch) inputBrowserSettings inputTrackName inputTrackDescription inputTrackColor inputBedVisibility inputItemRgb sortBed-       if (isRight outputBED)+       if isRight outputBED          then            if withHeader              then print (fromRight outputBED)@@ -104,7 +104,7 @@                let output = concatMap show (bedEntries (fromRight outputBED))                putStr output          else putStr (fromLeft outputBED)-     else (putStr ("A problem occured converting from cmsearch to BED format:\n " ++ show (fromLeft parsedCmsearch)))+     else putStr ("A problem occured converting from cmsearch to BED format:\n " ++ show (fromLeft parsedCmsearch))  --convertcmSearchToBED :: CMsearch -> String -> String -> Either String String --convertcmSearchToBED inputcmsearch trackName trackColor@@ -125,13 +125,13 @@         bedEntries = map (cmsearchHitToBEDentry trackName trackColor) cmHits         sortedBedEntries = if sortBed then sortBy orderBedEntry bedEntries else bedEntries         currentBrowserPosition = T.unpack (chrom firstEntry) ++ ":" ++ show (chromStart firstEntry) ++ "-" ++ show (chromEnd firstEntry)-        firstEntry = (head sortedBedEntries)+        firstEntry = head sortedBedEntries         bed = Bed (T.pack currentBrowserPosition) (T.pack inputBrowserSettings) (T.pack trackName) (T.pack trackDescription) inputBedVisibility inputItemRgb sortedBedEntries  cmsearchHitToBEDentry :: String -> String -> CMsearchHit -> BedEntry cmsearchHitToBEDentry hitName hitColor cmHit = entry   where entry = BedEntry  chromosome entrystart entryend (Just (T.pack hitName)) entryscore entrystrand thickstart thickend entrycolor blocks blockSize blockStart-        chromosome = T.pack (L.unpack (hitSequenceHeader cmHit)) +        chromosome = T.pack (L.unpack (hitSequenceHeader cmHit))         --entryline = L.unpack (hitSequenceHeader cmHit) ++ "\t" ++ entryStart cmHit ++ "\t" ++ entryEnd cmHit++ "\t" ++ (hitName) ++ "\t" ++ "0" ++ "\t" ++ [(hitStrand cmHit)] ++ "\t" ++ show (hitStart cmHit) ++ "\t" ++ show (hitEnd cmHit) ++ "\t" ++ hitColor ++ "\n"         entrystart = if hitStrand cmHit == '+' then hitStart cmHit else hitEnd cmHit         entryend = if hitStrand cmHit == '+' then hitEnd cmHit else hitStart cmHit@@ -141,10 +141,10 @@         thickend = Just entryend         entrycolor = Just (T.pack hitColor)         blocks = Just (1 :: Int)-        blockSize = Just [(entryend - entrystart)]-        blockStart = Just [(0 :: Int)]-        +        blockSize = Just [entryend - entrystart]+        blockStart = Just [0 :: Int] + --cmsearchHitToBEDentry :: String -> String -> CMsearchHit -> String --cmsearchHitToBEDentry hitName hitColor cmHit = entryline --  where entryline = L.unpack (hitSequenceHeader cmHit) ++ "\t" ++ entryStart cmHit ++ "\t" ++ entryEnd cmHit++ "\t" ++ (hitName) ++ "\t" ++ "0" ++ "\t" ++ [(hitStrand cmHit)] ++ "\t" ++ show (hitStart cmHit) ++ "\t" ++ show (hitEnd cmHit) ++ "\t" ++ hitColor ++ "\n"@@ -153,13 +153,13 @@  entryStart :: CMsearchHit -> String entryStart cmHit-  | (hitStrand cmHit) == '+' = show (hitStart cmHit)+  | hitStrand cmHit == '+' = show (hitStart cmHit)   | otherwise = show (hitEnd cmHit)  entryEnd :: CMsearchHit -> String entryEnd cmHit-  | (hitStrand cmHit) == '+' = show (hitEnd cmHit)-  | otherwise = show (hitStart cmHit) +  | hitStrand cmHit == '+' = show (hitEnd cmHit)+  | otherwise = show (hitStart cmHit)  orderBedEntry :: BedEntry -> BedEntry -> Ordering orderBedEntry firstHit secondHit