packages feed

RNAFold 0.0.2.1 → 1.99.1.0

raw patch · 13 files changed

+952/−1186 lines, 13 filesdep +ADPfusiondep +BiobaseXNAdep +mtldep −Biobasedep −BiobaseTurnerdep −BiobaseTypesdep ~BiobaseViennadep ~PrimitiveArraydep ~primitivenew-component:exe:RNAFold

Dependencies added: ADPfusion, BiobaseXNA, mtl, strict

Dependencies removed: Biobase, BiobaseTurner, BiobaseTypes, HsTools, containers

Dependency ranges changed: BiobaseVienna, PrimitiveArray, primitive, vector

Files

− BioInf/RNAEval.hs
@@ -1,122 +0,0 @@---- | Given a sequence and a structure, evaluate the energy.------ TODO switch to 'SSTree [Energy]' type!--module BioInf.RNAEval where--import Text.Printf-import qualified Data.Vector.Unboxed as VU--import Biobase.RNA-import Biobase.Structure-import Biobase.Structure.DotBracket-import Biobase.Types.Ring-import Biobase.Vienna-import Data.PrimitiveArray--import BioInf.RNAFold.EnergyInt-import BioInf.RNAFold.Functions------ | Sum up a complete (sub-) tree.--rnaEval :: ViennaTables -> String -> String -> Int-rnaEval vna pri' sec' = treeSum $ annotateWithEnergy vna pri sst where-  sec = dotbracketToPairlist sec'-  sst = toSSTree sec-  pri = mkPrimary pri'------ | Evaluate the energy of a secondary structure tree with sequence. We abuse--- the normal folding functions with a dummy table full of (one :: Energy).--- This is probably slower than another method but quickly written.------ TODO this is basically crapfuck ;-) Should use the FoldFunctions directly--- instead of that strange table. Should not xxxOpt either.--annotateWithEnergy :: ViennaTables -> Primary -> SSTree () -> SSTree [Int]-annotateWithEnergy trnr pri t = f t where-  -- extern part-  f (SSExt l _ []) = SSExt l [one] []-  f (SSExt l _ xs) =-    let-      es = map ((\(i,j) -> externalLoopOpt trnr pri dummy i j) . treeIJ) xs-    in-      SSExt l es (map f xs)-  -- hairpin-  f (SSTree i j _ []) = SSTree i j [hairpinOpt trnr pri i j] []-  -- 1-loop-  f (SSTree i j _ [x])-      -- stack-      | i+1==k&&j-1==l-      = SSTree i j [stackOpt trnr pri dummy i j] [f x]-      | (di,dj) `VU.elem` tabbedInteriorLoopDistances i j-      = SSTree i j [tabbedInteriorLoopOpt trnr pri dummy i j] [f x]-      | di==0&&dj>1-      = SSTree i j [bulgeLOpt trnr pri dummy i j] [f x]-      | di>1&&dj==0-      = SSTree i j [bulgeROpt trnr pri dummy i j] [f x]-      | di==1&&dj>1-      = SSTree i j [interior1xnLOpt trnr pri dummy i j] [f x]-      | di>1&&dj==1-      = SSTree i j [interior1xnROpt trnr pri dummy i j] [f x]-      | ds+dl>30-      = error "not handling loops with size >30"-      -- large interiorr loop-      | otherwise       = SSTree i j [largeInteriorLoopOpt trnr pri dummy i j] [f x]-    where-      (k,l) = treeIJ x-      di = k-i-1-      dj = j-l-1-      ds = min di dj-      dl = max di dj-  -- multiple loop-  f (SSTree i j _ xs) =-    let-      cl = multibranchCloseOpt trnr pri dummy dummy i j-      ls = map ((\(k,l) -> multibranchIJLoopOpt trnr pri dummy k l) . treeIJ) xs-    in-      SSTree i j (cl:ls) (map f xs)--  dummy = fromAssocs (0,0) (n,n) one []-  n = snd $ bounds pri------ | convert an annotated tree into strings that explain each score.------ TODO this is a stupid name--explainTree :: Primary -> SSTree [Int] -> [String]-explainTree inp sst = f sst where-  -- | exterior loop-  f (SSExt _ _ []) = [""]-  f (SSExt _ _ xs) = this : concatMap f xs where-    eners = map (\(SSTree _ _ [e] _) -> e) xs-    ener = sum eners-    this = printf "%-20s                                     %6d   %s" "External loop" ener (show eners)-  -- | hairpin-  f (SSTree i j [e] []) = [this] where-    this = printf "%-20s (%4d,%4d) %4s                    %6d" "Hairpin loop" (i+1) (j+1) (show $ pair inp i j) e-  f (SSTree i j [e] [x@(SSTree k l _ _)]) = this : f x where-      this = printf "%-20s (%4d,%4d) %4s   (%4d,%4d) %4s %6d" "Interior" (i+1) (j+1) (show $ pair inp i j) (k+1) (l+1) (show $ pair inp k l) e-  f (SSTree i j es xs) = concatMap f xs ++ [this] where-    this = printf "%-20s (%4d,%4d) %4s                    %6d %6d, %s" "Multi loop" (i+1) (j+1) (show $ pair inp i j) (sum es) (head es) (show $ tail es)------ | input sequence indices--treeIJ (SSTree i j _ _) = (i,j)----- | Run a sum over the tree. (foldl (+), the tree annotations)------ TODO that should go into Biobase.Structure as a generic walk over the tree--treeSum t = f t where-  f (SSExt _ es xs) = ringProductL $ es ++ map f xs-  f (SSTree _ _ es xs) = ringProductL $ es ++ map f xs
− BioInf/RNAFold.hs
@@ -1,115 +0,0 @@---- | ViennaRNA folding based on an algebraic ring structure. This should--- combine the goals of few lines of codes, multiple different folding--- functions and extensibility.------ NOTE Assume that you want '-d 3' for folding with dangles. Then you can just--- instanciate the folding functions, replacing only those functions where the--- folding changes based on the new dangle options.------ NOTE compile with: -fno-method-sharing--module BioInf.RNAFold where--import Control.Monad-import Control.Monad.ST--import Biobase.RNA-import Biobase.Types.Ring-import Data.PrimitiveArray-import Biobase.Structure--import BioInf.RNAFold.Functions--import Debug.Trace.Tools-import Debug.Trace----- | Folding works on unboxed values of a Ring-type for which a FoldFunctions--- instance does exist. By default, we have this for Energy values. Again, we--- use a class as we could be interested in probabilistic backtracking or--- something like that.--type ResultTables a =-  ( Table a -- weak structures-  , Table a -- strong structures-  , Table a -- exactly one component-  , Table a -- one or more components-  , Table a -- complete external structures-  )--type Pairlist = [(Int,Int)]--class (FoldFunctions a) => Fold a where--  fold      :: TurnerTables a -> Primary -> (ResultTables a)-  foldST    :: TurnerTables a -> Primary -> ST s (ResultTables a)-  backtrack :: TurnerTables a -> Primary -> (ResultTables a) -> a -> [(Secondary,a)]--  -- | We have a default instance for folding based on Rings--  fold trnr inp = runST $ foldST trnr inp-  {-# INLINE fold #-}--  foldST trnr inp = do-    let n = snd $ bounds inp-    (weakM,weak)     <- mkTable n-    (strongM,strong) <- mkTable n-    (externM,extern) <- mkTableWith one n-    (mbr1M,mbr1)     <- mkTable n-    (mbrM,mbr)       <- mkTable n-    forM_ [n,n-1..0] $ \i -> forM_ [i,i+1..n] $ \j -> do-      let pIJ = pair inp i j-      when (pIJ/=vpNP&&i+3<j) $ do-        -- weak table-        let hpVal = {-# SCC "hpVal" #-} hairpinOpt trnr inp i j-        let ilVal = {-# SCC "ilVal" #-} ringSumL-              [ largeInteriorLoopOpt trnr inp strong i j-              , tabbedInteriorLoopOpt trnr inp strong i j-              , bulgeLOpt trnr inp strong i j-              , bulgeROpt trnr inp strong i j-              , interior1xnLOpt trnr inp strong i j-              , interior1xnROpt trnr inp strong i j-              ]-        let mbVal = {-# SCC "mbVal" #-} multibranchCloseOpt trnr inp mbr mbr1 i j-        writeM weakM (i,j) $ ringSumL [hpVal,ilVal,mbVal]-        -- strong table-        when (i+5<j) $ do-          let stValW = {-# SCC "stValW" #-} stackOpt trnr inp weak i j-          let stValS = {-# SCC "stValS" #-} stackOpt trnr inp strong i j-          writeM strongM (i,j) $ ringSumL [stValW,stValS]-      -- multibranch loops-      when (i>0&&j<n) $ do-        -- M1-        let mbr1ValS = {-# SCC "mbr1ValS" #-} multibranchIJLoopOpt trnr inp strong i j-        let mbr1ValU = {-# SCC "mbr1ValU" #-} multibranchUnpairedJOpt trnr inp mbr1 i j-        writeM mbr1M (i,j) $ ringSumL [mbr1ValS,mbr1ValU]-        -- M-        let mbrValU  = {-# SCC "mbrValU" #-} multibranchUnpairedJOpt trnr inp mbr i j-        let mbrValS  = {-# SCC "mbrValS" #-} multibranchKJHelixOpt trnr inp strong i j-        let mbrValMS = {-# SCC "mbrValMS" #-} multibranchAddKJHelixOpt trnr inp mbr strong i j-        writeM mbrM (i,j) $ ringSumL [mbrValU,mbrValS,mbrValMS]-    -- fill only part of the F array-    let j=n-    forM_ [n-6,n-7..0] $ \i -> do-      let extUP   = {-# SCC "extUP"   #-} if i<n then extern ! (i+1,j) else zero-      let extStr  = {-# SCC "extStr"  #-} externalLoopOpt trnr inp strong i j-      let extAddL = {-# SCC "extAddL" #-} externalAddLoopOpt trnr inp strong extern i j-      writeM externM (i,j) $ ringSumL [extUP,extStr,extAddL,one] -- always add 'one' as the open chain should always be contained-    return (weak,strong,mbr1,mbr,extern)-  {-# INLINE foldST #-}----- * Helper functions---- Create one 2dim - IxTable with default value.--mkTable n = mkTableWith zero n---- Create one IxTable with user-supplied value.--mkTableWith v n = do-  tM <- fromAssocsM (0,0) (n,n) v []-  t <- unsafeFreezeM tM-  return (tM,t)-
− BioInf/RNAFold/Energy.hs
@@ -1,92 +0,0 @@-{-# LANGUAGE StandaloneDeriving #-}--module BioInf.RNAFold.Energy-  ( FoldFunctions (..)-  , Fold (..)-  ) where--import BioInf.RNAFold-import Biobase.Types.Energy-import Biobase.Types.Ring-import BioInf.RNAFold.Functions----instance FoldFunctions Energy--instance Fold Energy where-  backtrack trnr inp tbls = error "write me"-{--  backtrack trnr inp (weak,strong,mbr1,mbr,extern) = ext 0 n delta where-    n = VU.length inp -1-    delta = one :: Energy-    overallBest = extern `unsafeIndex` (0,n)-    ext i j d = let bestE = extern `unsafeIndex` (i,j) in-      [ []-      | i==j-      , overallBest == one-      ] ++ -- gives us the unfolded sequence-      [ r-      | i<j-      , r <- ext (i+1) j d-      ] ++-      [ r-      | i<j-      , ((k,l),ce) <- externalLoopIdx trnr inp strong i j-      , let dNew = ce `rmult` d `rmult` neg bestE-      , dNew <= one-      , r <- str k l d-      ] ++-      [ r++s-      | i<j-      , (k,ce) <- externalAddLoopIdx trnr inp strong extern i j-      , let dNew = ce `rmult` d `rmult` neg bestE-      , dNew <= one-      , r <- str i k d-      , s <- ext (k+1) j d ++ [[]] -- not 'd' but what 'str' leaves us with!, the [[]] only if the str-part alone works out-      ]-    str i j d = let bestE = strong `unsafeIndex` (i,j) in-      [ (i,j):r-      | i+2<j-      , ((k,l),ce) <- stackIdx trnr inp strong i j-      , let dNew = ce `rmult` d `rmult` neg bestE-      , dNew <= one-      , r <- str k l d-      ] ++-      [ (i,j):r-      | i+2<j-      , ((k,l),ce) <- stackIdx trnr inp weak   i j-      , let dNew = ce `rmult` d `rmult` neg bestE-      , dNew <= one-      , r <- wea k l d-      ]-    wea :: Int -> Int -> a -> [Pairlist]-    wea i j d = let bestE = weak `unsafeIndex` (i,j) in-      [ [(i,j)]-      | i+3<j-      , (ce :: Energy) <- hairpinIdx trnr inp i j -- needs to be qualified as we give no other table-      ]--}------ | (DEBUG) Print an array.--{--printArr arr = do-  --let (IT.IxTable (0,0) (_,n) _) = arr-  let n = snd $ snd $ bounds arr-  forM_ [0..n] $ \i -> do-    putStrLn ""-    forM [0..n] $ \j -> do-      if j>=i-        then do-          let v = arr `unsafeIndex` (i,j)-          if isZero v-            then printf "%5s" "_i_"-            else printf "%5i" (unEnergy $ arr `unsafeIndex` (i,j))-        else do-          putStr "     "-  putStrLn ""-  return ()--}
− BioInf/RNAFold/EnergyInt.hs
@@ -1,235 +0,0 @@-{-# LANGUAGE StandaloneDeriving #-}---- | Temporary hackery until all base libraries understand newtype Energy. And--- yes, for testing too.--module BioInf.RNAFold.EnergyInt-  ( FoldFunctions (..)-  , Fold (..)-  ) where--import Biobase.Types.Ring-import Biobase.RNA-import Biobase.Constants-import Biobase.Structure.DotBracket-import Biobase.Structure--import Data.PrimitiveArray--import BioInf.RNAFold-import BioInf.RNAFold.Functions---- for testing only-{--import Biobase.Vienna.Default-import Debug.Trace.Tools-import Data.List.Split-import Text.Printf-import Control.Monad-import Biobase.Turner.Tables--}---instance Ring Int where-  (.+.) = min-  (.*.) = (+)-  neg = negate-  one = 0-  zero = eInf-  isZero x = x>eMax-  n .^. k = n * k-  (.^^.) = error "write me"-  {-# INLINE (.+.) #-}-  {-# INLINE (.*.) #-}-  {-# INLINE neg #-}-  {-# INLINE one #-}-  {-# INLINE zero #-}-  {-# INLINE isZero #-}-  {-# INLINE (.^.) #-}--instance FoldFunctions Int where-  calcTermAU tAU p = if p/=vpCG && p/=vpGC then tAU else 0-  calcNinio maxNno nno l = min maxNno (nno * l)-  calcLargeLoop l = floor $ 108.856 * log (fromIntegral l / 30)-  {-# INLINE calcTermAU #-}-  {-# INLINE calcNinio #-}-  {-# INLINE calcLargeLoop #-}---- TODO detach backtrack so that all instances that use this kind of--- backtracking can immediately use it!--instance Fold Int where-  backtrack trnr inp (weak,strong,mbr1,mbr,extern) delta = filter ((<=0) . snd) $ map f $ ext 0 n delta where-    f (xs,z) = (Secondary (n+1) xs,optE+delta-z)-    n = snd $ bounds inp-    optE = extern!(0,n)-    newD d here next = d - (next - here)-    ---    -- All exterior loop decompositions-    ---    ext i j d = let ehere = extern!(i,j) in-      [ (x,z) -- shorter ext-      | i<j-      , let d' = newD d ehere (extern!(i+1,j))-      , d'>=0-      , (x,z) <- ext (i+1) j d'-      ] ++-      [ (x,z) -- loop at (i,j)-      | i<j-      , (_,enext) <- externalLoopIdx trnr inp strong i j -- _ = (i,j)-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- str i j d'-      ] ++-      [ (x++y,z)-      | i<j-      , (k,enext) <- externalAddLoopIdx trnr inp strong extern i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z') <- str i k d'-      , (y,z) <- ext (k+1) j z' ++ [([],z') | z'>=0 && extern!(k+1,j)==0]-      ]-    ---    -- A strong stem on top of strong of weak-    ---    str i j d = let ehere = strong!(i,j) in-      [ ((i,j):x,z)-      | i<j-      , (_,enext) <- stackIdx trnr inp strong i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- str (i+1) (j-1) d'-      ] ++-      [ ((i,j):x,z)-      | i<j-      , (_,enext) <- stackIdx trnr inp weak i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- wea (i+1) (j-1) d'-      ]-    wea i j d = let ehere = weak!(i,j) in-      ---      -- A hairpin closes at (i,j)-      ---      [ ([(i,j)],d')-      | i<j-      , enext <- hairpinIdx trnr inp i j-      , let d' = newD d ehere enext-      , d'>=0-      ] ++-      ---      -- interior loops-      ---      [ ((i,j):x,z)-      | i<j-      , ((k,l),enext) <- (-          largeInteriorLoopIdx trnr inp strong i j ++-          tabbedInteriorLoopIdx trnr inp strong i j ++-          bulgeLIdx trnr inp strong i j ++-          bulgeRIdx trnr inp strong i j ++-          interior1xnLIdx trnr inp strong i j ++-          interior1xnRIdx trnr inp strong i j-          )-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- str k l d'-      ] ++-      ---      -- multibranch loops closed at (i,j)-      ---      [ ((i,j):x++y,z)-      | i<j-      , (k,enext) <- multibranchCloseIdx trnr inp mbr mbr1 i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z') <- mul (i+1) k d'-      , (y,z) <- mul1 (k+1) (j-1) z' -- z' is what 'mul' left us-      ]-    mul i j d = let ehere = mbr!(i,j) in-      ---      -- unpaired nucleotide on the J side-      ---      [ (x,z)-      | i<j-      , ((k,l),enext) <- multibranchUnpairedJIdx trnr inp mbr i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- mul k l d'-      ] ++-      ---      -- a helix (k,j)-      ---      [ (x,z)-      | i<j-      , (k,enext) <- multibranchKJHelixIdx trnr inp strong i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- str k j d'-      ] ++-      ---      -- add a helix to an existing structure-      ---      [ (x++y,z)-      | i<j-      , (k,enext) <- multibranchAddKJHelixIdx trnr inp mbr strong i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z') <- mul i k d'-      , (y,z) <- str (k+1) j z'-      ]-    mul1 i j d = let ehere = mbr1!(i,j) in-      ---      -- Simply the strong part in a multibranch loop-      ---      [ (x,z)-      | i<j-      , (_,enext) <- multibranchIJLoopIdx trnr inp strong i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- str i j d'-      ] ++-      ---      -- unpaired nucleotide on the J side-      ---      [ (x,z)-      | i<j-      , ((k,l),enext) <- multibranchUnpairedJIdx trnr inp mbr1 i j-      , let d' = newD d ehere enext-      , d'>=0-      , (x,z) <- mul1 k l d'-      ]--{--test inp' k =-  let-    (_,n) = bounds inp-    bts = backtrack trnr inp tbls k-    inp = mkPrimary inp'-    trnr = fst turner2004GH-    tbls@(weak,strong,mbr1,mbr,extern) = fold trnr inp-    optE = extern ! (0,n)-    f x-      | x > 999 = "   x"-      | x < -999 = "-999"-      | otherwise = printf "%4d" x-    g t = do-            let ls = splitEvery (n+1) $ map f $ toList t-            putStr "    "-            mapM_ (printf "%4d") [0 :: Int .. (length $ head ls) -1]-            putStrLn ""-            zipWithM_ (\k xs -> printf "%4d" k >> mapM_ putStr xs >> putStrLn"") [0 :: Int ..] ls-  in do-      print "weak"-      g weak-      print "strong"-      g strong-      print "mbr   L"-      g mbr-      print "mbr1  R"-      g mbr1-      print "extern"-      g extern-      print optE-      putStrLn inp'-      mapM_ (\(s,e) -> (putStr $ dotbracket s) >> (putStrLn $ " " ++ show e)) bts--}
− BioInf/RNAFold/Functions.hs
@@ -1,575 +0,0 @@-{-# LANGUAGE PatternGuards #-}-{-# LANGUAGE BangPatterns #-}-{-# LANGUAGE RecordWildCards #-}---- | These functions are implementations of RNA secondary structure folding as--- described in "Bompfuenewere et al., 2006, Variations on RNA folding and--- alignment"------ We have all the facilities needed for folding with the RNA parameter of--- Turner 2004 http://rna.urmc.rochester.edu/NNDB/turner04/ but consider only--- "double dangles" which correspond to the ViennaRNA package option "-d2".--- They are a bit easier to implement and are what is used for partition--- function calculations. In addition, it seems unlikely to see a statiscally--- relevant improvement in predication with "-d1" or "-d3".------ All functions work on an algebraic ring structure. This should make it--- easier to implement certain functionality without having to rewrite all the--- functions given here. Try deriving a new 'Ring' instance first and see if it--- /just works/.------ These functions do quite well, performancewise. GHC-HEAD with "-Odph" and--- "-fllvm" takes 14.4s, while the highly optimized viennaRNA package (the yet--- unpublished 2.0 version) takes about 1-2s on a sequence of length 1000.------ NOTE For GHC <= 6.12.3 you should copy the default instances into your--- instance BLA, otherwise the resulting code will be slow. Or you could just--- wait for the new GHC to arrive! The new one produces good code without such--- stuff.------ TODO single nucleotide bulges:--- http://rna.urmc.rochester.edu/NNDB/turner04/bulge.html , check what Vienna--- 2.0 does!--module BioInf.RNAFold.Functions-  ( FoldFunctions (..)-  , Table-  , TurnerTables-  , ringSumL-  , pair-  , riap-  , ringProductL-  , tabbedInteriorLoopDistances-  ) where--import qualified Data.Vector.Unboxed as VU-import Control.Exception (assert)-import Data.List (foldl')-import qualified Data.Map as M--import Biobase.RNA-import Biobase.Turner.Tables-import Biobase.Types.Ring-import Biobase.Vienna-import Data.PrimitiveArray-import Data.Primitive.Types--import Debug.Trace.Tools--type Cell = (Int,Int)-type Table a = PrimArray Cell a-type TurnerTables a = Turner2004 ViennaPair Nucleotide a------ | The folding functions. It could happen that we need different folding--- functions with the same type, hence the class-based approach. The default--- instance uses the usual ring methods.--class (Show a, Ring a, VU.Unbox a, Prim a) => FoldFunctions a where--  stackOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  stackIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  hairpinOpt  :: TurnerTables a -> Primary -> Int -> Int -> a-  hairpinIdx  :: TurnerTables a -> Primary -> Int -> Int -> [a]--  largeInteriorLoopOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  largeInteriorLoopIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  tabbedInteriorLoopOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  tabbedInteriorLoopIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  bulgeLOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  bulgeLIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  bulgeROpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  bulgeRIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  interior1xnLOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  interior1xnLIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  interior1xnROpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  interior1xnRIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  multibranchIJLoopOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  multibranchIJLoopIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  multibranchUnpairedJOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  multibranchUnpairedJIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  multibranchKJHelixOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  multibranchKJHelixIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Int,a)]--  multibranchAddKJHelixOpt  :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> a-  multibranchAddKJHelixIdx  :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> [(Int,a)]--  multibranchCloseOpt  :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> a-  multibranchCloseIdx  :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> [(Int,a)]--  externalLoopOpt  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a-  externalLoopIdx  :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]--  externalAddLoopOpt  :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> a-  externalAddLoopIdx  :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> [(Int,a)] -- return only 'k' index--  -- | Calculate the ninio asymmetric malus. Can not be written using ring-  -- functions alone as a 'min' or 'max' functions is required.--  calcNinio :: a -> a -> Int -> a--  -- | Applies a terminal AU/GU penalty, where required.-  ---  -- TODO shouldn't this be just: if CG||GC then one else termAU?--  calcTermAU :: a -> ViennaPair -> a -- ^ Apply terminal AU penalty--  -- | large hairpin loops >30 require special calculations that involve-  -- 'floor', rounding and other stuff that can not be handled by the Ring-  -- class alone--  calcLargeLoop :: Int -> a--  -- NOTE Copy these functions into your own instance. In most cases, your are-  -- now done and get optimized loops. Each function that you do not copy uses-  -- the version here. This can lead to less efficient code.-  ---  -- NOTE Fixed in GHC 6.13. The default instances should yield superb code!--  stackOpt trnr inp tbl i j =-    VU.foldl' (.+.) zero $ stackBase trnr inp tbl i j-  hairpinOpt trnr inp i j =-    VU.foldl' (.+.) zero $ hairpinBase trnr inp i j-  largeInteriorLoopOpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ largeInteriorLoopBase trnr inp strong i j-  tabbedInteriorLoopOpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ tabbedInteriorLoopBase trnr inp strong i j-  bulgeLOpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ bulgeLBase trnr inp strong i j-  bulgeROpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ bulgeRBase trnr inp strong i j-  interior1xnLOpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ interior1xnLBase trnr inp strong i j-  interior1xnROpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ interior1xnRBase trnr inp strong i j-  multibranchIJLoopOpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ multibranchIJLoopBase trnr inp strong i j-  multibranchUnpairedJOpt trnr inp mtable i j =-    VU.foldl' (.+.) zero $ multibranchUnpairedJBase trnr inp mtable i j-  multibranchKJHelixOpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ multibranchKJHelixBase trnr inp strong i j-  multibranchAddKJHelixOpt trnr inp table strong i j =-    VU.foldl' (.+.) zero $ multibranchAddKJHelixBase trnr inp table strong i j-  multibranchCloseOpt trnr inp m m1 i j =-    VU.foldl' (.+.) zero $ multibranchCloseBase trnr inp m m1 i j-  externalLoopOpt trnr inp strong i j =-    VU.foldl' (.+.) zero $ externalLoopBase trnr inp strong i j-  externalAddLoopOpt trnr inp strong extern i j =-    VU.foldl' (.+.) zero $ externalAddLoopBase trnr inp strong extern i j--  -- NOTE copy and instanciate these functions if you have to work with many-  -- candidate sequences. Otherwise you probably do not need the speed-up from-  -- these functions. This stuff is for backtracking  mostly as you get lists-  -- of indices with attached scores.-  ---  -- NOTE With GHC 6.13 we should get optimized code anyways!--  stackIdx trnr inp tbl i j =-    [((i+1,j-1),stackOpt trnr inp tbl i j)]-  hairpinIdx trnr inp i j =-    VU.toList $ hairpinBase trnr inp i j-  largeInteriorLoopIdx trnr inp strong i j =-    VU.toList $ VU.zip (interiorLoopIndices i j) (largeInteriorLoopBase trnr inp strong i j)-  tabbedInteriorLoopIdx trnr inp strong i j =-    VU.toList $ VU.zip (tabbedInteriorLoopIndices i j) $ tabbedInteriorLoopBase trnr inp strong i j-  bulgeLIdx trnr inp strong i j =-    VU.toList $ VU.zip (VU.map (\k -> (i+1+k,j-1)) . uncurry VU.enumFromN $ bulgeLimit i j) $ bulgeLBase trnr inp strong i j-  bulgeRIdx trnr inp strong i j =-    VU.toList $ VU.zip (VU.map (\k -> (i+1,j-1-k)) . uncurry VU.enumFromN $ bulgeLimit i j) $ bulgeRBase trnr inp strong i j-  interior1xnLIdx trnr inp strong i j =-    VU.toList $ VU.zip (VU.map (\k -> (i+1+k,j-2)) $ uncurry VU.enumFromN $ iloop1xnLimit i j) $ interior1xnLBase trnr inp strong i j-  interior1xnRIdx trnr inp strong i j =-    VU.toList $ VU.zip (VU.map (\k -> (i+2,j-1-k)) $ uncurry VU.enumFromN $ iloop1xnLimit i j) $ interior1xnRBase trnr inp strong i j-  multibranchIJLoopIdx trnr inp strong i j =-    VU.toList $ VU.zip (VU.singleton (i,j)) $ multibranchIJLoopBase trnr inp strong i j-  multibranchUnpairedJIdx trnr inp mtable i j =-    VU.toList $ VU.zip (VU.singleton (i,j-1)) $ multibranchUnpairedJBase trnr inp mtable i j-  multibranchKJHelixIdx trnr inp strong i j =-    VU.toList $ VU.zip (uncurry VU.enumFromN $ multibranchKJHelixLimit i j) $ multibranchKJHelixBase trnr inp strong i j-  multibranchCloseIdx trnr inp m m1 i j = -- TODO this is wrong!-    VU.toList $ VU.zip (uncurry VU.enumFromN $ multibranchCloseLimit i j) $ multibranchCloseBase trnr inp m m1 i j-  multibranchAddKJHelixIdx trnr inp table strong i j =-    VU.toList $ VU.zip (uncurry VU.enumFromN $ multibranchAddKJHelixLimit i j) $ multibranchAddKJHelixBase trnr inp table strong i j-  externalLoopIdx trnr inp strong i j =-    VU.toList $ VU.singleton ((i,j), externalLoopOpt trnr inp strong i j)-  externalAddLoopIdx trnr inp strong extern i j =-    VU.toList $ VU.zip (uncurry VU.enumFromN $ externalAddLoopLimit i j) $ externalAddLoopBase trnr inp strong extern i j------ * We provide a default instance working on rings.---- | Simple hairpin loops. If (i,j) pairs then, first, try to do a lookup of--- the exact sequence of the hairpin in a tabulated list. If this fails then,--- second, try length 3 hairpins and so on.--hairpinBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Int -> Int -> VU.Vector a-hairpinBase Turner2004{..} inp i j = VU.singleton go where-  go-    | pIJ==vpNP || l<3 = zero-    | l<=6, Just v <- s `M.lookup` hairpinLookup = v-    | l==3      = (hairpinL ! l) -- .*. tAU -- apparantly not anymore according to NNDB-    | l>=31     = (hairpinL ! 30) .*. (hairpinMM ! (pIJ,bI,bJ)) .*. (calcLargeLoop l)-    | otherwise = {-traceVal (show (i,j,pIJ,bI,bJ,hairpinL!l,tAU,hairpinMM!(pIJ,bI,bJ))) $ -} (hairpinL ! l) .*. (hairpinMM ! (pIJ,bI,bJ))-  l = j-i-1-  s = assert (i>=0 && checkBounds inp j) $ [inp ! k | k <- [i..j-1]]-  bI = inp ! (i+1)-  bJ = inp ! (j-1)-  pIJ = pair inp i j-  tAU = calcTermAU termAU pIJ-{-# INLINE hairpinBase #-}---- | Extend a stem by another pair.--stackBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-stackBase Turner2004{..} inp tbl i j = VU.singleton $ go (i+1,j-1) where-  pIJ = pair inp i j-  go (k,l)-    | pIJ==vpNP || pKL==vpNP || isZero tE-    = zero-    | otherwise-    = tE .*. ( stack ! (pIJ,pKL))-    where-      pKL = riap inp k l-      tE  = tbl ! (k,l)-{-# INLINE stackBase #-}---- | These are special cases of interior loops. Short iloops, such as 1x2 loops--- are completely tabulated. Look each one up here.------ TODO needs 1-bulges as a special case--tabbedInteriorLoopBase :: (Show a, FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-tabbedInteriorLoopBase Turner2004{..} inp strong i j = res where-  res = VU.map (\(k,l) -> (strong ! (k,l)) .*. (ftabbed (k-i-1,j-l-1) (k,l))) ili-  ili = tabbedInteriorLoopIndices i j-  ftabbed (di,dj) (k,l)-    | ds==0 && dl==1 = bulgeL!1 .*. stack!(pIJ,pKL) -- no termAU, since the helical stack continues (nndb)-    | ds==1 && dl==1 = iloop1x1 ! (pIJ,pKL,bI,bJ)-    | di==1 && dj==2 = iloop1x2 ! (pIJ,pKL,bI,bL,bJ)-    | di==2 && dj==1 = iloop1x2 ! (pIJ,pKL,bJ,bI,bK)-    | ds==2 && dl==2 = iloop2x2 ! (pIJ,pKL,bI,bK,bL,bJ)-    | ds==2 && dl==3 = iloop2x3MM!(pIJ,bI,bJ) .*. iloop2x3MM ! (pKL,bL,bK) .*. iloopL ! 5 .*. ninio-    where-      pKL = riap inp k l-      bK  = inp ! (k-1)-      bL  = inp ! (l+1)-      ds  = min di dj-      dl  = max di dj-  pIJ = pair inp i j-  bI  = inp ! (i+1)-  bJ  = inp ! (j-1)-{-# INLINE tabbedInteriorLoopBase #-}---- | A large number of iloops up to a total maximum loop size of 30 have to be--- checked. There are about 300 cases for j-i>>30. In addition, this loop does--- not like fusion very much and does many different lookups.------ TODO Any performance increase here should yield substantial improvements for--- the overall performance of folding algorithms.------ TODO performance improvement: Split mismatch calculation into its own table--- in the caller. Callee gets an additional argument.------ TODO didjs needs to go back into a *Limit function.--largeInteriorLoopBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-largeInteriorLoopBase Turner2004{..} inp strong i j = res where-  res = VU.map (\(di,dj) ->-                    ijmm .*.-                    (strong ! (i+di,j-dj)) .*.-                    (iloopL ! (di+dj-2)) .*. -- -2 because di,dj is total IL length +2-                    (iloopMM ! (riap inp (i+di) (j-dj), inp ! (i+di-1), inp ! (j-dj+1))) .*.-                    calcNinio maxNinio ninio (abs $ di-dj)-                ) didjs-  -- NOTE NO FUSION! :-(-  -- TODO check this!-  didjs = interiorLoopDistances i j-  {--  didjs = traceVal (show (i,j)) $ VU.unfoldr (\(di,dj) ->-                        if di>maxc-                          then Nothing-                          else if di+dj>=nexc-                                then Just ((di,dj),(di+1,3   ))-                                else Just ((di,dj),(di  ,dj+1))-                      ) (3,5)  -}-  -- constant-  {--  maxc = min 27 (j-i-16)-  nexc = min 30 (j-i-13)-  -}-  ijmm = iloopMM ! (pIJ,bI,bJ)-  pIJ  = pair inp i j-  bI   = inp ! (i+1)-  bJ   = inp ! (j-1)-{-# INLINE largeInteriorLoopBase #-}---- | A bulge on the left side of the inner closing pair. 1-bulges are treated--- as tabulated interior loops.------ (..((...)))--- 01234567890--bulgeLBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-bulgeLBase Turner2004{..} inp strong i j = res where-  res = VU.map (\k ->-                  strong ! (i+1+k,j-1) .*.-                  bulgeL ! k .*.-                  calcTermAU termAU (riap inp (i+1+k) (j-1)) .*.-                  tAUij-                ) . uncurry VU.enumFromN $ bulgeLimit i j-  tAUij = calcTermAU termAU $ pair inp i j-{-# INLINE bulgeLBase #-}---- | A bulge on the right side of the inner closing pair. Mirroring bulgeLBase------ ((~)...)--bulgeRBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-bulgeRBase Turner2004{..} inp strong i j = res where-  res = VU.map (\k ->-                  strong ! (i+1,j-1-k) .*.-                  bulgeL ! k .*.-                  calcTermAU termAU (riap inp (i+1) (j-1-k)) .*.-                  tAUij-                ) . uncurry VU.enumFromN $ bulgeLimit i j-  tAUij  = calcTermAU termAU $ pair inp i j-{-# INLINE bulgeRBase #-}---- | 1xn iloops work a bit like bulges. They are more complicated because we--- have to consider 'ninio' values and terminal mismatches.------ TODO how big an improvement would 'iloopL1xn' be with integrated 'ninio'--- values?------ (...(~).)--interior1xnLBase Turner2004{..} inp strong i j = res where-  res = VU.map (\k ->-                  strong ! (i+1+k,j-2) .*.-                  iloopL ! (k+1) .*.-                  iloop1xnMM ! (riap inp (i+1+k) (j-2), inp ! (i+k), inp ! (j-1)) .*.-                  calcNinio maxNinio ninio (k-1) .*.-                  pIJmm-                ) . uncurry VU.enumFromN $ iloop1xnLimit i j-  pIJmm = iloop1xnMM ! (pair inp i j, inp ! (i+1), inp ! (j-1))-{-# INLINE interior1xnLBase #-}---- | A mirror to the above.------ (.(~)...)--interior1xnRBase Turner2004{..} inp strong i j = res where-  res = VU.map (\k ->-                  strong ! (i+2,j-1-k) .*.-                  iloopL ! (k+1) .*.-                  iloop1xnMM ! (riap inp (i+2) (j-1-k), inp ! (j-k), inp ! (i+1)) .*.-                  calcNinio maxNinio ninio (k-1) .*.-                  pIJmm-                ) . uncurry VU.enumFromN $ iloop1xnLimit i j-  pIJmm = iloop1xnMM ! (pair inp i j, inp ! (i+1), inp ! (j-1))-{-# INLINE interior1xnRBase #-}---- | Close a multibranch loop by trying to combine one element of 'm' with one--- of 'm1'.------ <[[...]][[...]]>--- 0123456789012345---           1--multibranchCloseBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> VU.Vector a-multibranchCloseBase Turner2004{..} inp m m1 i j = res where-  res = VU.map (\k ->-                  m ! (i+1,k) .*.-                  m1 ! (k+1,j-1) .*.-                  ijmm .*.-                  mbcl-                ) . uncurry VU.enumFromN $ multibranchCloseLimit i j-  ijmm =  multiMM ! (pIJ,bJ,bI)-  mbcl =  multiOffset .*. multiHelix-  pIJ  = riap inp i j-  bI   = inp ! (i+1)-  bJ   = inp ! (j-1)-{-# INLINE multibranchCloseBase #-}---- | Adds a multibranch loop at exactly (i,j).--multibranchIJLoopBase Turner2004{..} inp strong i j = res where-  res = VU.singleton $ strong ! (i,j) .*. mbrhlx .*. mbrmm-  mbrhlx = multiHelix-  mbrmm  =  multiMM ! (pIJ,bI,bJ) -- TODO correct orientation?-  pIJ    = pair inp i j-  bI     = inp ! (i-1)-  bJ     = inp ! (j+1)-{-# INLINE multibranchIJLoopBase #-}---- | Trivial function that adds a single unpaired nucleotide within a--- multibranch loop.--multibranchUnpairedJBase Turner2004{..} inp mtable i j = res where-  res = VU.singleton $ mtable ! (i,j-1) .*. mbrup-  mbrup = multiNuc-{-# INLINE multibranchUnpairedJBase #-}---- | Adds a multibranch loop at (k,j), with k-i unpaired nucleotides to the--- left of 'k'.--multibranchKJHelixBase  :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-multibranchKJHelixBase Turner2004{..} inp strong i j = res where-  res = VU.map (\k ->-          multiNuc .^. (k-i) .*.-          strong ! (k,j) .*.-          multiHelix .*.-          multiMM ! (pair inp k j, inp ! (k-1), inp ! (j+1))-        ) . uncurry VU.enumFromN $ multibranchKJHelixLimit i j-{-# INLINE multibranchKJHelixBase #-}---- |--multibranchAddKJHelixBase Turner2004{..} inp table strong i j = res where-  res = VU.map (\k ->-                  table ! (i,k) .*.-                  strong ! (k+1,j) .*.-                  multiMM ! (pair inp (k+1) j, inp ! k, inp ! (j+1))-                ) . uncurry VU.enumFromN $ multibranchAddKJHelixLimit i j-{-# INLINE multibranchAddKJHelixBase #-}---- | [[...]]---   0123456--externalLoopBase Turner2004{..} inp strong i j = res where-  res = VU.singleton $ strong ! (i,j) .*. mm .*. tAU-  n = snd $ bounds inp-  pIJ = pair inp i j-  bI = inp ! (i-1)-  bJ = inp ! (j+1)-  tAU = calcTermAU termAU pIJ-  mm-    | i>0&&j<n  = extMM ! (pIJ,bI,bJ)-    | i>0       = dangle5 ! (pIJ,bI)-    | j<n       = dangle3 ! (pIJ,bJ)-    | otherwise = one-{-# INLINE externalLoopBase #-}---- |--externalAddLoopBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> VU.Vector a-externalAddLoopBase trnr@Turner2004{..} inp strong extern i j = res where-  res = VU.map (\k ->-                  externalLoopOpt trnr inp strong i k .*.-                  extern ! (k+1,j)-                ) . uncurry VU.enumFromN $ externalAddLoopLimit i j-{-# INLINE externalAddLoopBase #-}------ * Helper Functions.---- TODO We definitely need to check that this works!--pair :: Primary -> Int -> Int -> ViennaPair-pair inp i j-  = assert (checkBounds inp i && checkBounds inp j)-  $ toPair (inp `unsafeIndex` i) (inp `unsafeIndex` j)-{-# INLINE pair #-}--riap inp i j-  = assert (i>=0 && j>=0 && checkBounds inp i && checkBounds inp j)-  $ toPair (inp ! j) (inp ! i)-{-# INLINE riap #-}--ringSum :: (Ring a, VU.Unbox a) => VU.Vector a -> a-ringSum v = VU.foldl' (.+.) zero v-{- INLINE ringSum #-}--ringSumL :: (Ring a, VU.Unbox a) => [a] -> a-ringSumL v = foldl' (.+.) zero v-{-# INLINE ringSumL #-}--ringProduct :: (Ring a, VU.Unbox a) => VU.Vector a -> a-ringProduct v = VU.foldl' (.*.) one v-{-# INLINE ringProduct #-}--ringProductL :: (Ring a, VU.Unbox a) => [a] -> a-ringProductL v = foldl' (.*.) one v---- | Explicit index generator for interior loops. Does not create indices for:--- - bulges     0 k--- - 1xn loops  1 k--- - 2x3 loops  2 3, 3 2--- - tabulated  1 1, 1 2, 2 1, 2 2--interiorLoopDistances i j =-  VU.concatMap (-    \d -> VU.map (\d' -> (d',d-d'))  -- written as a tuple-          $ VU.enumFromN 3 (d-5))    -- for each distance, all possible left/right combinations-  $ VU.enumFromN 8 (min 23 (j-i-13)) -- diagonal distance or number of unpaired nucleotides -2.-{-# INLINE interiorLoopDistances #-}---- WTF ?! the function below is 10.000x slower than the function above!--interiorLoopIndices :: Int -> Int -> VU.Vector (Int,Int)-interiorLoopIndices !i !j = VU.map (\(k,l) -> (i+k,j-l)) $ interiorLoopDistances i j-{-# INLINE interiorLoopIndices #-}------- TODO filter 'ili' to accept only indices that are not too close. Does--tabbedInteriorLoopDistances :: Int -> Int -> VU.Vector (Int,Int)-tabbedInteriorLoopDistances i j-  | j-i>=8    = VU.fromList [(0,1),(1,0),(1,1),(1,2),(2,1),(2,2),(2,3),(3,2)]-  | otherwise = VU.empty-{-# INLINE tabbedInteriorLoopDistances #-}---- | Yes, therer is the (+1,+1) and yes, this is inconsistent with the other function--tabbedInteriorLoopIndices i j = VU.map (\(di,dj) -> (i+di+1,j-dj-1)) $ tabbedInteriorLoopDistances i j-{-# INLINE tabbedInteriorLoopIndices #-}---- * All limits depending on (i,j) should be here.---- | Bulge limitations--bulgeLimit :: Int -> Int -> (Int,Int)-bulgeLimit i j = (2,min 29 $ j-i-9)-{-# INLINE bulgeLimit #-}---- | 1xn iloop limits--iloop1xnLimit :: Int -> Int -> (Int,Int)-iloop1xnLimit i j = (3,min 26 $ j-i-10)-{-# INLINE iloop1xnLimit #-}---- | closing of a multibranch loop--multibranchCloseLimit :: Int -> Int -> (Int,Int)-multibranchCloseLimit i j = (i+1,j-i-2) -- (i+7, j-i-14)-{-# INLINE multibranchCloseLimit #-}---- | add mb helix--multibranchAddKJHelixLimit :: Int -> Int -> (Int,Int)-multibranchAddKJHelixLimit i j = (i+1,j-i-1)-{-# INLINE multibranchAddKJHelixLimit #-}---- | mb helix--multibranchKJHelixLimit :: Int -> Int -> (Int,Int)-multibranchKJHelixLimit i j = (i,j-i)-{-# INLINE multibranchKJHelixLimit #-}---- | add external loop--externalAddLoopLimit :: Int -> Int -> (Int,Int)-externalAddLoopLimit i j = (i+5,j-i-5)-{-# INLINE externalAddLoopLimit #-}
+ BioInf/RNAfold.hs view
@@ -0,0 +1,335 @@+{-# LANGUAGE BangPatterns #-}+{-# LANGUAGE TypeOperators #-}+{-# LANGUAGE TupleSections #-}+{-# LANGUAGE NoMonomorphismRestriction #-}+{-# LANGUAGE RecordWildCards #-}++module BioInf.RNAfold where++import Control.Monad+import Control.Monad.Primitive+import Control.Monad.ST+import Data.Array.Repa.Index+import qualified Data.Vector.Fusion.Stream.Monadic as S+import qualified Data.Vector.Fusion.Stream as P+import qualified Data.Vector.Unboxed as VU+import Control.Monad.State.Lazy+import Control.Arrow (first,second,(***))+import qualified Data.List as L+import Control.Exception (assert)+import Data.Strict.Tuple hiding (fst,snd)++import Biobase.Primary+import Biobase.Secondary.Vienna++import Data.PrimitiveArray+import Data.PrimitiveArray.Unboxed.Zero++import ADP.Fusion.Monadic+import ADP.Fusion.Monadic.Internal++import Debug.Trace+import Text.Printf+import GHC.Exts++import Biobase.Primary+import Biobase.Secondary.Vienna+import Biobase.Vienna+import Biobase.Vienna.Default++import BioInf.RNAfold.Combinators+import BioInf.RNAfold.Energy+import BioInf.RNAfold.Library++++-- |++testRNAfold :: String -> (Int,[String])+testRNAfold inp' = struct `seq` bt `seq` (struct!(Z:.0:.n),bt) where+  (_,Z:._:.n) = bounds struct+  ener = fst turnerRNA2004+  inp = mkPrimary inp'+  tbls@(weak,block,comps,struct) = runST (rnafold ener inp)+  bt = btRNAfold ener inp tbls+{-# NOINLINE testRNAfold #-}++-- |+testInput = "cccacccaaagggaaaaggg"+test = testRNAfold testInput++rnafold :: Vienna2004 -> Primary -> ST s+  ( Arr0 DIM2 Int+  , Arr0 DIM2 Int+  , Arr0 DIM2 Int+  , Arr0 DIM2 Int+  )+rnafold ener inp = do++  let !n = let (_,Z:.l) = bounds inp in l+1+  let base   = base'   inp+      {-# INLINE base #-}+  let baseLr = baseLr' inp+      {-# INLINE baseLr #-}+  let baselR = baselR' inp+      {-# INLINE baselR #-}+  let basepairing = basepairing' inp+      {-# INLINE basepairing #-}+  let stackpairing = stackpairing' inp+      {-# INLINE stackpairing #-}+  let reglen = reglen' inp+      {-# INLINE reglen #-}+  let primary = primary' inp+      {-# INLINE primary #-}+  let primaryPR = primaryPR' inp+      {-# INLINE primaryPR #-}+  let primaryPL = primaryPL' inp+      {-# INLINE primaryPL #-}+  -- this is a bit unfortunate, but otherwise we get type inference problems+  let hS :: S.Stream (ST s) Int -> ScalarM (ST s Int)+      hS = ScalarM . S.foldl' min (999999::Int)+      {-# INLINE hS #-}++  weak   <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 999999 []+  block  <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 999999 []+  comps  <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 999999 []+  struct <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 0 []++  fillTables+    weak (+      multiOF   ener <<< baseLr -~+ (multiIF ener <<< block +~+ comps              ... hS) +~- baselR |||+      iloopOF   ener <<< baseLr -~+ (iloopIF ener <<< primary #~~ weak ~~# primary ... hS) +~- baselR |||+      iloop1NF  ener <<< primary ---~+ weak +~@   primary   |||+      iloopN1F  ener <<< primary   @~+ weak +~--- primary   |||+      bulgeRF   ener <<< baseLr    -~+ weak +~*   primary   |||+      bulgeLF   ener <<< primary   *~+ weak +~-   baselR    |||+      tinyloopF ener <<< primaryPR &~+ weak +~&   primaryPL |||+      hairpinF  ener <<< baseLr -~+ primary +~- baselR ... h `with` basepairing )+    block (+      adjustStream n (justStemF ener <<< baseLr -~+ weak +~- baselR) |||+      regionStemF ener <<< base -~+ block             ... h )+    comps (+      bsF <<< block +~+ reglen |||+      bcF <<< block +~+ comps  |||+      iD  <<< block            ... h )+    struct (+      iD   <<< weak            |||+      rSF  <<< base -~~ struct |||+      cmF  <<< weak +~+ struct |||+      nilF <<< empty           ... h `with` constrained (\(Z:.i:.j) -> j==n) )++  weak'   <- freeze weak+  block'  <- freeze block+  comps'  <- freeze comps+  struct' <- freeze struct++  return+    ( weak'+    , block'+    , comps'+    , struct'+    )+{-# INLINE rnafold #-}++infixl 9 *~+, +~*, &~+, +~&, ---~+, +~@, +~---, @~+++(*~+) = makeLeft_MinRight (3,31) 1+{-# INLINE (*~+) #-}++(+~*) = makeMinLeft_Right 1 (3,31)+{-# INLINE (+~*) #-}++(&~+) = makeLeft_MinRight (1,4) 1+{-# INLINE (&~+) #-}++(+~&) = makeMinLeft_Right 1 (1,4)+{-# INLINE (+~&) #-}++(---~+) = makeLeft_MinRight (3,3) 1+{-# INLINE (---~+) #-}++(+~@) = makeMinLeft_Right 1 (5,31)+{-# INLINE (+~@) #-}++(+~---) = makeMinLeft_Right 1 (3,3)+{-# INLINE (+~---) #-}++(@~+) = makeLeft_MinRight (5,31) 1+{-# INLINE (@~+) #-}++-- * backtracking+--+-- For now, we replicate the grammar as the optimizer is rather fragile++btRNAfold+  :: Vienna2004+  -> Primary+  -> (Arr0 DIM2 Int, Arr0 DIM2 Int, Arr0 DIM2 Int, Arr0 DIM2 Int)+  -> [String]+btRNAfold ener inp (weak,block,comps,struct) = structG (Z:.0:.n) where++  !n = let (_,Z:.l) = bounds inp in l+1+  base   = base'   inp+  baseLr = baseLr' inp+  baselR = baselR' inp+  reglen = reglen' inp+  basepairing = basepairing' inp+  primary = primary' inp+  primaryPR = primaryPR' inp+  primaryPL = primaryPL' inp++  --++  weak' :: DIM2 -> Scalar (Int, [String])+  weak' ij = Scalar (weak!ij, weakG ij)++  block' :: DIM2 -> Scalar (Int, [String])+  block' ij = Scalar (block!ij, blockG ij)++  comps' :: DIM2 -> Scalar (Int, [String])+  comps' ij = Scalar (comps!ij, compsG ij)++  struct' :: DIM2 -> Scalar (Int, [String])+  struct' ij = Scalar (struct!ij, structG ij)++  --++  weakG :: DIM2 -> [String]+  weakG = (+            multiBT ener    <<< baseLr -~+ block'  +~+ comps' +~- baselR             |||+            iloopBT ener    <<< baseLr -~+ primary #~~ weak'  ~~# primary +~- baselR |||+            iloop1NBT ener  <<< primary ---~+ weak'   +~@   primary |||+            iloopN1BT ener  <<< primary @~+   weak'   +~--- primary |||+            bulgeRBT ener   <<< baseLr  -~+   weak'   +~*   primary |||+            bulgeLBT ener   <<< primary *~+   weak'   +~-   baselR  |||+            tinyloopBT ener <<< primaryPR &~+   weak'   +~&   primaryPL |||+            hairpinBT  ener <<< baseLr  -~+   primary +~-   baselR  ..@ (hBT weak) `withBT` basepairing+          )++  blockG :: DIM2 -> [String]+  blockG = (+             adjustStreamBT n (justStemBT   ener <<< baseLr -~+ weak'  +~- baselR) |||+             regionStemBT ener <<< base   -~+  block'             ..@ (hBT block)+           )++  compsG :: DIM2 -> [String]+  compsG = (+             bsBT <<< block' +~+ reglen |||+             bcBT <<< block' +~+ comps' |||+             iDBT <<< block'            ..@ (hBT comps)+           )++  structG :: DIM2 -> [String]+  structG = (+              iDBT  <<< weak'             |||+              rSBT  <<< base  -~~ struct' |||+              cmBT  <<< weak' +~+ struct' |||+              nilBT <<< empty             ..@ (hBT struct `withBT` constrained (\(Z:.i:.j) -> j==n) )+            )++  multiBT ener l (b,bS) (c,cS) r =+    let e = multiOF ener l (multiIF ener b c) r+    in (e, ["("++x++y++")" | x<-bS, y<-cS])+  iloopBT ener lo ls@(_:!:li:!:lj) (w,wS) rs@(_:!:ri:!:rj) ro =+    let e = iloopOF ener lo (iloopIF ener ls w rs) ro+    in (e, L.map (\s -> "("++replicate (lj-li) '.'++"("++s++")"++replicate (rj-ri) '.'++")") wS)+  iloop1NBT ener ls (w,wS) rs@(_:!:ri:!:rj) =+    let e = iloop1NF ener ls w rs+    in (e, L.map (\s -> "(.("++s++")"++replicate (rj-ri-1) '.'++")") wS)+  iloopN1BT ener ls@(_:!:li:!:lj) (w,wS) rs =+    let e = iloopN1F ener ls w rs+    in (e, L.map (\s -> "("++replicate (lj-li-1) '.'++"("++s++").)") wS)+  bulgeRBT ener ls (w,wS) rs@(_:!:ri:!:rj) =+    let e = bulgeRF ener ls w rs+    in (e, L.map (\s -> "("++s++"."++replicate (rj-ri-1) '.'++")") wS)+  bulgeLBT ener ls@(_:!:li:!:lj) (w,wS) rs =+    let e = bulgeLF ener ls w rs+    in (e, L.map (\s -> "("++replicate (lj-li-1) '.'++"."++s++")") wS)+  hairpinBT ener llp reg@(xs:!:i:!:j) rpr =+    let e = hairpinF ener llp reg rpr+    in (e, ["(" ++ replicate (j-i+1) '.' ++ ")"])+  tinyloopBT ener ls@(_:!:li:!:lj) (w,sW) rs@(_:!:ri:!:rj) =+    let e = tinyloopF ener ls w rs+    in (e, L.map (\s -> "("++replicate (lj-li-1) '.'++s++replicate (rj-ri-1) '.'++")") sW)++  regionStemBT ener nc (w,sW) =+    let e = regionStemF ener nc w+    in (e, L.map (\s -> "." ++ s) sW)+  justStemBT ener llp (w,sW) rpr =+    let e = justStemF ener llp w rpr+    in (e, sW)++  bcBT (b,bW) (c,cW) =+    let e = b+c+    in (e,[ x++y | x<-bW, y<-cW ])+  bsBT (b,bW) reg = (b, L.map (++ replicate reg '.') bW)+  iDBT = id++  ssBT len = (ssF len, [replicate len '.'])+  rSBT n (w,wS) =+    let e = rSF n w+    in (e, map ("."++) wS)+  cmBT (w,wS) (s,sS) =+    let e = cmF w s+    in (e, [x++y | x<-wS, y<-sS])+  nilBT b = if b then (nilF b, [""]) else (nilF b, [])++  hBT tbl ij = L.concatMap snd . L.filter ((tbl!ij==).fst) . P.toList+++-- * different energy functions (very simplified signature)++++-- * Functions that will be part of a bioinformatics DP library++++-- **++adjustStream :: Int -> (DIM2 -> S.Stream (ST s) Int) -> DIM2 -> S.Stream (ST s) Int+adjustStream !n sgen (Z:.i:.j)+  | i>0 && j<n = sgen (Z:.i-1:.j+1)+  | otherwise  = S.empty+{-# INLINE adjustStream #-}++adjustStreamBT :: Int -> (DIM2 -> P.Stream elm) -> DIM2 -> P.Stream elm+adjustStreamBT !n sgen (Z:.i:.j)+  | i>0 && j<n = sgen (Z:.i-1:.j+1)+  | otherwise  = P.empty+{-# INLINE adjustStreamBT #-}++infixl 6 .!.+(.!.) stream (h,n) (Z:.i:.j)+  | i>0 && j<n = h $ stream (Z:.i-1:.j+1)+  | otherwise  = h $ S.empty+{-# INLINE (.!.) #-}++-- |++infixl 5 `with`+with xs cond ij = if cond ij then xs ij else return 999999+{-# INLINE with #-}++infixl 5 `withBT`+withBT xs cond ij = if cond ij then xs ij else return []++-- |++fillTables+  :: PrimMonad m+  => MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+  -> MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+  -> MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+  -> MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+  -> m ()+fillTables aT aF bT bF cT cF dT dF = do+  let (_,Z:.n:._) = boundsM aT+  forM_ [n,n-1 .. 0] $ \i -> forM_ [i..n] $ \j -> do+    let ij = Z:.i:.j+    aF ij >>= writeM aT ij+    bF ij >>= writeM bT ij+    cF ij >>= writeM cT ij+    dF ij >>= writeM dT ij+{-# INLINE fillTables #-}+
+ BioInf/RNAfold/Combinators.hs view
@@ -0,0 +1,52 @@+{-# LANGUAGE TemplateHaskell #-}+{-# LANGUAGE NoMonomorphismRestriction #-}++-- | RNAfold combinators, extracted for quickcheck++module BioInf.RNAfold.Combinators+  ( (~~#)+  , (#~~)+  ) where++import Data.Array.Repa.Index+import qualified Data.Vector.Fusion.Stream as S+import Data.List++import qualified ADP.Fusion as F+import qualified ADP.Fusion.Monadic as M+import qualified ADP.Fusion.Monadic.Internal as F+import ADP.Fusion.Monadic (makeLeft_MinRight)+import ADP.Fusion.Monadic.Internal (Box(..))++++infixl 9 #~~, ~~#++-- | The structure on the left is a subword with size 2-28. The maximal size+-- could be 30 but since the two combinators are linked, 29,30 would fail+-- anyways.++(#~~) = makeLeft_MinRight (3,30) 1+{-# INLINE (#~~) #-}++-- | The structure on the right is a subword with size 2-30, however we inspect+-- the stack an reduce the maximal size.++(~~#) xs ys = Box mk step xs ys where+  minT = 8  -- minimal total size of region+  minC = 3  -- minimal number of nuc's on the right+  maxC = 32+  {-# INLINE mk #-}+  mk (z:.k:.j,a,b) = let (_:.i) = z+                         cnsmd = k-i -- consumed part+                         l = max k (j-maxC+cnsmd)+                     in return (z:.k:.l:.j,a,b)+  {-# INLINE step #-}+  step (z:.k:.l:.j,a,b)+    | l<=j-(max 0 $ minT - cnsmd) && l+minC<=j+    = return $ S.Yield (z:.k:.l:.j,a,b) (z:.k:.l+1:.j,a,b)+    | otherwise = return $ S.Done+    where cnsmd = k-i+          (_:.i) = z+{-# INLINE (~~#) #-}+
+ BioInf/RNAfold/Energy.hs view
@@ -0,0 +1,252 @@+{-# LANGUAGE PackageImports #-}+{-# LANGUAGE TypeOperators #-}+{-# LANGUAGE RecordWildCards #-}++-- | A set of energy functions that are modelled after the ViennaRNA package,+-- Version 2 (with d=2).+--+-- As part of the design, we could have (i) either continued giving many+-- parameters or (ii) have fewer parameters that require input of the+-- (Primary,Index,Index) type. Since the compilation speed of the grammars+-- using these functions depends on the number of arguments (in case (i)+-- compilation takes minutes!), this approach has benefits for testing the+-- fusion library.+--+-- This means compilation is a lot faster, but runtime is not @2.8x@ slower but+-- @3.5x@ slower.++module BioInf.RNAfold.Energy where++import Control.Exception (assert)+import Data.Strict.Tuple hiding (fst,snd)+import qualified Data.Vector.Fusion.Stream.Monadic as S++import Biobase.Primary+import Biobase.Secondary.Vienna+import Biobase.Vienna+import Data.PrimitiveArray+import "PrimitiveArray" Data.Array.Repa.Index++import Debug.Trace++++-- | Hairpin structures. Hairpins with less than 3 unpaired nucleotides are+-- forbidden.+--+-- NOTE @(xs,i,j)@ is indeed *only* the unpaired stretch. Hence, the length is+-- @j-i+1@, as given.+--+-- TODO Activate tabulated hairpin structures.++hairpinF :: Vienna2004 -> (Nuc :!: Nuc) -> (Primary :!: Int :!: Int) -> (Nuc :!: Nuc) -> Int+hairpinF Vienna2004{..} (l :!: lp) (xs :!: i :!: j) (rp :!: r) = hairpinType where+  {-# INLINE hairpinType #-}+  hairpinType+    -- TODO use sliceEq for tabulated hairpins+    {-+    | len <= 6, Just v <- find tabulated hairpin+    -}+    | len <  3  = 999999+    | len == 3  = hairpinL!(Z:.len) + tAU+    | len > 31  = hairpinL!(Z:.30)  + hairpinMM!(Z:.p:.lp:.rp) + llp+    | otherwise = hairpinL!(Z:.len) + hairpinMM!(Z:.p:.lp:.rp)+  p   = mkViennaPair (l,r)+  len = j-i+1+  tAU = if p/=vpCG && p/=vpGC then termAU else 0+  llp = floor $ 108.856 * log (fromIntegral len / 30)+{-# INLINE hairpinF #-}++-- | Tiny loops are small interior loops. This includes canonical stacks+-- without any unpaired nucleotides, and small, tabulated interior loops.++tinyloopF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+tinyloopF Vienna2004{..} (ls :!: li :!: lj) w (rs :!: ri :!: rj) = assert (assertL && assertR) $ loopType where+  assertL = let (_,Z:.n) = bounds ls in li>=0 && lj<=n+  assertR = let (_,Z:.n) = bounds rs in ri>=0 && rj<=n+  {-# INLINE loopType #-}+  loopType+    | dl==0 || dr==0 = error $ "bug in tinyloop: " ++ show (li,lj,[ls!(Z:.k) | k<-[li..lj]],ri,rj,[rs!(Z:.l) | l<-[ri..rj]])+    -- normal stack+    | dl==1 && dr==1 = w+stack!(Z:.op:.ip)+    -- one intervening unpaired nucleotide doesn't break the stack+    | dl==1 && dr==2 = w+stack!(Z:.op:.ip)+bulgeL!(Z:.1)+    | dl==2 && dr==1 = w+stack!(Z:.op:.ip)+bulgeL!(Z:.1)+    -- 1x1 symmetric interior loop+    | dl==2 && dr==2 = w+iloop1x1!(Z:.op:.ip:.bI:.bJ)+    -- 1x2 interior loop+    | dl==2 && dr==3 = w+iloop2x1!(Z:.op:.ip:.bI:.bL:.bJ)+    -- 2x1 interior loop+    | dl==3 && dr==2 = w+iloop2x1!(Z:.op:.ip:.bJ:.bI:.bK)+    -- 2x2 interior loop+    | dl==3 && dr==3 = w+iloop2x2!(Z:.op:.ip:.bI:.bK:.bL:.bJ)+    -- 2x3 interior loops with specialized mismatches+    |  dl==3 && dr==4+    || dl==4 && dr==3 = w+iloop2x3MM!(Z:.op:.bI:.bJ) + iloop2x3MM!(Z:.ip:.bL:.bK) + iloopL!(Z:.5) + ninio+    | otherwise      = 999999 -- overlaps with big interior loops+  op = mkViennaPair (ls!(Z:.li),rs!(Z:.rj))+  ip = mkViennaPair (rs!(Z:.ri),ls!(Z:.lj))+  bI = ls!(Z:.li+1)+  bJ = rs!(Z:.rj-1)+  bK = ls!(Z:.lj-1)+  bL = rs!(Z:.ri+1)+  dl = lj-li+  dr = rj-ri+{-# INLINE tinyloopF #-}++-- | A left bulge @(....[[...]])@ which four unpaired nucleotides in the bulge.+-- the left bulge @ls@ will be given six nucleotides (note, @ls@ is the+-- complete input, use @li@ and @lj@ as the first and last included nucleotide+-- index), the two outer ones being for the outer and inner loop. On the right,+-- we have @rp@ and @r@ which are nucleotides. @ls!(Z:.li)@ and @r@ form the+-- outer Vienna pair. @rp@ and @ls!(Z:.lj)@ form the inner pair.++bulgeLF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Nuc :!: Nuc) -> Int+bulgeLF Vienna2004{..} (ls :!: li :!: lj) w (rp :!: r) = assert (lj-li<=30) $ w + tAUlr + lenE + tAUrpcp where+  tAUlr = terminalAU termAU lr+  tAUrpcp = terminalAU termAU rpcp+  lr = mkViennaPair (ls!(Z:.li),r)+  rpcp = mkViennaPair (rp,ls!(Z:.lj))+  lenE = bulgeL!(Z:.lj-li-1)+{-# INLINE bulgeLF #-}++-- | A right bulge @([[...]]....)@. See 'bulgeLF' for how this works.++bulgeRF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Primary :!: Int :!: Int) -> Int+bulgeRF Vienna2004{..} (l :!: lp) w (rs :!: ri :!: rj) = assert (rj-ri<=30) $ w + tAUlr + lenE + tAUcplp where+  tAUlr = terminalAU termAU lr+  tAUcplp = terminalAU termAU cplp+  lr = mkViennaPair (l,rs!(Z:.rj))+  cplp = mkViennaPair (rs!(Z:.ri),lp)+  lenE = bulgeL!(Z:.rj-ri-1)+{-# iNLINE bulgeRF #-}++-- | An interior loop with @N@ unpaired nucleotides to the left and @1@+-- unpaired nucleotide to the right. The regions @ls@ and @rs@ each have 2+-- nucleotides more than are unpaired. These first and last nucleotides form+-- the last paired or first pairs in the stacks around the loop.++iloopN1F :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+iloopN1F Vienna2004{..} (ls:!:li:!:lj) w (rs:!:ri:!:rj)+  = assert (lj-li-1 <=29 && rj-ri == 2)+  $ w + outerMM + lenE + innerMM + owninio where+    poLR = mkViennaPair (ls!(Z:.li), rs!(Z:.rj))+    piRL = mkViennaPair (rs!(Z:.ri), ls!(Z:.lj))+    outerMM = iloop1xnMM!(Z:.poLR:.ls!(Z:.li+1):.rs!(Z:.ri+1))+    innerMM = iloop1xnMM!(Z:.piRL:.rs!(Z:.ri+1):.ls!(Z:.lj-1))+    lenE = iloopL!(Z:.(lL+1))+    owninio = min maxNinio (ninio * (lL-1))+    lL = lj-li-1+    lR = rj-ri-1+{-# INLINE iloopN1F #-}++-- | 1xN interior loops.++iloop1NF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+iloop1NF Vienna2004{..} (ls :!: li :!: lj) w (rs :!: ri :!: rj)+  = assert (lj-li == 2 && rj-ri-1 <=29)+  $ w + outerMM + lenE + innerMM + owninio where+    poLR = mkViennaPair (ls!(Z:.li), rs!(Z:.rj))+    piRL = mkViennaPair (rs!(Z:.ri), ls!(Z:.lj))+    outerMM = iloop1xnMM!(Z:.poLR:.ls!(Z:.li+1):.rs!(Z:.rj-1))+    innerMM = iloop1xnMM!(Z:.piRL:.rs!(Z:.ri+1):.ls!(Z:.li+1))+    lenE = iloopL!(Z:.(lR+1))+    owninio = min maxNinio (ninio * (lR-1))+    lL = lj-li-1+    lR = rj-ri-1+{-# INLINE iloop1NF #-}++iloopIF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+iloopIF Vienna2004{..} (ls :!: li :!: lj) w (rs :!: ri :!: rj) = w + iloopMM!(Z:.p:.bR:.bL) + iloopL!(Z:.len) + owninio where+  p = mkViennaPair (rs!(Z:.ri), ls!(Z:.lj))+  bL = ls!(Z:.lj-1)+  bR = rs!(Z:.ri+1)+  len = (lj-li)+(rj-ri)+  owninio = min maxNinio (ninio * (abs $ (lj-li) - (rj-ri)))+{-# INLINE iloopIF #-}++-- |++iloopOF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Nuc :!: Nuc) -> Int+iloopOF Vienna2004{..} (l :!: lp) iloopif (rp :!: r) = {- CORE "iloopOF" -} iloopif + iloopMM!(Z:.op:.lp:.rp)+  where op = mkViennaPair (l,r)+{-# INLINE iloopOF #-}++-- |++multiIF :: Vienna2004 -> Int -> Int -> Int+multiIF Vienna2004{..} b c = b+c+{-# INLINE multiIF #-}++-- |++multiOF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Nuc :!: Nuc) -> Int+multiOF Vienna2004{..} (l :!: lp) multiif (rp :!: r) = multiif + multiMM!(Z:.p:.lp:.rp) + multiHelix + multiOffset + terminalAU termAU p+  where p = mkViennaPair (l,r)+{-# INLINE multiOF #-}++-- |++regionStemF :: Vienna2004 -> Nuc -> Int -> Int+regionStemF Vienna2004{..} _ w = w + multiNuc+{-# INLINE regionStemF #-}++-- |++justStemF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Nuc :!: Nuc) -> Int+justStemF Vienna2004{..} (l :!: lp) w (rp :!: r) = w + multiMM!(Z:.p:.l:.r)+  where p = mkViennaPair (lp,rp)+{-# INLINE justStemF #-}++-- |++bsF :: Int -> Int -> Int+bsF b reg = b+{-# INLINE bsF #-}++-- |++rSF :: Nuc -> Int -> Int+rSF nuc w = w+{-# INLINE rSF #-}++-- |++bcF :: Int -> Int -> Int+bcF b c = b + c+{-# INLINE bcF #-}++-- |++ssF :: Int -> Int+ssF reg = 0+{-# INLINE ssF #-}++-- |++cmF :: Int -> Int -> Int+cmF w s = w+s+{-# INLINE cmF #-}++-- |++nilF :: Bool -> Int+nilF e = if e then 0 else 999999+{-# INLINE nilF #-}++-- |++iD = id+{-# INLINE iD #-}++-- |++h :: Monad m => S.Stream m Int -> m Int+h = S.foldl' min (999999::Int)+{-# INLINE h #-}++-- |++terminalAU termAU p = if p/=vpCG && p/=vpGC then termAU else 0+{-# INLINE terminalAU #-}+
+ BioInf/RNAfold/Library.hs view
@@ -0,0 +1,140 @@+{-# LANGUAGE TypeOperators #-}++-- | A library of helpers for ADPfusion algorithms.++module BioInf.RNAfold.Library where++import Control.Exception (assert)+import Data.Array.Repa.Index+import Debug.Trace+import qualified Data.Vector.Unboxed as VU+import Data.Strict.Tuple hiding (fst,snd)++import Biobase.Primary+import Biobase.Secondary.Vienna+import Data.PrimitiveArray++import ADP.Fusion.Monadic+import ADP.Fusion.Monadic.Internal++++-- |++base' :: Primary -> DIM2 -> (Scalar Nuc)+base' inp (Z:.i:.j) = Scalar $ index inp (Z:.i)+{-# INLINE base' #-}++-- | Nucleotide, second one to the right. The assertion allows a size of one or+-- two to capture special cases of looking outside of the bounds (used by+-- @justStemF@ in RNAfold).++baseLr' :: Primary -> DIM2 -> (Scalar (Nuc :!: Nuc))+baseLr' inp (Z:.i:.j)+  = assert (let (_,Z:.n) = bounds inp in (i+1==j || i+2==j) && i>=0 && i+1<=n)+  . Scalar $ (index inp (Z:.i) :!: index inp (Z:.i+1))+{-# INLINE baseLr' #-}++-- |++baselR' :: Primary -> DIM2 -> (Scalar (Nuc :!: Nuc))+baselR' inp (Z:.i:.j)+  = assert (let (_,Z:.n) = bounds inp in i+1==j && i>0 && i<=n)+  . Scalar $ (index inp (Z:.i-1) :!: index inp (Z:.i))+{-# INLINE baselR' #-}++-- |++region' :: VU.Vector Nuc -> DIM2 -> (Scalar (VU.Vector Nuc))+region' inp (Z:.i:.j)+  = assert (let n = VU.length inp -1 in i<=j && i>=0 && j<=n+1)+  . Scalar $ VU.unsafeSlice i (j-i) inp+{-# INLINE region' #-}++-- | A 'Primary' together with the lowest included nucleotide and the highest+-- included nucleotide.++primary' :: Primary -> DIM2 -> (Scalar (Primary :!: Int :!: Int))+primary' inp (Z:.i:.j)+  = assert (let (_,Z:.u) = bounds inp in i>=0 && j-1<=u && i<=j)+  $ Scalar (inp :!: i :!: j-1)+{-# INLINE primary' #-}++-- | A 'Primary' together with the lowest included nucleotide and the highest+-- included nucleotide.++primaryPR' :: Primary -> DIM2 -> (Scalar (Primary :!: Int :!: Int))+primaryPR' inp (Z:.i:.j)+  = assert (let (_,Z:.u) = bounds inp in i>=0 && j-2<=u && i<=j)+  $ Scalar (inp :!: i :!: j)+{-# INLINE primaryPR' #-}++-- | A 'Primary' together with the lowest included nucleotide and the highest+-- included nucleotide.++primaryPL' :: Primary -> DIM2 -> (Scalar (Primary :!: Int :!: Int))+primaryPL' inp (Z:.i:.j)+  = assert (let (_,Z:.u) = bounds inp in i>0 && j-1<=u && i<=j)+  $ Scalar (inp :!: i-1 :!: j-1)+{-# INLINE primaryPL' #-}++-- | Vector of nucleotides peeking one nucleotide to the left.++regionpl' :: VU.Vector Nuc -> DIM2 -> (Scalar (VU.Vector Nuc))+regionpl' inp (Z:.i:.j)+  = assert (let n = VU.length inp -1 in i-1<=j && i>0 && j<=n+1)+  . Scalar $ VU.unsafeSlice (i-1) (j-i+1) inp+{-# INLINE regionpl' #-}++-- | Vector of nucleotides peeaking one nucleotide to the right.++regionpr' :: VU.Vector Nuc -> DIM2 -> (Scalar (VU.Vector Nuc))+regionpr' inp (Z:.i:.j)+  = assert (let n = VU.length inp -1 in i<=j && i>=0 && j+1<=n+1)+  . Scalar $ VU.unsafeSlice i (j-i+1) inp+{-# INLINE regionpr' #-}++-- | Tests if (i,j) is a valid base pair. ++basepairing' inp (Z:.i:.j) = tf+  where p     = mkViennaPair (inp!(Z:.i), inp!(Z:.j-1))+        Z:.n  = snd . bounds $ inp+        tf    = i>=0 && j>0 && i<=j && j-1<=n && i<=n && p /= vpNS+{-# INLINE basepairing' #-}++stackpairing' inp k (Z:.i:.j) = tf+  where ps   = [ mkViennaPair (inp!(Z:.i+l), inp!(Z:.j-1-l)) | l <-[0..k-1] ]+        Z:.n = snd . bounds $ inp+        tf   = i>=k-1 && j>k-1 && i+k-1<=j-k+1 && j-k<=n && i+k-1<=n && all (/=vpNS) ps+{-# INLINE stackpairing' #-}++constrained cns ij = cns ij+{-# INLINE constrained #-}++-- |++reglen' :: Primary -> DIM2 -> Scalar Int+reglen' inp (Z:.i:.j)+  = assert (let (Z:.o,Z:.n) = bounds inp in i>=0 && (j<=n+1 || n== -1) && i<=j)+  . Scalar $ j-i+{-# INLINE reglen' #-}++-- |++reglenpl' :: Primary -> DIM2 -> Scalar (Nuc,Nuc,Int)+reglenpl' inp (Z:.i:.j)+  = assert (let (_,Z:.n) = bounds inp in i>0 && j<=n && i<=j)+  . Scalar $ (index inp (Z:.i-1),index inp (Z:.i),j-i)+{-# INLINE reglenpl' #-}++reglenpr' :: Primary -> DIM2 -> Scalar (Int,Nuc,Nuc)+reglenpr' inp (Z:.i:.j)+  = assert (let (_,Z:.n) = bounds inp in i>=0 && j<n && i<=j)+  . Scalar $ (j-i,index inp (Z:.j-1), index inp (Z:.j))+{-# INLINE reglenpr' #-}++-- | True, if the subword at ij is empty.++empty :: DIM2 -> Scalar Bool+empty (Z:.i:.j) = Scalar $ i==j+
+ BioInf/RNAfold/QuickCheck.hs view
@@ -0,0 +1,31 @@++module BioInf.RNAfold.QuickCheck where++import Test.QuickCheck+import Test.QuickCheck.All++import ADP.Fusion.QuickCheck.Arbitrary -- hiding (options,customCheck,allProps)++++-- * property checking++fCombined (i,j) = S.toList $ (,,) F.<<< fRegion #~~ fRegion ~~# fRegion F.... id $ Z:.i:.j++bCombined (i,j) = [ ( (i,k),(k,l),(l,j) )+                  | k <- [i..j]+                  , l <- [k..j]+                  , k-i >= 3+                  , j-l >= 3+                  , (k-i) + (j-l) >= 8+                  , (k-i) + (j-l) <= 32+                  ]++prop_Combined (Small i, Small j) = fCombined (i,j) == bCombined (i,j)++options = stdArgs {maxSuccess = 1000}++customCheck = quickCheckWithResult options++allProps = $forAllProperties customCheck+
+ README.md view
@@ -0,0 +1,39 @@++ViennaRNA RNAfold v2, MFE variant+using the ADPfusion library++++Introduction+============++This algorithm is the second, and much larger, test case for ADPfusion. We+implement "RNAfold v2" in the MFE variant using "-d2" dangles. Both a library+version and an executable are created. The "RNAFold" binary expects single+sequences, one per line. Backtracking tracks all co-optimal structures.++++Installation+============++A simple "cabal update && cabal-dev install RNAFold" should be enough.++++Runtime notes+=============++Using Haskell and ADPfusion, we come to within x3-x4 for this package. Between+the initial test case / submission (in 0.0.0.3) I have traded in some+performance improvements for much better readability in BioInf.RNAfold.Energy.+The C version of RNAfold employs some other methods to improve performance.+Consider:++base -~+ inner-1 +~- base+base -~+ inner-2 +~- base++where it is advantageous to calculate the outer basepair only once, not twice+as we are doing. It is probably better to try to improve the handling of+fusioned code and/or final assembler generation than finding calculations+common to different parts of CFG's.
RNAFold.cabal view
@@ -1,64 +1,102 @@ name:           RNAFold-version:        0.0.2.1-author:         Christian Hoener zu Siederdissen (Haskell), Ivo L. Hofacker et al (ViennaRNA)+version:        1.99.1.0+author:         Christian Hoener zu Siederdissen (Haskell), Ivo L. Hofacker et al (ViennaRNA), 2010-2012+copyright:      Christian Hoener zu Siederdissen, 2010-2012+homepage:       http://www.tbi.univie.ac.at/~choener/adpfusion maintainer:     choener@tbi.univie.ac.at-copyright:      Christian Hoener zu Siederdissen, 2010 category:       Bioinformatics-synopsis:       RNA secondary structure prediction license:        GPL-3 license-file:   LICENSE build-type:     Simple stability:      experimental-cabal-version:  >= 1.4.0+cabal-version:  >= 1.6.0+synopsis:       RNA secondary structure prediction description:-                Provides the folding functions as used in the ViennaRNA-                package. Here, they are in Haskell form to be used by Haskell-                programs.+                RNAfold v2 using the ADPfusion library. The RNAfold algorithm+                is used to determine how fast we can be compared to a highly+                optimized C program.                 .-                - This is a release aimed at testing Data.Vector-                - Expect major performance issues with GHC < 6.13!+                If possible, build using the GHC llvm backend, and GHC-7.2.2.+                GHC-7.4.x produces very bad code on my system, please benchmark+                using 7.2.2.+                .+                NOTE I'd like to rename this package to RNAfold, like the C+                implementation. Do not install "globally", especially if you+                normally use RNAfold from the ViennaRNA package, for obvious+                reasons.+                .+                NOTE I am reluctant to call this v2 for now. +Extra-Source-Files:+  BioInf/RNAfold/QuickCheck.hs+  README.md++Flag llvm+  description: build using llvm backend+  default: True+++ library   build-depends:-    base >=4 && <5,-    containers,-    vector >=0.7,-    primitive >=0.3,+    base >= 4 && < 5,+    mtl,+    strict,+    primitive      == 0.4.*   ,+    vector         == 0.9.*   ,+    PrimitiveArray == 0.2.1.1 ,+    BiobaseVienna  == 0.2.2.3 ,+    BiobaseXNA     == 0.6.2.2 ,+    ADPfusion      == 0.0.1.0+  exposed-modules:+    BioInf.RNAfold+    BioInf.RNAfold.Combinators+    BioInf.RNAfold.Energy+    BioInf.RNAfold.Library+  ghc-options:+    -Odph+    -funbox-strict-fields+    -fspec-constr+    -funfolding-use-threshold100+    -funfolding-keeness-factor100+  if flag (llvm)+    ghc-options:+      -fllvm -optlo-O3 -optlo-inline -optlo-std-compile-opts -    Biobase >=0.0.2,-    BiobaseTurner >=0.0.2,-    BiobaseVienna >=0.0.2,-    BiobaseTypes >=0.0.2,-    HsTools >=0.0.1.1,-    PrimitiveArray >=0.0.2 && <0.0.3 -  exposed-modules:-    BioInf.RNAFold,-    BioInf.RNAFold.Energy,-    BioInf.RNAFold.EnergyInt,-    BioInf.RNAEval,-    BioInf.RNAFold.Functions -  if impl(ghc > 6.13)+executable RNAFold+  build-depends:+    base >= 4 && < 5,+    mtl,+    strict,+    primitive      == 0.4.*   ,+    vector         == 0.9.*   ,+    PrimitiveArray == 0.2.1.1 ,+    BiobaseVienna  == 0.2.2.3 ,+    BiobaseXNA     == 0.6.2.2 ,+    ADPfusion      == 0.0.1.0+  main-is:+    RNAFold.hs+  other-modules:+    BioInf.RNAfold+    BioInf.RNAfold.Combinators+    BioInf.RNAfold.Energy+    BioInf.RNAfold.Library+  ghc-options:+    -rtsopts+    -Odph+    -funbox-strict-fields+    -fspec-constr+    -funfolding-use-threshold100+    -funfolding-keeness-factor100+  if flag (llvm)     ghc-options:-      -Odph-      -fllvm-      -fforce-recomp-      -funbox-strict-fields-      -fllvm-      -optlo-O3-      -optlc-O3-      -fdicts-cheap-      -fspec-constr-      -funbox-strict-fields-      -funfolding-use-threshold=100-      -funfolding-creation-threshold=100-  else-    ghc-options:-Odph+      -fllvm -optlo-O3 -optlo-inline -optlo-std-compile-opts ---    -fno-method-sharing -- performance does not improve!---    -fdicts-cheap---    -fspec-constr---    -funbox-strict-fields---    -funfolding-use-threshold=100---    -funfolding-creation-threshold=100+++source-repository head+  type: git+  location: git://github.com/choener/RNAfold+
+ RNAFold.hs view
@@ -0,0 +1,18 @@++-- | Simple wrapper around STrnafold++module Main where++import BioInf.RNAfold++++main = do+  xs <- fmap lines getContents+  mapM_ doRNAfold xs++doRNAfold inp = do+  let (e,bs) = testRNAfold inp+  putStrLn inp+  print e+  mapM_ putStrLn bs