RNAFold 0.0.2.1 → 1.99.1.0
raw patch · 13 files changed
+952/−1186 lines, 13 filesdep +ADPfusiondep +BiobaseXNAdep +mtldep −Biobasedep −BiobaseTurnerdep −BiobaseTypesdep ~BiobaseViennadep ~PrimitiveArraydep ~primitivenew-component:exe:RNAFold
Dependencies added: ADPfusion, BiobaseXNA, mtl, strict
Dependencies removed: Biobase, BiobaseTurner, BiobaseTypes, HsTools, containers
Dependency ranges changed: BiobaseVienna, PrimitiveArray, primitive, vector
Files
- BioInf/RNAEval.hs +0/−122
- BioInf/RNAFold.hs +0/−115
- BioInf/RNAFold/Energy.hs +0/−92
- BioInf/RNAFold/EnergyInt.hs +0/−235
- BioInf/RNAFold/Functions.hs +0/−575
- BioInf/RNAfold.hs +335/−0
- BioInf/RNAfold/Combinators.hs +52/−0
- BioInf/RNAfold/Energy.hs +252/−0
- BioInf/RNAfold/Library.hs +140/−0
- BioInf/RNAfold/QuickCheck.hs +31/−0
- README.md +39/−0
- RNAFold.cabal +85/−47
- RNAFold.hs +18/−0
− BioInf/RNAEval.hs
@@ -1,122 +0,0 @@---- | Given a sequence and a structure, evaluate the energy.------ TODO switch to 'SSTree [Energy]' type!--module BioInf.RNAEval where--import Text.Printf-import qualified Data.Vector.Unboxed as VU--import Biobase.RNA-import Biobase.Structure-import Biobase.Structure.DotBracket-import Biobase.Types.Ring-import Biobase.Vienna-import Data.PrimitiveArray--import BioInf.RNAFold.EnergyInt-import BioInf.RNAFold.Functions------ | Sum up a complete (sub-) tree.--rnaEval :: ViennaTables -> String -> String -> Int-rnaEval vna pri' sec' = treeSum $ annotateWithEnergy vna pri sst where- sec = dotbracketToPairlist sec'- sst = toSSTree sec- pri = mkPrimary pri'------ | Evaluate the energy of a secondary structure tree with sequence. We abuse--- the normal folding functions with a dummy table full of (one :: Energy).--- This is probably slower than another method but quickly written.------ TODO this is basically crapfuck ;-) Should use the FoldFunctions directly--- instead of that strange table. Should not xxxOpt either.--annotateWithEnergy :: ViennaTables -> Primary -> SSTree () -> SSTree [Int]-annotateWithEnergy trnr pri t = f t where- -- extern part- f (SSExt l _ []) = SSExt l [one] []- f (SSExt l _ xs) =- let- es = map ((\(i,j) -> externalLoopOpt trnr pri dummy i j) . treeIJ) xs- in- SSExt l es (map f xs)- -- hairpin- f (SSTree i j _ []) = SSTree i j [hairpinOpt trnr pri i j] []- -- 1-loop- f (SSTree i j _ [x])- -- stack- | i+1==k&&j-1==l- = SSTree i j [stackOpt trnr pri dummy i j] [f x]- | (di,dj) `VU.elem` tabbedInteriorLoopDistances i j- = SSTree i j [tabbedInteriorLoopOpt trnr pri dummy i j] [f x]- | di==0&&dj>1- = SSTree i j [bulgeLOpt trnr pri dummy i j] [f x]- | di>1&&dj==0- = SSTree i j [bulgeROpt trnr pri dummy i j] [f x]- | di==1&&dj>1- = SSTree i j [interior1xnLOpt trnr pri dummy i j] [f x]- | di>1&&dj==1- = SSTree i j [interior1xnROpt trnr pri dummy i j] [f x]- | ds+dl>30- = error "not handling loops with size >30"- -- large interiorr loop- | otherwise = SSTree i j [largeInteriorLoopOpt trnr pri dummy i j] [f x]- where- (k,l) = treeIJ x- di = k-i-1- dj = j-l-1- ds = min di dj- dl = max di dj- -- multiple loop- f (SSTree i j _ xs) =- let- cl = multibranchCloseOpt trnr pri dummy dummy i j- ls = map ((\(k,l) -> multibranchIJLoopOpt trnr pri dummy k l) . treeIJ) xs- in- SSTree i j (cl:ls) (map f xs)-- dummy = fromAssocs (0,0) (n,n) one []- n = snd $ bounds pri------ | convert an annotated tree into strings that explain each score.------ TODO this is a stupid name--explainTree :: Primary -> SSTree [Int] -> [String]-explainTree inp sst = f sst where- -- | exterior loop- f (SSExt _ _ []) = [""]- f (SSExt _ _ xs) = this : concatMap f xs where- eners = map (\(SSTree _ _ [e] _) -> e) xs- ener = sum eners- this = printf "%-20s %6d %s" "External loop" ener (show eners)- -- | hairpin- f (SSTree i j [e] []) = [this] where- this = printf "%-20s (%4d,%4d) %4s %6d" "Hairpin loop" (i+1) (j+1) (show $ pair inp i j) e- f (SSTree i j [e] [x@(SSTree k l _ _)]) = this : f x where- this = printf "%-20s (%4d,%4d) %4s (%4d,%4d) %4s %6d" "Interior" (i+1) (j+1) (show $ pair inp i j) (k+1) (l+1) (show $ pair inp k l) e- f (SSTree i j es xs) = concatMap f xs ++ [this] where- this = printf "%-20s (%4d,%4d) %4s %6d %6d, %s" "Multi loop" (i+1) (j+1) (show $ pair inp i j) (sum es) (head es) (show $ tail es)------ | input sequence indices--treeIJ (SSTree i j _ _) = (i,j)----- | Run a sum over the tree. (foldl (+), the tree annotations)------ TODO that should go into Biobase.Structure as a generic walk over the tree--treeSum t = f t where- f (SSExt _ es xs) = ringProductL $ es ++ map f xs- f (SSTree _ _ es xs) = ringProductL $ es ++ map f xs
− BioInf/RNAFold.hs
@@ -1,115 +0,0 @@---- | ViennaRNA folding based on an algebraic ring structure. This should--- combine the goals of few lines of codes, multiple different folding--- functions and extensibility.------ NOTE Assume that you want '-d 3' for folding with dangles. Then you can just--- instanciate the folding functions, replacing only those functions where the--- folding changes based on the new dangle options.------ NOTE compile with: -fno-method-sharing--module BioInf.RNAFold where--import Control.Monad-import Control.Monad.ST--import Biobase.RNA-import Biobase.Types.Ring-import Data.PrimitiveArray-import Biobase.Structure--import BioInf.RNAFold.Functions--import Debug.Trace.Tools-import Debug.Trace----- | Folding works on unboxed values of a Ring-type for which a FoldFunctions--- instance does exist. By default, we have this for Energy values. Again, we--- use a class as we could be interested in probabilistic backtracking or--- something like that.--type ResultTables a =- ( Table a -- weak structures- , Table a -- strong structures- , Table a -- exactly one component- , Table a -- one or more components- , Table a -- complete external structures- )--type Pairlist = [(Int,Int)]--class (FoldFunctions a) => Fold a where-- fold :: TurnerTables a -> Primary -> (ResultTables a)- foldST :: TurnerTables a -> Primary -> ST s (ResultTables a)- backtrack :: TurnerTables a -> Primary -> (ResultTables a) -> a -> [(Secondary,a)]-- -- | We have a default instance for folding based on Rings-- fold trnr inp = runST $ foldST trnr inp- {-# INLINE fold #-}-- foldST trnr inp = do- let n = snd $ bounds inp- (weakM,weak) <- mkTable n- (strongM,strong) <- mkTable n- (externM,extern) <- mkTableWith one n- (mbr1M,mbr1) <- mkTable n- (mbrM,mbr) <- mkTable n- forM_ [n,n-1..0] $ \i -> forM_ [i,i+1..n] $ \j -> do- let pIJ = pair inp i j- when (pIJ/=vpNP&&i+3<j) $ do- -- weak table- let hpVal = {-# SCC "hpVal" #-} hairpinOpt trnr inp i j- let ilVal = {-# SCC "ilVal" #-} ringSumL- [ largeInteriorLoopOpt trnr inp strong i j- , tabbedInteriorLoopOpt trnr inp strong i j- , bulgeLOpt trnr inp strong i j- , bulgeROpt trnr inp strong i j- , interior1xnLOpt trnr inp strong i j- , interior1xnROpt trnr inp strong i j- ]- let mbVal = {-# SCC "mbVal" #-} multibranchCloseOpt trnr inp mbr mbr1 i j- writeM weakM (i,j) $ ringSumL [hpVal,ilVal,mbVal]- -- strong table- when (i+5<j) $ do- let stValW = {-# SCC "stValW" #-} stackOpt trnr inp weak i j- let stValS = {-# SCC "stValS" #-} stackOpt trnr inp strong i j- writeM strongM (i,j) $ ringSumL [stValW,stValS]- -- multibranch loops- when (i>0&&j<n) $ do- -- M1- let mbr1ValS = {-# SCC "mbr1ValS" #-} multibranchIJLoopOpt trnr inp strong i j- let mbr1ValU = {-# SCC "mbr1ValU" #-} multibranchUnpairedJOpt trnr inp mbr1 i j- writeM mbr1M (i,j) $ ringSumL [mbr1ValS,mbr1ValU]- -- M- let mbrValU = {-# SCC "mbrValU" #-} multibranchUnpairedJOpt trnr inp mbr i j- let mbrValS = {-# SCC "mbrValS" #-} multibranchKJHelixOpt trnr inp strong i j- let mbrValMS = {-# SCC "mbrValMS" #-} multibranchAddKJHelixOpt trnr inp mbr strong i j- writeM mbrM (i,j) $ ringSumL [mbrValU,mbrValS,mbrValMS]- -- fill only part of the F array- let j=n- forM_ [n-6,n-7..0] $ \i -> do- let extUP = {-# SCC "extUP" #-} if i<n then extern ! (i+1,j) else zero- let extStr = {-# SCC "extStr" #-} externalLoopOpt trnr inp strong i j- let extAddL = {-# SCC "extAddL" #-} externalAddLoopOpt trnr inp strong extern i j- writeM externM (i,j) $ ringSumL [extUP,extStr,extAddL,one] -- always add 'one' as the open chain should always be contained- return (weak,strong,mbr1,mbr,extern)- {-# INLINE foldST #-}----- * Helper functions---- Create one 2dim - IxTable with default value.--mkTable n = mkTableWith zero n---- Create one IxTable with user-supplied value.--mkTableWith v n = do- tM <- fromAssocsM (0,0) (n,n) v []- t <- unsafeFreezeM tM- return (tM,t)-
− BioInf/RNAFold/Energy.hs
@@ -1,92 +0,0 @@-{-# LANGUAGE StandaloneDeriving #-}--module BioInf.RNAFold.Energy- ( FoldFunctions (..)- , Fold (..)- ) where--import BioInf.RNAFold-import Biobase.Types.Energy-import Biobase.Types.Ring-import BioInf.RNAFold.Functions----instance FoldFunctions Energy--instance Fold Energy where- backtrack trnr inp tbls = error "write me"-{-- backtrack trnr inp (weak,strong,mbr1,mbr,extern) = ext 0 n delta where- n = VU.length inp -1- delta = one :: Energy- overallBest = extern `unsafeIndex` (0,n)- ext i j d = let bestE = extern `unsafeIndex` (i,j) in- [ []- | i==j- , overallBest == one- ] ++ -- gives us the unfolded sequence- [ r- | i<j- , r <- ext (i+1) j d- ] ++- [ r- | i<j- , ((k,l),ce) <- externalLoopIdx trnr inp strong i j- , let dNew = ce `rmult` d `rmult` neg bestE- , dNew <= one- , r <- str k l d- ] ++- [ r++s- | i<j- , (k,ce) <- externalAddLoopIdx trnr inp strong extern i j- , let dNew = ce `rmult` d `rmult` neg bestE- , dNew <= one- , r <- str i k d- , s <- ext (k+1) j d ++ [[]] -- not 'd' but what 'str' leaves us with!, the [[]] only if the str-part alone works out- ]- str i j d = let bestE = strong `unsafeIndex` (i,j) in- [ (i,j):r- | i+2<j- , ((k,l),ce) <- stackIdx trnr inp strong i j- , let dNew = ce `rmult` d `rmult` neg bestE- , dNew <= one- , r <- str k l d- ] ++- [ (i,j):r- | i+2<j- , ((k,l),ce) <- stackIdx trnr inp weak i j- , let dNew = ce `rmult` d `rmult` neg bestE- , dNew <= one- , r <- wea k l d- ]- wea :: Int -> Int -> a -> [Pairlist]- wea i j d = let bestE = weak `unsafeIndex` (i,j) in- [ [(i,j)]- | i+3<j- , (ce :: Energy) <- hairpinIdx trnr inp i j -- needs to be qualified as we give no other table- ]--}------ | (DEBUG) Print an array.--{--printArr arr = do- --let (IT.IxTable (0,0) (_,n) _) = arr- let n = snd $ snd $ bounds arr- forM_ [0..n] $ \i -> do- putStrLn ""- forM [0..n] $ \j -> do- if j>=i- then do- let v = arr `unsafeIndex` (i,j)- if isZero v- then printf "%5s" "_i_"- else printf "%5i" (unEnergy $ arr `unsafeIndex` (i,j))- else do- putStr " "- putStrLn ""- return ()--}
− BioInf/RNAFold/EnergyInt.hs
@@ -1,235 +0,0 @@-{-# LANGUAGE StandaloneDeriving #-}---- | Temporary hackery until all base libraries understand newtype Energy. And--- yes, for testing too.--module BioInf.RNAFold.EnergyInt- ( FoldFunctions (..)- , Fold (..)- ) where--import Biobase.Types.Ring-import Biobase.RNA-import Biobase.Constants-import Biobase.Structure.DotBracket-import Biobase.Structure--import Data.PrimitiveArray--import BioInf.RNAFold-import BioInf.RNAFold.Functions---- for testing only-{--import Biobase.Vienna.Default-import Debug.Trace.Tools-import Data.List.Split-import Text.Printf-import Control.Monad-import Biobase.Turner.Tables--}---instance Ring Int where- (.+.) = min- (.*.) = (+)- neg = negate- one = 0- zero = eInf- isZero x = x>eMax- n .^. k = n * k- (.^^.) = error "write me"- {-# INLINE (.+.) #-}- {-# INLINE (.*.) #-}- {-# INLINE neg #-}- {-# INLINE one #-}- {-# INLINE zero #-}- {-# INLINE isZero #-}- {-# INLINE (.^.) #-}--instance FoldFunctions Int where- calcTermAU tAU p = if p/=vpCG && p/=vpGC then tAU else 0- calcNinio maxNno nno l = min maxNno (nno * l)- calcLargeLoop l = floor $ 108.856 * log (fromIntegral l / 30)- {-# INLINE calcTermAU #-}- {-# INLINE calcNinio #-}- {-# INLINE calcLargeLoop #-}---- TODO detach backtrack so that all instances that use this kind of--- backtracking can immediately use it!--instance Fold Int where- backtrack trnr inp (weak,strong,mbr1,mbr,extern) delta = filter ((<=0) . snd) $ map f $ ext 0 n delta where- f (xs,z) = (Secondary (n+1) xs,optE+delta-z)- n = snd $ bounds inp- optE = extern!(0,n)- newD d here next = d - (next - here)- --- -- All exterior loop decompositions- --- ext i j d = let ehere = extern!(i,j) in- [ (x,z) -- shorter ext- | i<j- , let d' = newD d ehere (extern!(i+1,j))- , d'>=0- , (x,z) <- ext (i+1) j d'- ] ++- [ (x,z) -- loop at (i,j)- | i<j- , (_,enext) <- externalLoopIdx trnr inp strong i j -- _ = (i,j)- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- str i j d'- ] ++- [ (x++y,z)- | i<j- , (k,enext) <- externalAddLoopIdx trnr inp strong extern i j- , let d' = newD d ehere enext- , d'>=0- , (x,z') <- str i k d'- , (y,z) <- ext (k+1) j z' ++ [([],z') | z'>=0 && extern!(k+1,j)==0]- ]- --- -- A strong stem on top of strong of weak- --- str i j d = let ehere = strong!(i,j) in- [ ((i,j):x,z)- | i<j- , (_,enext) <- stackIdx trnr inp strong i j- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- str (i+1) (j-1) d'- ] ++- [ ((i,j):x,z)- | i<j- , (_,enext) <- stackIdx trnr inp weak i j- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- wea (i+1) (j-1) d'- ]- wea i j d = let ehere = weak!(i,j) in- --- -- A hairpin closes at (i,j)- --- [ ([(i,j)],d')- | i<j- , enext <- hairpinIdx trnr inp i j- , let d' = newD d ehere enext- , d'>=0- ] ++- --- -- interior loops- --- [ ((i,j):x,z)- | i<j- , ((k,l),enext) <- (- largeInteriorLoopIdx trnr inp strong i j ++- tabbedInteriorLoopIdx trnr inp strong i j ++- bulgeLIdx trnr inp strong i j ++- bulgeRIdx trnr inp strong i j ++- interior1xnLIdx trnr inp strong i j ++- interior1xnRIdx trnr inp strong i j- )- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- str k l d'- ] ++- --- -- multibranch loops closed at (i,j)- --- [ ((i,j):x++y,z)- | i<j- , (k,enext) <- multibranchCloseIdx trnr inp mbr mbr1 i j- , let d' = newD d ehere enext- , d'>=0- , (x,z') <- mul (i+1) k d'- , (y,z) <- mul1 (k+1) (j-1) z' -- z' is what 'mul' left us- ]- mul i j d = let ehere = mbr!(i,j) in- --- -- unpaired nucleotide on the J side- --- [ (x,z)- | i<j- , ((k,l),enext) <- multibranchUnpairedJIdx trnr inp mbr i j- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- mul k l d'- ] ++- --- -- a helix (k,j)- --- [ (x,z)- | i<j- , (k,enext) <- multibranchKJHelixIdx trnr inp strong i j- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- str k j d'- ] ++- --- -- add a helix to an existing structure- --- [ (x++y,z)- | i<j- , (k,enext) <- multibranchAddKJHelixIdx trnr inp mbr strong i j- , let d' = newD d ehere enext- , d'>=0- , (x,z') <- mul i k d'- , (y,z) <- str (k+1) j z'- ]- mul1 i j d = let ehere = mbr1!(i,j) in- --- -- Simply the strong part in a multibranch loop- --- [ (x,z)- | i<j- , (_,enext) <- multibranchIJLoopIdx trnr inp strong i j- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- str i j d'- ] ++- --- -- unpaired nucleotide on the J side- --- [ (x,z)- | i<j- , ((k,l),enext) <- multibranchUnpairedJIdx trnr inp mbr1 i j- , let d' = newD d ehere enext- , d'>=0- , (x,z) <- mul1 k l d'- ]--{--test inp' k =- let- (_,n) = bounds inp- bts = backtrack trnr inp tbls k- inp = mkPrimary inp'- trnr = fst turner2004GH- tbls@(weak,strong,mbr1,mbr,extern) = fold trnr inp- optE = extern ! (0,n)- f x- | x > 999 = " x"- | x < -999 = "-999"- | otherwise = printf "%4d" x- g t = do- let ls = splitEvery (n+1) $ map f $ toList t- putStr " "- mapM_ (printf "%4d") [0 :: Int .. (length $ head ls) -1]- putStrLn ""- zipWithM_ (\k xs -> printf "%4d" k >> mapM_ putStr xs >> putStrLn"") [0 :: Int ..] ls- in do- print "weak"- g weak- print "strong"- g strong- print "mbr L"- g mbr- print "mbr1 R"- g mbr1- print "extern"- g extern- print optE- putStrLn inp'- mapM_ (\(s,e) -> (putStr $ dotbracket s) >> (putStrLn $ " " ++ show e)) bts--}
− BioInf/RNAFold/Functions.hs
@@ -1,575 +0,0 @@-{-# LANGUAGE PatternGuards #-}-{-# LANGUAGE BangPatterns #-}-{-# LANGUAGE RecordWildCards #-}---- | These functions are implementations of RNA secondary structure folding as--- described in "Bompfuenewere et al., 2006, Variations on RNA folding and--- alignment"------ We have all the facilities needed for folding with the RNA parameter of--- Turner 2004 http://rna.urmc.rochester.edu/NNDB/turner04/ but consider only--- "double dangles" which correspond to the ViennaRNA package option "-d2".--- They are a bit easier to implement and are what is used for partition--- function calculations. In addition, it seems unlikely to see a statiscally--- relevant improvement in predication with "-d1" or "-d3".------ All functions work on an algebraic ring structure. This should make it--- easier to implement certain functionality without having to rewrite all the--- functions given here. Try deriving a new 'Ring' instance first and see if it--- /just works/.------ These functions do quite well, performancewise. GHC-HEAD with "-Odph" and--- "-fllvm" takes 14.4s, while the highly optimized viennaRNA package (the yet--- unpublished 2.0 version) takes about 1-2s on a sequence of length 1000.------ NOTE For GHC <= 6.12.3 you should copy the default instances into your--- instance BLA, otherwise the resulting code will be slow. Or you could just--- wait for the new GHC to arrive! The new one produces good code without such--- stuff.------ TODO single nucleotide bulges:--- http://rna.urmc.rochester.edu/NNDB/turner04/bulge.html , check what Vienna--- 2.0 does!--module BioInf.RNAFold.Functions- ( FoldFunctions (..)- , Table- , TurnerTables- , ringSumL- , pair- , riap- , ringProductL- , tabbedInteriorLoopDistances- ) where--import qualified Data.Vector.Unboxed as VU-import Control.Exception (assert)-import Data.List (foldl')-import qualified Data.Map as M--import Biobase.RNA-import Biobase.Turner.Tables-import Biobase.Types.Ring-import Biobase.Vienna-import Data.PrimitiveArray-import Data.Primitive.Types--import Debug.Trace.Tools--type Cell = (Int,Int)-type Table a = PrimArray Cell a-type TurnerTables a = Turner2004 ViennaPair Nucleotide a------ | The folding functions. It could happen that we need different folding--- functions with the same type, hence the class-based approach. The default--- instance uses the usual ring methods.--class (Show a, Ring a, VU.Unbox a, Prim a) => FoldFunctions a where-- stackOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- stackIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- hairpinOpt :: TurnerTables a -> Primary -> Int -> Int -> a- hairpinIdx :: TurnerTables a -> Primary -> Int -> Int -> [a]-- largeInteriorLoopOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- largeInteriorLoopIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- tabbedInteriorLoopOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- tabbedInteriorLoopIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- bulgeLOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- bulgeLIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- bulgeROpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- bulgeRIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- interior1xnLOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- interior1xnLIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- interior1xnROpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- interior1xnRIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- multibranchIJLoopOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- multibranchIJLoopIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- multibranchUnpairedJOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- multibranchUnpairedJIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- multibranchKJHelixOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- multibranchKJHelixIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Int,a)]-- multibranchAddKJHelixOpt :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> a- multibranchAddKJHelixIdx :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> [(Int,a)]-- multibranchCloseOpt :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> a- multibranchCloseIdx :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> [(Int,a)]-- externalLoopOpt :: TurnerTables a -> Primary -> Table a -> Int -> Int -> a- externalLoopIdx :: TurnerTables a -> Primary -> Table a -> Int -> Int -> [(Cell,a)]-- externalAddLoopOpt :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> a- externalAddLoopIdx :: TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> [(Int,a)] -- return only 'k' index-- -- | Calculate the ninio asymmetric malus. Can not be written using ring- -- functions alone as a 'min' or 'max' functions is required.-- calcNinio :: a -> a -> Int -> a-- -- | Applies a terminal AU/GU penalty, where required.- --- -- TODO shouldn't this be just: if CG||GC then one else termAU?-- calcTermAU :: a -> ViennaPair -> a -- ^ Apply terminal AU penalty-- -- | large hairpin loops >30 require special calculations that involve- -- 'floor', rounding and other stuff that can not be handled by the Ring- -- class alone-- calcLargeLoop :: Int -> a-- -- NOTE Copy these functions into your own instance. In most cases, your are- -- now done and get optimized loops. Each function that you do not copy uses- -- the version here. This can lead to less efficient code.- --- -- NOTE Fixed in GHC 6.13. The default instances should yield superb code!-- stackOpt trnr inp tbl i j =- VU.foldl' (.+.) zero $ stackBase trnr inp tbl i j- hairpinOpt trnr inp i j =- VU.foldl' (.+.) zero $ hairpinBase trnr inp i j- largeInteriorLoopOpt trnr inp strong i j =- VU.foldl' (.+.) zero $ largeInteriorLoopBase trnr inp strong i j- tabbedInteriorLoopOpt trnr inp strong i j =- VU.foldl' (.+.) zero $ tabbedInteriorLoopBase trnr inp strong i j- bulgeLOpt trnr inp strong i j =- VU.foldl' (.+.) zero $ bulgeLBase trnr inp strong i j- bulgeROpt trnr inp strong i j =- VU.foldl' (.+.) zero $ bulgeRBase trnr inp strong i j- interior1xnLOpt trnr inp strong i j =- VU.foldl' (.+.) zero $ interior1xnLBase trnr inp strong i j- interior1xnROpt trnr inp strong i j =- VU.foldl' (.+.) zero $ interior1xnRBase trnr inp strong i j- multibranchIJLoopOpt trnr inp strong i j =- VU.foldl' (.+.) zero $ multibranchIJLoopBase trnr inp strong i j- multibranchUnpairedJOpt trnr inp mtable i j =- VU.foldl' (.+.) zero $ multibranchUnpairedJBase trnr inp mtable i j- multibranchKJHelixOpt trnr inp strong i j =- VU.foldl' (.+.) zero $ multibranchKJHelixBase trnr inp strong i j- multibranchAddKJHelixOpt trnr inp table strong i j =- VU.foldl' (.+.) zero $ multibranchAddKJHelixBase trnr inp table strong i j- multibranchCloseOpt trnr inp m m1 i j =- VU.foldl' (.+.) zero $ multibranchCloseBase trnr inp m m1 i j- externalLoopOpt trnr inp strong i j =- VU.foldl' (.+.) zero $ externalLoopBase trnr inp strong i j- externalAddLoopOpt trnr inp strong extern i j =- VU.foldl' (.+.) zero $ externalAddLoopBase trnr inp strong extern i j-- -- NOTE copy and instanciate these functions if you have to work with many- -- candidate sequences. Otherwise you probably do not need the speed-up from- -- these functions. This stuff is for backtracking mostly as you get lists- -- of indices with attached scores.- --- -- NOTE With GHC 6.13 we should get optimized code anyways!-- stackIdx trnr inp tbl i j =- [((i+1,j-1),stackOpt trnr inp tbl i j)]- hairpinIdx trnr inp i j =- VU.toList $ hairpinBase trnr inp i j- largeInteriorLoopIdx trnr inp strong i j =- VU.toList $ VU.zip (interiorLoopIndices i j) (largeInteriorLoopBase trnr inp strong i j)- tabbedInteriorLoopIdx trnr inp strong i j =- VU.toList $ VU.zip (tabbedInteriorLoopIndices i j) $ tabbedInteriorLoopBase trnr inp strong i j- bulgeLIdx trnr inp strong i j =- VU.toList $ VU.zip (VU.map (\k -> (i+1+k,j-1)) . uncurry VU.enumFromN $ bulgeLimit i j) $ bulgeLBase trnr inp strong i j- bulgeRIdx trnr inp strong i j =- VU.toList $ VU.zip (VU.map (\k -> (i+1,j-1-k)) . uncurry VU.enumFromN $ bulgeLimit i j) $ bulgeRBase trnr inp strong i j- interior1xnLIdx trnr inp strong i j =- VU.toList $ VU.zip (VU.map (\k -> (i+1+k,j-2)) $ uncurry VU.enumFromN $ iloop1xnLimit i j) $ interior1xnLBase trnr inp strong i j- interior1xnRIdx trnr inp strong i j =- VU.toList $ VU.zip (VU.map (\k -> (i+2,j-1-k)) $ uncurry VU.enumFromN $ iloop1xnLimit i j) $ interior1xnRBase trnr inp strong i j- multibranchIJLoopIdx trnr inp strong i j =- VU.toList $ VU.zip (VU.singleton (i,j)) $ multibranchIJLoopBase trnr inp strong i j- multibranchUnpairedJIdx trnr inp mtable i j =- VU.toList $ VU.zip (VU.singleton (i,j-1)) $ multibranchUnpairedJBase trnr inp mtable i j- multibranchKJHelixIdx trnr inp strong i j =- VU.toList $ VU.zip (uncurry VU.enumFromN $ multibranchKJHelixLimit i j) $ multibranchKJHelixBase trnr inp strong i j- multibranchCloseIdx trnr inp m m1 i j = -- TODO this is wrong!- VU.toList $ VU.zip (uncurry VU.enumFromN $ multibranchCloseLimit i j) $ multibranchCloseBase trnr inp m m1 i j- multibranchAddKJHelixIdx trnr inp table strong i j =- VU.toList $ VU.zip (uncurry VU.enumFromN $ multibranchAddKJHelixLimit i j) $ multibranchAddKJHelixBase trnr inp table strong i j- externalLoopIdx trnr inp strong i j =- VU.toList $ VU.singleton ((i,j), externalLoopOpt trnr inp strong i j)- externalAddLoopIdx trnr inp strong extern i j =- VU.toList $ VU.zip (uncurry VU.enumFromN $ externalAddLoopLimit i j) $ externalAddLoopBase trnr inp strong extern i j------ * We provide a default instance working on rings.---- | Simple hairpin loops. If (i,j) pairs then, first, try to do a lookup of--- the exact sequence of the hairpin in a tabulated list. If this fails then,--- second, try length 3 hairpins and so on.--hairpinBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Int -> Int -> VU.Vector a-hairpinBase Turner2004{..} inp i j = VU.singleton go where- go- | pIJ==vpNP || l<3 = zero- | l<=6, Just v <- s `M.lookup` hairpinLookup = v- | l==3 = (hairpinL ! l) -- .*. tAU -- apparantly not anymore according to NNDB- | l>=31 = (hairpinL ! 30) .*. (hairpinMM ! (pIJ,bI,bJ)) .*. (calcLargeLoop l)- | otherwise = {-traceVal (show (i,j,pIJ,bI,bJ,hairpinL!l,tAU,hairpinMM!(pIJ,bI,bJ))) $ -} (hairpinL ! l) .*. (hairpinMM ! (pIJ,bI,bJ))- l = j-i-1- s = assert (i>=0 && checkBounds inp j) $ [inp ! k | k <- [i..j-1]]- bI = inp ! (i+1)- bJ = inp ! (j-1)- pIJ = pair inp i j- tAU = calcTermAU termAU pIJ-{-# INLINE hairpinBase #-}---- | Extend a stem by another pair.--stackBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-stackBase Turner2004{..} inp tbl i j = VU.singleton $ go (i+1,j-1) where- pIJ = pair inp i j- go (k,l)- | pIJ==vpNP || pKL==vpNP || isZero tE- = zero- | otherwise- = tE .*. ( stack ! (pIJ,pKL))- where- pKL = riap inp k l- tE = tbl ! (k,l)-{-# INLINE stackBase #-}---- | These are special cases of interior loops. Short iloops, such as 1x2 loops--- are completely tabulated. Look each one up here.------ TODO needs 1-bulges as a special case--tabbedInteriorLoopBase :: (Show a, FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-tabbedInteriorLoopBase Turner2004{..} inp strong i j = res where- res = VU.map (\(k,l) -> (strong ! (k,l)) .*. (ftabbed (k-i-1,j-l-1) (k,l))) ili- ili = tabbedInteriorLoopIndices i j- ftabbed (di,dj) (k,l)- | ds==0 && dl==1 = bulgeL!1 .*. stack!(pIJ,pKL) -- no termAU, since the helical stack continues (nndb)- | ds==1 && dl==1 = iloop1x1 ! (pIJ,pKL,bI,bJ)- | di==1 && dj==2 = iloop1x2 ! (pIJ,pKL,bI,bL,bJ)- | di==2 && dj==1 = iloop1x2 ! (pIJ,pKL,bJ,bI,bK)- | ds==2 && dl==2 = iloop2x2 ! (pIJ,pKL,bI,bK,bL,bJ)- | ds==2 && dl==3 = iloop2x3MM!(pIJ,bI,bJ) .*. iloop2x3MM ! (pKL,bL,bK) .*. iloopL ! 5 .*. ninio- where- pKL = riap inp k l- bK = inp ! (k-1)- bL = inp ! (l+1)- ds = min di dj- dl = max di dj- pIJ = pair inp i j- bI = inp ! (i+1)- bJ = inp ! (j-1)-{-# INLINE tabbedInteriorLoopBase #-}---- | A large number of iloops up to a total maximum loop size of 30 have to be--- checked. There are about 300 cases for j-i>>30. In addition, this loop does--- not like fusion very much and does many different lookups.------ TODO Any performance increase here should yield substantial improvements for--- the overall performance of folding algorithms.------ TODO performance improvement: Split mismatch calculation into its own table--- in the caller. Callee gets an additional argument.------ TODO didjs needs to go back into a *Limit function.--largeInteriorLoopBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-largeInteriorLoopBase Turner2004{..} inp strong i j = res where- res = VU.map (\(di,dj) ->- ijmm .*.- (strong ! (i+di,j-dj)) .*.- (iloopL ! (di+dj-2)) .*. -- -2 because di,dj is total IL length +2- (iloopMM ! (riap inp (i+di) (j-dj), inp ! (i+di-1), inp ! (j-dj+1))) .*.- calcNinio maxNinio ninio (abs $ di-dj)- ) didjs- -- NOTE NO FUSION! :-(- -- TODO check this!- didjs = interiorLoopDistances i j- {-- didjs = traceVal (show (i,j)) $ VU.unfoldr (\(di,dj) ->- if di>maxc- then Nothing- else if di+dj>=nexc- then Just ((di,dj),(di+1,3 ))- else Just ((di,dj),(di ,dj+1))- ) (3,5) -}- -- constant- {-- maxc = min 27 (j-i-16)- nexc = min 30 (j-i-13)- -}- ijmm = iloopMM ! (pIJ,bI,bJ)- pIJ = pair inp i j- bI = inp ! (i+1)- bJ = inp ! (j-1)-{-# INLINE largeInteriorLoopBase #-}---- | A bulge on the left side of the inner closing pair. 1-bulges are treated--- as tabulated interior loops.------ (..((...)))--- 01234567890--bulgeLBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-bulgeLBase Turner2004{..} inp strong i j = res where- res = VU.map (\k ->- strong ! (i+1+k,j-1) .*.- bulgeL ! k .*.- calcTermAU termAU (riap inp (i+1+k) (j-1)) .*.- tAUij- ) . uncurry VU.enumFromN $ bulgeLimit i j- tAUij = calcTermAU termAU $ pair inp i j-{-# INLINE bulgeLBase #-}---- | A bulge on the right side of the inner closing pair. Mirroring bulgeLBase------ ((~)...)--bulgeRBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-bulgeRBase Turner2004{..} inp strong i j = res where- res = VU.map (\k ->- strong ! (i+1,j-1-k) .*.- bulgeL ! k .*.- calcTermAU termAU (riap inp (i+1) (j-1-k)) .*.- tAUij- ) . uncurry VU.enumFromN $ bulgeLimit i j- tAUij = calcTermAU termAU $ pair inp i j-{-# INLINE bulgeRBase #-}---- | 1xn iloops work a bit like bulges. They are more complicated because we--- have to consider 'ninio' values and terminal mismatches.------ TODO how big an improvement would 'iloopL1xn' be with integrated 'ninio'--- values?------ (...(~).)--interior1xnLBase Turner2004{..} inp strong i j = res where- res = VU.map (\k ->- strong ! (i+1+k,j-2) .*.- iloopL ! (k+1) .*.- iloop1xnMM ! (riap inp (i+1+k) (j-2), inp ! (i+k), inp ! (j-1)) .*.- calcNinio maxNinio ninio (k-1) .*.- pIJmm- ) . uncurry VU.enumFromN $ iloop1xnLimit i j- pIJmm = iloop1xnMM ! (pair inp i j, inp ! (i+1), inp ! (j-1))-{-# INLINE interior1xnLBase #-}---- | A mirror to the above.------ (.(~)...)--interior1xnRBase Turner2004{..} inp strong i j = res where- res = VU.map (\k ->- strong ! (i+2,j-1-k) .*.- iloopL ! (k+1) .*.- iloop1xnMM ! (riap inp (i+2) (j-1-k), inp ! (j-k), inp ! (i+1)) .*.- calcNinio maxNinio ninio (k-1) .*.- pIJmm- ) . uncurry VU.enumFromN $ iloop1xnLimit i j- pIJmm = iloop1xnMM ! (pair inp i j, inp ! (i+1), inp ! (j-1))-{-# INLINE interior1xnRBase #-}---- | Close a multibranch loop by trying to combine one element of 'm' with one--- of 'm1'.------ <[[...]][[...]]>--- 0123456789012345--- 1--multibranchCloseBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> VU.Vector a-multibranchCloseBase Turner2004{..} inp m m1 i j = res where- res = VU.map (\k ->- m ! (i+1,k) .*.- m1 ! (k+1,j-1) .*.- ijmm .*.- mbcl- ) . uncurry VU.enumFromN $ multibranchCloseLimit i j- ijmm = multiMM ! (pIJ,bJ,bI)- mbcl = multiOffset .*. multiHelix- pIJ = riap inp i j- bI = inp ! (i+1)- bJ = inp ! (j-1)-{-# INLINE multibranchCloseBase #-}---- | Adds a multibranch loop at exactly (i,j).--multibranchIJLoopBase Turner2004{..} inp strong i j = res where- res = VU.singleton $ strong ! (i,j) .*. mbrhlx .*. mbrmm- mbrhlx = multiHelix- mbrmm = multiMM ! (pIJ,bI,bJ) -- TODO correct orientation?- pIJ = pair inp i j- bI = inp ! (i-1)- bJ = inp ! (j+1)-{-# INLINE multibranchIJLoopBase #-}---- | Trivial function that adds a single unpaired nucleotide within a--- multibranch loop.--multibranchUnpairedJBase Turner2004{..} inp mtable i j = res where- res = VU.singleton $ mtable ! (i,j-1) .*. mbrup- mbrup = multiNuc-{-# INLINE multibranchUnpairedJBase #-}---- | Adds a multibranch loop at (k,j), with k-i unpaired nucleotides to the--- left of 'k'.--multibranchKJHelixBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Int -> Int -> VU.Vector a-multibranchKJHelixBase Turner2004{..} inp strong i j = res where- res = VU.map (\k ->- multiNuc .^. (k-i) .*.- strong ! (k,j) .*.- multiHelix .*.- multiMM ! (pair inp k j, inp ! (k-1), inp ! (j+1))- ) . uncurry VU.enumFromN $ multibranchKJHelixLimit i j-{-# INLINE multibranchKJHelixBase #-}---- |--multibranchAddKJHelixBase Turner2004{..} inp table strong i j = res where- res = VU.map (\k ->- table ! (i,k) .*.- strong ! (k+1,j) .*.- multiMM ! (pair inp (k+1) j, inp ! k, inp ! (j+1))- ) . uncurry VU.enumFromN $ multibranchAddKJHelixLimit i j-{-# INLINE multibranchAddKJHelixBase #-}---- | [[...]]--- 0123456--externalLoopBase Turner2004{..} inp strong i j = res where- res = VU.singleton $ strong ! (i,j) .*. mm .*. tAU- n = snd $ bounds inp- pIJ = pair inp i j- bI = inp ! (i-1)- bJ = inp ! (j+1)- tAU = calcTermAU termAU pIJ- mm- | i>0&&j<n = extMM ! (pIJ,bI,bJ)- | i>0 = dangle5 ! (pIJ,bI)- | j<n = dangle3 ! (pIJ,bJ)- | otherwise = one-{-# INLINE externalLoopBase #-}---- |--externalAddLoopBase :: (FoldFunctions a) => TurnerTables a -> Primary -> Table a -> Table a -> Int -> Int -> VU.Vector a-externalAddLoopBase trnr@Turner2004{..} inp strong extern i j = res where- res = VU.map (\k ->- externalLoopOpt trnr inp strong i k .*.- extern ! (k+1,j)- ) . uncurry VU.enumFromN $ externalAddLoopLimit i j-{-# INLINE externalAddLoopBase #-}------ * Helper Functions.---- TODO We definitely need to check that this works!--pair :: Primary -> Int -> Int -> ViennaPair-pair inp i j- = assert (checkBounds inp i && checkBounds inp j)- $ toPair (inp `unsafeIndex` i) (inp `unsafeIndex` j)-{-# INLINE pair #-}--riap inp i j- = assert (i>=0 && j>=0 && checkBounds inp i && checkBounds inp j)- $ toPair (inp ! j) (inp ! i)-{-# INLINE riap #-}--ringSum :: (Ring a, VU.Unbox a) => VU.Vector a -> a-ringSum v = VU.foldl' (.+.) zero v-{- INLINE ringSum #-}--ringSumL :: (Ring a, VU.Unbox a) => [a] -> a-ringSumL v = foldl' (.+.) zero v-{-# INLINE ringSumL #-}--ringProduct :: (Ring a, VU.Unbox a) => VU.Vector a -> a-ringProduct v = VU.foldl' (.*.) one v-{-# INLINE ringProduct #-}--ringProductL :: (Ring a, VU.Unbox a) => [a] -> a-ringProductL v = foldl' (.*.) one v---- | Explicit index generator for interior loops. Does not create indices for:--- - bulges 0 k--- - 1xn loops 1 k--- - 2x3 loops 2 3, 3 2--- - tabulated 1 1, 1 2, 2 1, 2 2--interiorLoopDistances i j =- VU.concatMap (- \d -> VU.map (\d' -> (d',d-d')) -- written as a tuple- $ VU.enumFromN 3 (d-5)) -- for each distance, all possible left/right combinations- $ VU.enumFromN 8 (min 23 (j-i-13)) -- diagonal distance or number of unpaired nucleotides -2.-{-# INLINE interiorLoopDistances #-}---- WTF ?! the function below is 10.000x slower than the function above!--interiorLoopIndices :: Int -> Int -> VU.Vector (Int,Int)-interiorLoopIndices !i !j = VU.map (\(k,l) -> (i+k,j-l)) $ interiorLoopDistances i j-{-# INLINE interiorLoopIndices #-}------- TODO filter 'ili' to accept only indices that are not too close. Does--tabbedInteriorLoopDistances :: Int -> Int -> VU.Vector (Int,Int)-tabbedInteriorLoopDistances i j- | j-i>=8 = VU.fromList [(0,1),(1,0),(1,1),(1,2),(2,1),(2,2),(2,3),(3,2)]- | otherwise = VU.empty-{-# INLINE tabbedInteriorLoopDistances #-}---- | Yes, therer is the (+1,+1) and yes, this is inconsistent with the other function--tabbedInteriorLoopIndices i j = VU.map (\(di,dj) -> (i+di+1,j-dj-1)) $ tabbedInteriorLoopDistances i j-{-# INLINE tabbedInteriorLoopIndices #-}---- * All limits depending on (i,j) should be here.---- | Bulge limitations--bulgeLimit :: Int -> Int -> (Int,Int)-bulgeLimit i j = (2,min 29 $ j-i-9)-{-# INLINE bulgeLimit #-}---- | 1xn iloop limits--iloop1xnLimit :: Int -> Int -> (Int,Int)-iloop1xnLimit i j = (3,min 26 $ j-i-10)-{-# INLINE iloop1xnLimit #-}---- | closing of a multibranch loop--multibranchCloseLimit :: Int -> Int -> (Int,Int)-multibranchCloseLimit i j = (i+1,j-i-2) -- (i+7, j-i-14)-{-# INLINE multibranchCloseLimit #-}---- | add mb helix--multibranchAddKJHelixLimit :: Int -> Int -> (Int,Int)-multibranchAddKJHelixLimit i j = (i+1,j-i-1)-{-# INLINE multibranchAddKJHelixLimit #-}---- | mb helix--multibranchKJHelixLimit :: Int -> Int -> (Int,Int)-multibranchKJHelixLimit i j = (i,j-i)-{-# INLINE multibranchKJHelixLimit #-}---- | add external loop--externalAddLoopLimit :: Int -> Int -> (Int,Int)-externalAddLoopLimit i j = (i+5,j-i-5)-{-# INLINE externalAddLoopLimit #-}
+ BioInf/RNAfold.hs view
@@ -0,0 +1,335 @@+{-# LANGUAGE BangPatterns #-}+{-# LANGUAGE TypeOperators #-}+{-# LANGUAGE TupleSections #-}+{-# LANGUAGE NoMonomorphismRestriction #-}+{-# LANGUAGE RecordWildCards #-}++module BioInf.RNAfold where++import Control.Monad+import Control.Monad.Primitive+import Control.Monad.ST+import Data.Array.Repa.Index+import qualified Data.Vector.Fusion.Stream.Monadic as S+import qualified Data.Vector.Fusion.Stream as P+import qualified Data.Vector.Unboxed as VU+import Control.Monad.State.Lazy+import Control.Arrow (first,second,(***))+import qualified Data.List as L+import Control.Exception (assert)+import Data.Strict.Tuple hiding (fst,snd)++import Biobase.Primary+import Biobase.Secondary.Vienna++import Data.PrimitiveArray+import Data.PrimitiveArray.Unboxed.Zero++import ADP.Fusion.Monadic+import ADP.Fusion.Monadic.Internal++import Debug.Trace+import Text.Printf+import GHC.Exts++import Biobase.Primary+import Biobase.Secondary.Vienna+import Biobase.Vienna+import Biobase.Vienna.Default++import BioInf.RNAfold.Combinators+import BioInf.RNAfold.Energy+import BioInf.RNAfold.Library++++-- |++testRNAfold :: String -> (Int,[String])+testRNAfold inp' = struct `seq` bt `seq` (struct!(Z:.0:.n),bt) where+ (_,Z:._:.n) = bounds struct+ ener = fst turnerRNA2004+ inp = mkPrimary inp'+ tbls@(weak,block,comps,struct) = runST (rnafold ener inp)+ bt = btRNAfold ener inp tbls+{-# NOINLINE testRNAfold #-}++-- |+testInput = "cccacccaaagggaaaaggg"+test = testRNAfold testInput++rnafold :: Vienna2004 -> Primary -> ST s+ ( Arr0 DIM2 Int+ , Arr0 DIM2 Int+ , Arr0 DIM2 Int+ , Arr0 DIM2 Int+ )+rnafold ener inp = do++ let !n = let (_,Z:.l) = bounds inp in l+1+ let base = base' inp+ {-# INLINE base #-}+ let baseLr = baseLr' inp+ {-# INLINE baseLr #-}+ let baselR = baselR' inp+ {-# INLINE baselR #-}+ let basepairing = basepairing' inp+ {-# INLINE basepairing #-}+ let stackpairing = stackpairing' inp+ {-# INLINE stackpairing #-}+ let reglen = reglen' inp+ {-# INLINE reglen #-}+ let primary = primary' inp+ {-# INLINE primary #-}+ let primaryPR = primaryPR' inp+ {-# INLINE primaryPR #-}+ let primaryPL = primaryPL' inp+ {-# INLINE primaryPL #-}+ -- this is a bit unfortunate, but otherwise we get type inference problems+ let hS :: S.Stream (ST s) Int -> ScalarM (ST s Int)+ hS = ScalarM . S.foldl' min (999999::Int)+ {-# INLINE hS #-}++ weak <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 999999 []+ block <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 999999 []+ comps <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 999999 []+ struct <- fromAssocsM (Z:.0:.0) (Z:.n:.n) 0 []++ fillTables+ weak (+ multiOF ener <<< baseLr -~+ (multiIF ener <<< block +~+ comps ... hS) +~- baselR |||+ iloopOF ener <<< baseLr -~+ (iloopIF ener <<< primary #~~ weak ~~# primary ... hS) +~- baselR |||+ iloop1NF ener <<< primary ---~+ weak +~@ primary |||+ iloopN1F ener <<< primary @~+ weak +~--- primary |||+ bulgeRF ener <<< baseLr -~+ weak +~* primary |||+ bulgeLF ener <<< primary *~+ weak +~- baselR |||+ tinyloopF ener <<< primaryPR &~+ weak +~& primaryPL |||+ hairpinF ener <<< baseLr -~+ primary +~- baselR ... h `with` basepairing )+ block (+ adjustStream n (justStemF ener <<< baseLr -~+ weak +~- baselR) |||+ regionStemF ener <<< base -~+ block ... h )+ comps (+ bsF <<< block +~+ reglen |||+ bcF <<< block +~+ comps |||+ iD <<< block ... h )+ struct (+ iD <<< weak |||+ rSF <<< base -~~ struct |||+ cmF <<< weak +~+ struct |||+ nilF <<< empty ... h `with` constrained (\(Z:.i:.j) -> j==n) )++ weak' <- freeze weak+ block' <- freeze block+ comps' <- freeze comps+ struct' <- freeze struct++ return+ ( weak'+ , block'+ , comps'+ , struct'+ )+{-# INLINE rnafold #-}++infixl 9 *~+, +~*, &~+, +~&, ---~+, +~@, +~---, @~+++(*~+) = makeLeft_MinRight (3,31) 1+{-# INLINE (*~+) #-}++(+~*) = makeMinLeft_Right 1 (3,31)+{-# INLINE (+~*) #-}++(&~+) = makeLeft_MinRight (1,4) 1+{-# INLINE (&~+) #-}++(+~&) = makeMinLeft_Right 1 (1,4)+{-# INLINE (+~&) #-}++(---~+) = makeLeft_MinRight (3,3) 1+{-# INLINE (---~+) #-}++(+~@) = makeMinLeft_Right 1 (5,31)+{-# INLINE (+~@) #-}++(+~---) = makeMinLeft_Right 1 (3,3)+{-# INLINE (+~---) #-}++(@~+) = makeLeft_MinRight (5,31) 1+{-# INLINE (@~+) #-}++-- * backtracking+--+-- For now, we replicate the grammar as the optimizer is rather fragile++btRNAfold+ :: Vienna2004+ -> Primary+ -> (Arr0 DIM2 Int, Arr0 DIM2 Int, Arr0 DIM2 Int, Arr0 DIM2 Int)+ -> [String]+btRNAfold ener inp (weak,block,comps,struct) = structG (Z:.0:.n) where++ !n = let (_,Z:.l) = bounds inp in l+1+ base = base' inp+ baseLr = baseLr' inp+ baselR = baselR' inp+ reglen = reglen' inp+ basepairing = basepairing' inp+ primary = primary' inp+ primaryPR = primaryPR' inp+ primaryPL = primaryPL' inp++ --++ weak' :: DIM2 -> Scalar (Int, [String])+ weak' ij = Scalar (weak!ij, weakG ij)++ block' :: DIM2 -> Scalar (Int, [String])+ block' ij = Scalar (block!ij, blockG ij)++ comps' :: DIM2 -> Scalar (Int, [String])+ comps' ij = Scalar (comps!ij, compsG ij)++ struct' :: DIM2 -> Scalar (Int, [String])+ struct' ij = Scalar (struct!ij, structG ij)++ --++ weakG :: DIM2 -> [String]+ weakG = (+ multiBT ener <<< baseLr -~+ block' +~+ comps' +~- baselR |||+ iloopBT ener <<< baseLr -~+ primary #~~ weak' ~~# primary +~- baselR |||+ iloop1NBT ener <<< primary ---~+ weak' +~@ primary |||+ iloopN1BT ener <<< primary @~+ weak' +~--- primary |||+ bulgeRBT ener <<< baseLr -~+ weak' +~* primary |||+ bulgeLBT ener <<< primary *~+ weak' +~- baselR |||+ tinyloopBT ener <<< primaryPR &~+ weak' +~& primaryPL |||+ hairpinBT ener <<< baseLr -~+ primary +~- baselR ..@ (hBT weak) `withBT` basepairing+ )++ blockG :: DIM2 -> [String]+ blockG = (+ adjustStreamBT n (justStemBT ener <<< baseLr -~+ weak' +~- baselR) |||+ regionStemBT ener <<< base -~+ block' ..@ (hBT block)+ )++ compsG :: DIM2 -> [String]+ compsG = (+ bsBT <<< block' +~+ reglen |||+ bcBT <<< block' +~+ comps' |||+ iDBT <<< block' ..@ (hBT comps)+ )++ structG :: DIM2 -> [String]+ structG = (+ iDBT <<< weak' |||+ rSBT <<< base -~~ struct' |||+ cmBT <<< weak' +~+ struct' |||+ nilBT <<< empty ..@ (hBT struct `withBT` constrained (\(Z:.i:.j) -> j==n) )+ )++ multiBT ener l (b,bS) (c,cS) r =+ let e = multiOF ener l (multiIF ener b c) r+ in (e, ["("++x++y++")" | x<-bS, y<-cS])+ iloopBT ener lo ls@(_:!:li:!:lj) (w,wS) rs@(_:!:ri:!:rj) ro =+ let e = iloopOF ener lo (iloopIF ener ls w rs) ro+ in (e, L.map (\s -> "("++replicate (lj-li) '.'++"("++s++")"++replicate (rj-ri) '.'++")") wS)+ iloop1NBT ener ls (w,wS) rs@(_:!:ri:!:rj) =+ let e = iloop1NF ener ls w rs+ in (e, L.map (\s -> "(.("++s++")"++replicate (rj-ri-1) '.'++")") wS)+ iloopN1BT ener ls@(_:!:li:!:lj) (w,wS) rs =+ let e = iloopN1F ener ls w rs+ in (e, L.map (\s -> "("++replicate (lj-li-1) '.'++"("++s++").)") wS)+ bulgeRBT ener ls (w,wS) rs@(_:!:ri:!:rj) =+ let e = bulgeRF ener ls w rs+ in (e, L.map (\s -> "("++s++"."++replicate (rj-ri-1) '.'++")") wS)+ bulgeLBT ener ls@(_:!:li:!:lj) (w,wS) rs =+ let e = bulgeLF ener ls w rs+ in (e, L.map (\s -> "("++replicate (lj-li-1) '.'++"."++s++")") wS)+ hairpinBT ener llp reg@(xs:!:i:!:j) rpr =+ let e = hairpinF ener llp reg rpr+ in (e, ["(" ++ replicate (j-i+1) '.' ++ ")"])+ tinyloopBT ener ls@(_:!:li:!:lj) (w,sW) rs@(_:!:ri:!:rj) =+ let e = tinyloopF ener ls w rs+ in (e, L.map (\s -> "("++replicate (lj-li-1) '.'++s++replicate (rj-ri-1) '.'++")") sW)++ regionStemBT ener nc (w,sW) =+ let e = regionStemF ener nc w+ in (e, L.map (\s -> "." ++ s) sW)+ justStemBT ener llp (w,sW) rpr =+ let e = justStemF ener llp w rpr+ in (e, sW)++ bcBT (b,bW) (c,cW) =+ let e = b+c+ in (e,[ x++y | x<-bW, y<-cW ])+ bsBT (b,bW) reg = (b, L.map (++ replicate reg '.') bW)+ iDBT = id++ ssBT len = (ssF len, [replicate len '.'])+ rSBT n (w,wS) =+ let e = rSF n w+ in (e, map ("."++) wS)+ cmBT (w,wS) (s,sS) =+ let e = cmF w s+ in (e, [x++y | x<-wS, y<-sS])+ nilBT b = if b then (nilF b, [""]) else (nilF b, [])++ hBT tbl ij = L.concatMap snd . L.filter ((tbl!ij==).fst) . P.toList+++-- * different energy functions (very simplified signature)++++-- * Functions that will be part of a bioinformatics DP library++++-- **++adjustStream :: Int -> (DIM2 -> S.Stream (ST s) Int) -> DIM2 -> S.Stream (ST s) Int+adjustStream !n sgen (Z:.i:.j)+ | i>0 && j<n = sgen (Z:.i-1:.j+1)+ | otherwise = S.empty+{-# INLINE adjustStream #-}++adjustStreamBT :: Int -> (DIM2 -> P.Stream elm) -> DIM2 -> P.Stream elm+adjustStreamBT !n sgen (Z:.i:.j)+ | i>0 && j<n = sgen (Z:.i-1:.j+1)+ | otherwise = P.empty+{-# INLINE adjustStreamBT #-}++infixl 6 .!.+(.!.) stream (h,n) (Z:.i:.j)+ | i>0 && j<n = h $ stream (Z:.i-1:.j+1)+ | otherwise = h $ S.empty+{-# INLINE (.!.) #-}++-- |++infixl 5 `with`+with xs cond ij = if cond ij then xs ij else return 999999+{-# INLINE with #-}++infixl 5 `withBT`+withBT xs cond ij = if cond ij then xs ij else return []++-- |++fillTables+ :: PrimMonad m+ => MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+ -> MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+ -> MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+ -> MArr0 (PrimState m) DIM2 Int -> (DIM2 -> m Int)+ -> m ()+fillTables aT aF bT bF cT cF dT dF = do+ let (_,Z:.n:._) = boundsM aT+ forM_ [n,n-1 .. 0] $ \i -> forM_ [i..n] $ \j -> do+ let ij = Z:.i:.j+ aF ij >>= writeM aT ij+ bF ij >>= writeM bT ij+ cF ij >>= writeM cT ij+ dF ij >>= writeM dT ij+{-# INLINE fillTables #-}+
+ BioInf/RNAfold/Combinators.hs view
@@ -0,0 +1,52 @@+{-# LANGUAGE TemplateHaskell #-}+{-# LANGUAGE NoMonomorphismRestriction #-}++-- | RNAfold combinators, extracted for quickcheck++module BioInf.RNAfold.Combinators+ ( (~~#)+ , (#~~)+ ) where++import Data.Array.Repa.Index+import qualified Data.Vector.Fusion.Stream as S+import Data.List++import qualified ADP.Fusion as F+import qualified ADP.Fusion.Monadic as M+import qualified ADP.Fusion.Monadic.Internal as F+import ADP.Fusion.Monadic (makeLeft_MinRight)+import ADP.Fusion.Monadic.Internal (Box(..))++++infixl 9 #~~, ~~#++-- | The structure on the left is a subword with size 2-28. The maximal size+-- could be 30 but since the two combinators are linked, 29,30 would fail+-- anyways.++(#~~) = makeLeft_MinRight (3,30) 1+{-# INLINE (#~~) #-}++-- | The structure on the right is a subword with size 2-30, however we inspect+-- the stack an reduce the maximal size.++(~~#) xs ys = Box mk step xs ys where+ minT = 8 -- minimal total size of region+ minC = 3 -- minimal number of nuc's on the right+ maxC = 32+ {-# INLINE mk #-}+ mk (z:.k:.j,a,b) = let (_:.i) = z+ cnsmd = k-i -- consumed part+ l = max k (j-maxC+cnsmd)+ in return (z:.k:.l:.j,a,b)+ {-# INLINE step #-}+ step (z:.k:.l:.j,a,b)+ | l<=j-(max 0 $ minT - cnsmd) && l+minC<=j+ = return $ S.Yield (z:.k:.l:.j,a,b) (z:.k:.l+1:.j,a,b)+ | otherwise = return $ S.Done+ where cnsmd = k-i+ (_:.i) = z+{-# INLINE (~~#) #-}+
+ BioInf/RNAfold/Energy.hs view
@@ -0,0 +1,252 @@+{-# LANGUAGE PackageImports #-}+{-# LANGUAGE TypeOperators #-}+{-# LANGUAGE RecordWildCards #-}++-- | A set of energy functions that are modelled after the ViennaRNA package,+-- Version 2 (with d=2).+--+-- As part of the design, we could have (i) either continued giving many+-- parameters or (ii) have fewer parameters that require input of the+-- (Primary,Index,Index) type. Since the compilation speed of the grammars+-- using these functions depends on the number of arguments (in case (i)+-- compilation takes minutes!), this approach has benefits for testing the+-- fusion library.+--+-- This means compilation is a lot faster, but runtime is not @2.8x@ slower but+-- @3.5x@ slower.++module BioInf.RNAfold.Energy where++import Control.Exception (assert)+import Data.Strict.Tuple hiding (fst,snd)+import qualified Data.Vector.Fusion.Stream.Monadic as S++import Biobase.Primary+import Biobase.Secondary.Vienna+import Biobase.Vienna+import Data.PrimitiveArray+import "PrimitiveArray" Data.Array.Repa.Index++import Debug.Trace++++-- | Hairpin structures. Hairpins with less than 3 unpaired nucleotides are+-- forbidden.+--+-- NOTE @(xs,i,j)@ is indeed *only* the unpaired stretch. Hence, the length is+-- @j-i+1@, as given.+--+-- TODO Activate tabulated hairpin structures.++hairpinF :: Vienna2004 -> (Nuc :!: Nuc) -> (Primary :!: Int :!: Int) -> (Nuc :!: Nuc) -> Int+hairpinF Vienna2004{..} (l :!: lp) (xs :!: i :!: j) (rp :!: r) = hairpinType where+ {-# INLINE hairpinType #-}+ hairpinType+ -- TODO use sliceEq for tabulated hairpins+ {-+ | len <= 6, Just v <- find tabulated hairpin+ -}+ | len < 3 = 999999+ | len == 3 = hairpinL!(Z:.len) + tAU+ | len > 31 = hairpinL!(Z:.30) + hairpinMM!(Z:.p:.lp:.rp) + llp+ | otherwise = hairpinL!(Z:.len) + hairpinMM!(Z:.p:.lp:.rp)+ p = mkViennaPair (l,r)+ len = j-i+1+ tAU = if p/=vpCG && p/=vpGC then termAU else 0+ llp = floor $ 108.856 * log (fromIntegral len / 30)+{-# INLINE hairpinF #-}++-- | Tiny loops are small interior loops. This includes canonical stacks+-- without any unpaired nucleotides, and small, tabulated interior loops.++tinyloopF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+tinyloopF Vienna2004{..} (ls :!: li :!: lj) w (rs :!: ri :!: rj) = assert (assertL && assertR) $ loopType where+ assertL = let (_,Z:.n) = bounds ls in li>=0 && lj<=n+ assertR = let (_,Z:.n) = bounds rs in ri>=0 && rj<=n+ {-# INLINE loopType #-}+ loopType+ | dl==0 || dr==0 = error $ "bug in tinyloop: " ++ show (li,lj,[ls!(Z:.k) | k<-[li..lj]],ri,rj,[rs!(Z:.l) | l<-[ri..rj]])+ -- normal stack+ | dl==1 && dr==1 = w+stack!(Z:.op:.ip)+ -- one intervening unpaired nucleotide doesn't break the stack+ | dl==1 && dr==2 = w+stack!(Z:.op:.ip)+bulgeL!(Z:.1)+ | dl==2 && dr==1 = w+stack!(Z:.op:.ip)+bulgeL!(Z:.1)+ -- 1x1 symmetric interior loop+ | dl==2 && dr==2 = w+iloop1x1!(Z:.op:.ip:.bI:.bJ)+ -- 1x2 interior loop+ | dl==2 && dr==3 = w+iloop2x1!(Z:.op:.ip:.bI:.bL:.bJ)+ -- 2x1 interior loop+ | dl==3 && dr==2 = w+iloop2x1!(Z:.op:.ip:.bJ:.bI:.bK)+ -- 2x2 interior loop+ | dl==3 && dr==3 = w+iloop2x2!(Z:.op:.ip:.bI:.bK:.bL:.bJ)+ -- 2x3 interior loops with specialized mismatches+ | dl==3 && dr==4+ || dl==4 && dr==3 = w+iloop2x3MM!(Z:.op:.bI:.bJ) + iloop2x3MM!(Z:.ip:.bL:.bK) + iloopL!(Z:.5) + ninio+ | otherwise = 999999 -- overlaps with big interior loops+ op = mkViennaPair (ls!(Z:.li),rs!(Z:.rj))+ ip = mkViennaPair (rs!(Z:.ri),ls!(Z:.lj))+ bI = ls!(Z:.li+1)+ bJ = rs!(Z:.rj-1)+ bK = ls!(Z:.lj-1)+ bL = rs!(Z:.ri+1)+ dl = lj-li+ dr = rj-ri+{-# INLINE tinyloopF #-}++-- | A left bulge @(....[[...]])@ which four unpaired nucleotides in the bulge.+-- the left bulge @ls@ will be given six nucleotides (note, @ls@ is the+-- complete input, use @li@ and @lj@ as the first and last included nucleotide+-- index), the two outer ones being for the outer and inner loop. On the right,+-- we have @rp@ and @r@ which are nucleotides. @ls!(Z:.li)@ and @r@ form the+-- outer Vienna pair. @rp@ and @ls!(Z:.lj)@ form the inner pair.++bulgeLF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Nuc :!: Nuc) -> Int+bulgeLF Vienna2004{..} (ls :!: li :!: lj) w (rp :!: r) = assert (lj-li<=30) $ w + tAUlr + lenE + tAUrpcp where+ tAUlr = terminalAU termAU lr+ tAUrpcp = terminalAU termAU rpcp+ lr = mkViennaPair (ls!(Z:.li),r)+ rpcp = mkViennaPair (rp,ls!(Z:.lj))+ lenE = bulgeL!(Z:.lj-li-1)+{-# INLINE bulgeLF #-}++-- | A right bulge @([[...]]....)@. See 'bulgeLF' for how this works.++bulgeRF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Primary :!: Int :!: Int) -> Int+bulgeRF Vienna2004{..} (l :!: lp) w (rs :!: ri :!: rj) = assert (rj-ri<=30) $ w + tAUlr + lenE + tAUcplp where+ tAUlr = terminalAU termAU lr+ tAUcplp = terminalAU termAU cplp+ lr = mkViennaPair (l,rs!(Z:.rj))+ cplp = mkViennaPair (rs!(Z:.ri),lp)+ lenE = bulgeL!(Z:.rj-ri-1)+{-# iNLINE bulgeRF #-}++-- | An interior loop with @N@ unpaired nucleotides to the left and @1@+-- unpaired nucleotide to the right. The regions @ls@ and @rs@ each have 2+-- nucleotides more than are unpaired. These first and last nucleotides form+-- the last paired or first pairs in the stacks around the loop.++iloopN1F :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+iloopN1F Vienna2004{..} (ls:!:li:!:lj) w (rs:!:ri:!:rj)+ = assert (lj-li-1 <=29 && rj-ri == 2)+ $ w + outerMM + lenE + innerMM + owninio where+ poLR = mkViennaPair (ls!(Z:.li), rs!(Z:.rj))+ piRL = mkViennaPair (rs!(Z:.ri), ls!(Z:.lj))+ outerMM = iloop1xnMM!(Z:.poLR:.ls!(Z:.li+1):.rs!(Z:.ri+1))+ innerMM = iloop1xnMM!(Z:.piRL:.rs!(Z:.ri+1):.ls!(Z:.lj-1))+ lenE = iloopL!(Z:.(lL+1))+ owninio = min maxNinio (ninio * (lL-1))+ lL = lj-li-1+ lR = rj-ri-1+{-# INLINE iloopN1F #-}++-- | 1xN interior loops.++iloop1NF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+iloop1NF Vienna2004{..} (ls :!: li :!: lj) w (rs :!: ri :!: rj)+ = assert (lj-li == 2 && rj-ri-1 <=29)+ $ w + outerMM + lenE + innerMM + owninio where+ poLR = mkViennaPair (ls!(Z:.li), rs!(Z:.rj))+ piRL = mkViennaPair (rs!(Z:.ri), ls!(Z:.lj))+ outerMM = iloop1xnMM!(Z:.poLR:.ls!(Z:.li+1):.rs!(Z:.rj-1))+ innerMM = iloop1xnMM!(Z:.piRL:.rs!(Z:.ri+1):.ls!(Z:.li+1))+ lenE = iloopL!(Z:.(lR+1))+ owninio = min maxNinio (ninio * (lR-1))+ lL = lj-li-1+ lR = rj-ri-1+{-# INLINE iloop1NF #-}++iloopIF :: Vienna2004 -> (Primary :!: Int :!: Int) -> Int -> (Primary :!: Int :!: Int) -> Int+iloopIF Vienna2004{..} (ls :!: li :!: lj) w (rs :!: ri :!: rj) = w + iloopMM!(Z:.p:.bR:.bL) + iloopL!(Z:.len) + owninio where+ p = mkViennaPair (rs!(Z:.ri), ls!(Z:.lj))+ bL = ls!(Z:.lj-1)+ bR = rs!(Z:.ri+1)+ len = (lj-li)+(rj-ri)+ owninio = min maxNinio (ninio * (abs $ (lj-li) - (rj-ri)))+{-# INLINE iloopIF #-}++-- |++iloopOF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Nuc :!: Nuc) -> Int+iloopOF Vienna2004{..} (l :!: lp) iloopif (rp :!: r) = {- CORE "iloopOF" -} iloopif + iloopMM!(Z:.op:.lp:.rp)+ where op = mkViennaPair (l,r)+{-# INLINE iloopOF #-}++-- |++multiIF :: Vienna2004 -> Int -> Int -> Int+multiIF Vienna2004{..} b c = b+c+{-# INLINE multiIF #-}++-- |++multiOF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Nuc :!: Nuc) -> Int+multiOF Vienna2004{..} (l :!: lp) multiif (rp :!: r) = multiif + multiMM!(Z:.p:.lp:.rp) + multiHelix + multiOffset + terminalAU termAU p+ where p = mkViennaPair (l,r)+{-# INLINE multiOF #-}++-- |++regionStemF :: Vienna2004 -> Nuc -> Int -> Int+regionStemF Vienna2004{..} _ w = w + multiNuc+{-# INLINE regionStemF #-}++-- |++justStemF :: Vienna2004 -> (Nuc :!: Nuc) -> Int -> (Nuc :!: Nuc) -> Int+justStemF Vienna2004{..} (l :!: lp) w (rp :!: r) = w + multiMM!(Z:.p:.l:.r)+ where p = mkViennaPair (lp,rp)+{-# INLINE justStemF #-}++-- |++bsF :: Int -> Int -> Int+bsF b reg = b+{-# INLINE bsF #-}++-- |++rSF :: Nuc -> Int -> Int+rSF nuc w = w+{-# INLINE rSF #-}++-- |++bcF :: Int -> Int -> Int+bcF b c = b + c+{-# INLINE bcF #-}++-- |++ssF :: Int -> Int+ssF reg = 0+{-# INLINE ssF #-}++-- |++cmF :: Int -> Int -> Int+cmF w s = w+s+{-# INLINE cmF #-}++-- |++nilF :: Bool -> Int+nilF e = if e then 0 else 999999+{-# INLINE nilF #-}++-- |++iD = id+{-# INLINE iD #-}++-- |++h :: Monad m => S.Stream m Int -> m Int+h = S.foldl' min (999999::Int)+{-# INLINE h #-}++-- |++terminalAU termAU p = if p/=vpCG && p/=vpGC then termAU else 0+{-# INLINE terminalAU #-}+
+ BioInf/RNAfold/Library.hs view
@@ -0,0 +1,140 @@+{-# LANGUAGE TypeOperators #-}++-- | A library of helpers for ADPfusion algorithms.++module BioInf.RNAfold.Library where++import Control.Exception (assert)+import Data.Array.Repa.Index+import Debug.Trace+import qualified Data.Vector.Unboxed as VU+import Data.Strict.Tuple hiding (fst,snd)++import Biobase.Primary+import Biobase.Secondary.Vienna+import Data.PrimitiveArray++import ADP.Fusion.Monadic+import ADP.Fusion.Monadic.Internal++++-- |++base' :: Primary -> DIM2 -> (Scalar Nuc)+base' inp (Z:.i:.j) = Scalar $ index inp (Z:.i)+{-# INLINE base' #-}++-- | Nucleotide, second one to the right. The assertion allows a size of one or+-- two to capture special cases of looking outside of the bounds (used by+-- @justStemF@ in RNAfold).++baseLr' :: Primary -> DIM2 -> (Scalar (Nuc :!: Nuc))+baseLr' inp (Z:.i:.j)+ = assert (let (_,Z:.n) = bounds inp in (i+1==j || i+2==j) && i>=0 && i+1<=n)+ . Scalar $ (index inp (Z:.i) :!: index inp (Z:.i+1))+{-# INLINE baseLr' #-}++-- |++baselR' :: Primary -> DIM2 -> (Scalar (Nuc :!: Nuc))+baselR' inp (Z:.i:.j)+ = assert (let (_,Z:.n) = bounds inp in i+1==j && i>0 && i<=n)+ . Scalar $ (index inp (Z:.i-1) :!: index inp (Z:.i))+{-# INLINE baselR' #-}++-- |++region' :: VU.Vector Nuc -> DIM2 -> (Scalar (VU.Vector Nuc))+region' inp (Z:.i:.j)+ = assert (let n = VU.length inp -1 in i<=j && i>=0 && j<=n+1)+ . Scalar $ VU.unsafeSlice i (j-i) inp+{-# INLINE region' #-}++-- | A 'Primary' together with the lowest included nucleotide and the highest+-- included nucleotide.++primary' :: Primary -> DIM2 -> (Scalar (Primary :!: Int :!: Int))+primary' inp (Z:.i:.j)+ = assert (let (_,Z:.u) = bounds inp in i>=0 && j-1<=u && i<=j)+ $ Scalar (inp :!: i :!: j-1)+{-# INLINE primary' #-}++-- | A 'Primary' together with the lowest included nucleotide and the highest+-- included nucleotide.++primaryPR' :: Primary -> DIM2 -> (Scalar (Primary :!: Int :!: Int))+primaryPR' inp (Z:.i:.j)+ = assert (let (_,Z:.u) = bounds inp in i>=0 && j-2<=u && i<=j)+ $ Scalar (inp :!: i :!: j)+{-# INLINE primaryPR' #-}++-- | A 'Primary' together with the lowest included nucleotide and the highest+-- included nucleotide.++primaryPL' :: Primary -> DIM2 -> (Scalar (Primary :!: Int :!: Int))+primaryPL' inp (Z:.i:.j)+ = assert (let (_,Z:.u) = bounds inp in i>0 && j-1<=u && i<=j)+ $ Scalar (inp :!: i-1 :!: j-1)+{-# INLINE primaryPL' #-}++-- | Vector of nucleotides peeking one nucleotide to the left.++regionpl' :: VU.Vector Nuc -> DIM2 -> (Scalar (VU.Vector Nuc))+regionpl' inp (Z:.i:.j)+ = assert (let n = VU.length inp -1 in i-1<=j && i>0 && j<=n+1)+ . Scalar $ VU.unsafeSlice (i-1) (j-i+1) inp+{-# INLINE regionpl' #-}++-- | Vector of nucleotides peeaking one nucleotide to the right.++regionpr' :: VU.Vector Nuc -> DIM2 -> (Scalar (VU.Vector Nuc))+regionpr' inp (Z:.i:.j)+ = assert (let n = VU.length inp -1 in i<=j && i>=0 && j+1<=n+1)+ . Scalar $ VU.unsafeSlice i (j-i+1) inp+{-# INLINE regionpr' #-}++-- | Tests if (i,j) is a valid base pair. ++basepairing' inp (Z:.i:.j) = tf+ where p = mkViennaPair (inp!(Z:.i), inp!(Z:.j-1))+ Z:.n = snd . bounds $ inp+ tf = i>=0 && j>0 && i<=j && j-1<=n && i<=n && p /= vpNS+{-# INLINE basepairing' #-}++stackpairing' inp k (Z:.i:.j) = tf+ where ps = [ mkViennaPair (inp!(Z:.i+l), inp!(Z:.j-1-l)) | l <-[0..k-1] ]+ Z:.n = snd . bounds $ inp+ tf = i>=k-1 && j>k-1 && i+k-1<=j-k+1 && j-k<=n && i+k-1<=n && all (/=vpNS) ps+{-# INLINE stackpairing' #-}++constrained cns ij = cns ij+{-# INLINE constrained #-}++-- |++reglen' :: Primary -> DIM2 -> Scalar Int+reglen' inp (Z:.i:.j)+ = assert (let (Z:.o,Z:.n) = bounds inp in i>=0 && (j<=n+1 || n== -1) && i<=j)+ . Scalar $ j-i+{-# INLINE reglen' #-}++-- |++reglenpl' :: Primary -> DIM2 -> Scalar (Nuc,Nuc,Int)+reglenpl' inp (Z:.i:.j)+ = assert (let (_,Z:.n) = bounds inp in i>0 && j<=n && i<=j)+ . Scalar $ (index inp (Z:.i-1),index inp (Z:.i),j-i)+{-# INLINE reglenpl' #-}++reglenpr' :: Primary -> DIM2 -> Scalar (Int,Nuc,Nuc)+reglenpr' inp (Z:.i:.j)+ = assert (let (_,Z:.n) = bounds inp in i>=0 && j<n && i<=j)+ . Scalar $ (j-i,index inp (Z:.j-1), index inp (Z:.j))+{-# INLINE reglenpr' #-}++-- | True, if the subword at ij is empty.++empty :: DIM2 -> Scalar Bool+empty (Z:.i:.j) = Scalar $ i==j+
+ BioInf/RNAfold/QuickCheck.hs view
@@ -0,0 +1,31 @@++module BioInf.RNAfold.QuickCheck where++import Test.QuickCheck+import Test.QuickCheck.All++import ADP.Fusion.QuickCheck.Arbitrary -- hiding (options,customCheck,allProps)++++-- * property checking++fCombined (i,j) = S.toList $ (,,) F.<<< fRegion #~~ fRegion ~~# fRegion F.... id $ Z:.i:.j++bCombined (i,j) = [ ( (i,k),(k,l),(l,j) )+ | k <- [i..j]+ , l <- [k..j]+ , k-i >= 3+ , j-l >= 3+ , (k-i) + (j-l) >= 8+ , (k-i) + (j-l) <= 32+ ]++prop_Combined (Small i, Small j) = fCombined (i,j) == bCombined (i,j)++options = stdArgs {maxSuccess = 1000}++customCheck = quickCheckWithResult options++allProps = $forAllProperties customCheck+
+ README.md view
@@ -0,0 +1,39 @@++ViennaRNA RNAfold v2, MFE variant+using the ADPfusion library++++Introduction+============++This algorithm is the second, and much larger, test case for ADPfusion. We+implement "RNAfold v2" in the MFE variant using "-d2" dangles. Both a library+version and an executable are created. The "RNAFold" binary expects single+sequences, one per line. Backtracking tracks all co-optimal structures.++++Installation+============++A simple "cabal update && cabal-dev install RNAFold" should be enough.++++Runtime notes+=============++Using Haskell and ADPfusion, we come to within x3-x4 for this package. Between+the initial test case / submission (in 0.0.0.3) I have traded in some+performance improvements for much better readability in BioInf.RNAfold.Energy.+The C version of RNAfold employs some other methods to improve performance.+Consider:++base -~+ inner-1 +~- base+base -~+ inner-2 +~- base++where it is advantageous to calculate the outer basepair only once, not twice+as we are doing. It is probably better to try to improve the handling of+fusioned code and/or final assembler generation than finding calculations+common to different parts of CFG's.
RNAFold.cabal view
@@ -1,64 +1,102 @@ name: RNAFold-version: 0.0.2.1-author: Christian Hoener zu Siederdissen (Haskell), Ivo L. Hofacker et al (ViennaRNA)+version: 1.99.1.0+author: Christian Hoener zu Siederdissen (Haskell), Ivo L. Hofacker et al (ViennaRNA), 2010-2012+copyright: Christian Hoener zu Siederdissen, 2010-2012+homepage: http://www.tbi.univie.ac.at/~choener/adpfusion maintainer: choener@tbi.univie.ac.at-copyright: Christian Hoener zu Siederdissen, 2010 category: Bioinformatics-synopsis: RNA secondary structure prediction license: GPL-3 license-file: LICENSE build-type: Simple stability: experimental-cabal-version: >= 1.4.0+cabal-version: >= 1.6.0+synopsis: RNA secondary structure prediction description:- Provides the folding functions as used in the ViennaRNA- package. Here, they are in Haskell form to be used by Haskell- programs.+ RNAfold v2 using the ADPfusion library. The RNAfold algorithm+ is used to determine how fast we can be compared to a highly+ optimized C program. .- - This is a release aimed at testing Data.Vector- - Expect major performance issues with GHC < 6.13!+ If possible, build using the GHC llvm backend, and GHC-7.2.2.+ GHC-7.4.x produces very bad code on my system, please benchmark+ using 7.2.2.+ .+ NOTE I'd like to rename this package to RNAfold, like the C+ implementation. Do not install "globally", especially if you+ normally use RNAfold from the ViennaRNA package, for obvious+ reasons.+ .+ NOTE I am reluctant to call this v2 for now. +Extra-Source-Files:+ BioInf/RNAfold/QuickCheck.hs+ README.md++Flag llvm+ description: build using llvm backend+ default: True+++ library build-depends:- base >=4 && <5,- containers,- vector >=0.7,- primitive >=0.3,+ base >= 4 && < 5,+ mtl,+ strict,+ primitive == 0.4.* ,+ vector == 0.9.* ,+ PrimitiveArray == 0.2.1.1 ,+ BiobaseVienna == 0.2.2.3 ,+ BiobaseXNA == 0.6.2.2 ,+ ADPfusion == 0.0.1.0+ exposed-modules:+ BioInf.RNAfold+ BioInf.RNAfold.Combinators+ BioInf.RNAfold.Energy+ BioInf.RNAfold.Library+ ghc-options:+ -Odph+ -funbox-strict-fields+ -fspec-constr+ -funfolding-use-threshold100+ -funfolding-keeness-factor100+ if flag (llvm)+ ghc-options:+ -fllvm -optlo-O3 -optlo-inline -optlo-std-compile-opts - Biobase >=0.0.2,- BiobaseTurner >=0.0.2,- BiobaseVienna >=0.0.2,- BiobaseTypes >=0.0.2,- HsTools >=0.0.1.1,- PrimitiveArray >=0.0.2 && <0.0.3 - exposed-modules:- BioInf.RNAFold,- BioInf.RNAFold.Energy,- BioInf.RNAFold.EnergyInt,- BioInf.RNAEval,- BioInf.RNAFold.Functions - if impl(ghc > 6.13)+executable RNAFold+ build-depends:+ base >= 4 && < 5,+ mtl,+ strict,+ primitive == 0.4.* ,+ vector == 0.9.* ,+ PrimitiveArray == 0.2.1.1 ,+ BiobaseVienna == 0.2.2.3 ,+ BiobaseXNA == 0.6.2.2 ,+ ADPfusion == 0.0.1.0+ main-is:+ RNAFold.hs+ other-modules:+ BioInf.RNAfold+ BioInf.RNAfold.Combinators+ BioInf.RNAfold.Energy+ BioInf.RNAfold.Library+ ghc-options:+ -rtsopts+ -Odph+ -funbox-strict-fields+ -fspec-constr+ -funfolding-use-threshold100+ -funfolding-keeness-factor100+ if flag (llvm) ghc-options:- -Odph- -fllvm- -fforce-recomp- -funbox-strict-fields- -fllvm- -optlo-O3- -optlc-O3- -fdicts-cheap- -fspec-constr- -funbox-strict-fields- -funfolding-use-threshold=100- -funfolding-creation-threshold=100- else- ghc-options:-Odph+ -fllvm -optlo-O3 -optlo-inline -optlo-std-compile-opts --- -fno-method-sharing -- performance does not improve!--- -fdicts-cheap--- -fspec-constr--- -funbox-strict-fields--- -funfolding-use-threshold=100--- -funfolding-creation-threshold=100+++source-repository head+ type: git+ location: git://github.com/choener/RNAfold+
+ RNAFold.hs view
@@ -0,0 +1,18 @@++-- | Simple wrapper around STrnafold++module Main where++import BioInf.RNAfold++++main = do+ xs <- fmap lines getContents+ mapM_ doRNAfold xs++doRNAfold inp = do+ let (e,bs) = testRNAfold inp+ putStrLn inp+ print e+ mapM_ putStrLn bs