ClustalParser 1.2.3 → 1.3.0

raw patch · 10 files changed

+525/−488 lines, 10 filesdep ~parsecPVP ok

version bump matches the API change (PVP)

Dependency ranges changed: parsec

API changes (from Hackage documentation)

Files

• Biobase/Clustal.hs +10/−0
• Biobase/Clustal/Import.hs +294/−0
• Biobase/Clustal/Types.hs +131/−0
• ChangeLog.md +57/−0
• ClustalParser.cabal +26/−23
• ClustalParserTest.hs +3/−4
• changelog +0/−30
• src/Bio/ClustalData.hs +0/−133
• src/Bio/ClustalParser.hs +0/−294
• test-suite/ClustalParserSpec.hs +4/−4

@@ -0,0 +1,10 @@+-- | Types and functions for Clustal+--++module Biobase.Clustal+  ( module Biobase.Clustal.Types+  , module Biobase.Clustal.Import+  ) where++import Biobase.Clustal.Import+import Biobase.Clustal.Types

@@ -0,0 +1,294 @@+-- | Parse Clustal output+--   For more information on Clustal tools consult: <http://www.clustal.org/>+module Biobase.Clustal.Import (+                       parseClustalAlignment,+                       readClustalAlignment,+                       parseStructuralClustalAlignment,+                       readStructuralClustalAlignment,+                       parseClustalSummary,+                       readClustalSummary,+                       module Biobase.Clustal.Types+                      ) where++import Biobase.Clustal.Types+import Text.ParserCombinators.Parsec+import Control.Monad+import Data.List+import qualified Data.Text as T+readDouble :: String -> Double+readDouble = read++readInt :: String -> Int+readInt = read++-- | Parse the input as ClustalSummary datatype+genParserClustalSummary :: GenParser Char st ClustalSummary+genParserClustalSummary = do+  newline+  newline+  newline+  space+  string "CLUSTAL "+  version <- many1 (noneOf " ")+  many1 (noneOf "\n")+  newline+  newline+  newline+  string "Sequence format is "+  sequenceFormat' <- many1 (noneOf "\n")+  newline+  sequenceParametersList <- many1 (try genParserSequenceParameters)+  string "Start of Pairwise alignments"+  newline+  string "Aligning..."+  newline+  newline+  pairwiseAlignmentSummaryList <- many1 genParserPairwiseAlignmentSummary+  string "Guide tree file created:   ["+  guideTreeFileName' <- many1 (noneOf "]")+  char ']'+  newline+  newline+  string "There are "+  numberOfGroups <- many1 digit+  string " groups"+  newline+  string "Start of Multiple Alignment"+  newline+  newline+  string "Aligning..."+  newline+  groupSummaryList <- many1 genParserGroupSummary+  string "Alignment Score "+  alignmentScore' <- many1 digit+  newline+  newline+  string "CLUSTAL-Alignment file created  ["+  alignmentFileName' <- many1 (noneOf "]")+  char ']'+  newline+  newline+  eof+  return $ ClustalSummary (T.pack version) (T.pack sequenceFormat') sequenceParametersList pairwiseAlignmentSummaryList (T.pack guideTreeFileName') (readInt numberOfGroups) groupSummaryList (readInt alignmentScore') (T.pack alignmentFileName')++genParserGroupSummary :: GenParser Char st GroupSummary+genParserGroupSummary = do+  string "Group "+  groupIndex <- many1 digit+  string ":"+  optional space+  optional (string "Sequences:")+  many1 space+  sequenceNumber <- optionMaybe (many1 digit)+  optional (many1 space)+  string "Score:" <|>  string "Delayed"+  groupScore' <- optionMaybe (many1 digit)+  newline+  return $ GroupSummary (readInt groupIndex) (liftM readInt sequenceNumber) (liftM readInt groupScore')++genParserPairwiseAlignmentSummary :: GenParser Char st PairwiseAlignmentSummary+genParserPairwiseAlignmentSummary = do+  string "Sequences ("+  firstSeqIndex <- many1 digit+  string ":"+  secondSeqIndex <- many1 digit+  string ") Aligned. Score:"+  many1 space+  pairwiseScore <- many1 digit+  newline+  return $ PairwiseAlignmentSummary (readInt firstSeqIndex) (readInt secondSeqIndex) (readInt pairwiseScore)++genParserSequenceParameters :: GenParser Char st SequenceParameters+genParserSequenceParameters = do+  string "Sequence "+  sequenceIndexParam <- many1 digit+  string ": "+  sequenceIdentifierParam <- many1 (noneOf " ")+  spaces+  sequenceLengthParam <- many1 digit+  space+  string "bp"+  newline+  return $ SequenceParameters (readInt sequenceIndexParam) (T.pack sequenceIdentifierParam) (readInt sequenceLengthParam)++-- | Parse the input as ClustalAlignment datatype+genParserClustalAlignment :: GenParser Char st ClustalAlignment+genParserClustalAlignment = do+  string "CLUSTAL"+  many1 (noneOf "\n")+  many1 (try newline)+  alignmentSlices <- many1 (try genParserClustalAlignmentSlice)+  optional newline+  eof+  return (mergealignmentSlices alignmentSlices)++mergealignmentSlices :: [ClustalAlignmentSlice] -> ClustalAlignment+mergealignmentSlices slices = alignment+  where entrySlicesList = concatMap entrySlices slices -- list of lists of entry slices+        sequenceIdentifiers = nub (map entrySequenceSliceIdentifier entrySlicesList)+        mergedAlignmentEntries = map (constructAlignmentEntries entrySlicesList) sequenceIdentifiers+        mergedConservationTrack = concatMap conservationTrackSlice slices+        alignment = ClustalAlignment mergedAlignmentEntries (T.pack mergedConservationTrack)++constructAlignmentEntries ::  [ClustalAlignmentEntrySlice] -> String -> ClustalAlignmentEntry+constructAlignmentEntries slices entryIdentifier= entry+  where currentSlices = filter (\a -> entrySequenceSliceIdentifier a == entryIdentifier) slices+        entrySequence = concatMap entryAlignedSliceSequence currentSlices+        entry = ClustalAlignmentEntry (T.pack entryIdentifier) (T.pack entrySequence)++genParserClustalAlignmentSlice :: GenParser Char st ClustalAlignmentSlice+genParserClustalAlignmentSlice = do+  entrySlices' <- many1 genParserClustalEntrySlice+  --extract length of identifier and spacer to determine offset of conservation track+  let offsetLenght = length (entrySequenceSliceIdentifier (head entrySlices')) + spacerLength (head entrySlices')+  conservationTrackSliceChoice  <- choice [(lookAhead (string "\n")), (try (genParserConservationTrackSlice offsetLenght))]+  --spacerAndConservationTrackSlice <- many1 (noneOf "\n")+  --let conservationTrackSlice' = drop offsetLenght spacerAndConservationTrackSlice+  --newline+  let conservationTrackSlice' = if (conservationTrackSliceChoice == "\n") then "" else conservationTrackSliceChoice+  optional newline+  return $ ClustalAlignmentSlice entrySlices' conservationTrackSlice'++genParserConservationTrackSlice :: Int -> GenParser Char st String+genParserConservationTrackSlice offsetLenght = do+  spacerAndConservationTrackSlice <- many1 (noneOf "\n")+  let conservationTrackSlice' = drop offsetLenght spacerAndConservationTrackSlice+  newline+  return $ conservationTrackSlice'++genParserClustalEntrySlice :: GenParser Char st ClustalAlignmentEntrySlice+genParserClustalEntrySlice = do+  sliceIdentifier <- many1 (noneOf " \n")+  spacer <- many1 (char ' ')+  sliceSequence <- parseNucleotideAlignmentEntry+  newline+  return $ ClustalAlignmentEntrySlice sliceIdentifier sliceSequence (length spacer)++--Structural Clustal Parser functions++-- | Parse the input as ClustalAlignment datatype as used in mlocarna+genParserStructuralClustalAlignment :: GenParser Char st StructuralClustalAlignment+genParserStructuralClustalAlignment = do+  genParseMlocarnaHeader+  alignmentSlices <- many1 (try genParserStructuralClustalAlignmentSlice)+  secondaryStructure <- genSecondaryStructure+  energy' <- genParseEnergy+  eof+  return (mergeStructuralAlignmentSlices (concat alignmentSlices) secondaryStructure energy')++genSecondaryStructure :: GenParser Char st String+genSecondaryStructure = do+  string "alifold"+  secondaryStructure <- many1 (try genSecondaryStructureSlice)+  return (concat secondaryStructure)++genSecondaryStructureSlice :: GenParser Char st String+genSecondaryStructureSlice = do+  many1 space+  secondaryStructureSlice <- many1 (try (oneOf ".()"))+  choice [try (string "\n"),try (string " ")]+  return secondaryStructureSlice++genParseEnergy :: GenParser Char st Double+genParseEnergy = do+  string "("+  many space+  energy' <- many1 (noneOf " ")+  optional space+  char ('=')+  many1 (noneOf "\n")+  newline+  return (readDouble energy')++genParseMlocarnaHeader :: GenParser Char st String+genParseMlocarnaHeader = do+  string "mLocARNA"+  many1 (choice [alphaNum,oneOf "-: ()."])+  newline+  string "Copyright"+  many1 (choice [alphaNum,char ' '])+  newline+  newline+  string "Compute pair probs ..."+  newline+  optional (try (string "Compute pairwise alignments ... "))+  optional (try newline)+  string "Perform progressive alignment ..."+  many1 newline+  return ""++mergeStructuralAlignmentSlices :: [StructuralClustalAlignmentEntrySlice] -> String -> Double -> StructuralClustalAlignment+mergeStructuralAlignmentSlices slices secondaryStructure energy' = alignment+  where sequenceIdentifiers = nub (map structuralEntrySequenceSliceIdentifier slices)+        mergedAlignmentEntries = map (constructStructuralAlignmentEntries slices) sequenceIdentifiers+        alignment = StructuralClustalAlignment mergedAlignmentEntries (T.pack secondaryStructure) energy'++constructStructuralAlignmentEntries ::  [StructuralClustalAlignmentEntrySlice] -> String -> ClustalAlignmentEntry+constructStructuralAlignmentEntries slices entryIdentifier= entry+  where currentSlices = filter (\a -> structuralEntrySequenceSliceIdentifier a == entryIdentifier) slices+        entrySequence = concatMap structuralEntryAlignedSliceSequence currentSlices+        entry = ClustalAlignmentEntry (T.pack entryIdentifier) (T.pack entrySequence)++genParserStructuralClustalAlignmentSlice :: GenParser Char st [StructuralClustalAlignmentEntrySlice]+genParserStructuralClustalAlignmentSlice = do+  entrySlices' <- many1 (try genParserStructuralClustalEntrySlice)+  optional newline+  return entrySlices'++genParserStructuralClustalEntrySlice :: GenParser Char st StructuralClustalAlignmentEntrySlice+genParserStructuralClustalEntrySlice = do+  sliceIdentifier <- many1 (noneOf " ")+  many1 (char ' ')+  sliceSequence <- parseNucleotideAlignmentEntry+  newline+  return $ StructuralClustalAlignmentEntrySlice (filter (/='\n') sliceIdentifier) sliceSequence++-- exported functions++-- | Parse Clustal alignment (.aln) from String+parseClustalAlignment :: String -> Either ParseError ClustalAlignment+parseClustalAlignment = parse genParserClustalAlignment "genParserClustalAlignment"++-- | Parse Clustal alignment (.aln) from filehandle+readClustalAlignment :: String ->  IO (Either ParseError ClustalAlignment)+readClustalAlignment = parseFromFile genParserClustalAlignment++-- | Parse Clustal alignment (.aln) with secondary structure in dot-bracket notation from String (as produced by mlocarna)+parseStructuralClustalAlignment :: String ->  Either ParseError StructuralClustalAlignment+parseStructuralClustalAlignment = parse genParserStructuralClustalAlignment "genParserStructuralClustalAlignment"++-- | Parse Clustal alignment (.aln) with secondary structure in dot-bracket notation from filehandle (as produced by mlocarna)+readStructuralClustalAlignment :: String ->  IO (Either ParseError StructuralClustalAlignment)+readStructuralClustalAlignment = parseFromFile genParserStructuralClustalAlignment++-- |  Parse Clustal summary (printed to STDOUT) from String+parseClustalSummary :: String ->   Either ParseError ClustalSummary+parseClustalSummary = parse genParserClustalSummary "genParserClustalSummary"++-- | Parse Clustal summary (printed to STDOUT) from file+readClustalSummary ::  String -> IO (Either ParseError ClustalSummary)+readClustalSummary = parseFromFile genParserClustalSummary++-- | Parse nucleotide sequence. Allowed letters according to IUPAC+--parseNucleotideSequence :: GenParser Char st String+--parseNucleotideSequence = do+--  nucleotideSequence <- many1 (oneOf "RYSWKMBDHVNATUGCryswkmbdhvnatugc")+--  return $ nucleotideSequence++-- | Parse nucleotide alignment entry. Allowed letters according to IUPAC and commonly used gap characters+parseNucleotideAlignmentEntry :: GenParser Char st String+parseNucleotideAlignmentEntry = do+  entry <- many1 (oneOf "~_-.RYSWKMBDHVNATUGCryswkmbdhvnatugc")+  return $ entry++-- | Parse protein amino acid code sequence. Allowed letters according to IUPAC+--parseProteinSequence :: GenParser Char st String+--parseProteinSequence = do+--  proteinSequence <- many1 (oneOf "ABCDEFGHIKLMNPQRSTVWXYZabcdefghiklmnpqrstvwxyz")+--  return $ proteinSequence++-- | Parse protein amino acid code alignment entry. Allowed letters according to IUPAC and commonly used gap characters+--parseProteinAlignmentEntry :: GenParser Char st String+--parseProteinAlignmentEntry = do+--  entry <- many1 (oneOf "~_-.ABCDEFGHIKLMNPQRSTVWXYZabcdefghiklmnpqrstvwxyz")+--  return $ entry

@@ -0,0 +1,131 @@+-- | This module contains data structures for the Clustal tools+--   For more information on Clustal tools consult: <http://www.clustal.org/>++module Biobase.Clustal.Types where+import qualified Data.Vector as V+import qualified Data.Text as T++-- | Data type for clustal summary, containing information about the alignment process, usually printed to STDOUT+data ClustalSummary = ClustalSummary+  {+    clustalw2version :: T.Text,+    sequenceFormat :: T.Text,+    parametersOfInputSequences :: [SequenceParameters],+    pairwiseAlignmentSummaries :: [PairwiseAlignmentSummary],+    guideTreeFileName :: T.Text,+    groupNumber :: Int,+    groupSummaries :: [GroupSummary],+    alignmentScore :: Int,+    alignmentFileName :: T.Text+  }+  deriving (Show, Eq)++data SequenceParameters = SequenceParameters+  {+     inputSequenceIndex :: Int,+     inputSequenceIdentifier :: T.Text,+     inputSequenceLength :: Int+  }+  deriving (Show, Eq)++data PairwiseAlignmentSummary = PairwiseAlignmentSummary+  {+     firstSequenceIndex :: Int,+     secondSequenceIndex :: Int,+     pairwiseAlignmentScore :: Int+  }+  deriving (Show, Eq)++data GroupSummary = GroupSummary+  {+     alignmentGroupIndex :: Int,+     numberOfAlignedSequences :: Maybe Int,+     groupScore :: Maybe Int+  }+  deriving (Show, Eq)++-- | Data structure for Clustal alignment format+data ClustalAlignment = ClustalAlignment+  {+    alignmentEntries :: [ClustalAlignmentEntry],+    conservationTrack :: T.Text+  }+  deriving (Eq)++instance Show ClustalAlignment where+  show (ClustalAlignment _alignmentEntries _conservationTrack )+    | not (null _alignmentEntries) = header ++ alignmentString+    | otherwise = header+    where header = "CLUSTAL W (1.8) multiple sequence alignment\n\n\n"+          longestSequenceIdLength =  (maximum (map T.length (map entrySequenceIdentifier _alignmentEntries))) + 1+          totalSequenceLength = T.length (entryAlignedSequence (head _alignmentEntries))+          alignmentString = showAlignment totalSequenceLength longestSequenceIdLength 0 _alignmentEntries _conservationTrack++showAlignment :: Int -> Int -> Int -> [ClustalAlignmentEntry] -> T.Text -> String+showAlignment totalSequenceLength longestSequenceIdLength currentWindowPosition _alignmentEntries _conservationTrack+  | totalSequenceLength == 0 = []+  | currentWindowPosition < totalSequenceLength = showAlignmentBlock longestSequenceIdLength currentWindowPosition _alignmentEntries _conservationTrack ++ (showAlignment totalSequenceLength longestSequenceIdLength (currentWindowPosition + 60) _alignmentEntries _conservationTrack)+  | currentWindowPosition == totalSequenceLength = []+  | otherwise = ""++showAlignmentBlock :: Int -> Int -> [ClustalAlignmentEntry] -> T.Text -> String+showAlignmentBlock longestSequenceIdLength currentWindowPosition _alignmentEntries _conservationTrack = blockString+  where blockString = entries ++ extraTrack ++ "\n"+        entries = concatMap (showAlignmentLine longestSequenceIdLength currentWindowPosition) _alignmentEntries+        extraTrack = concat (replicate longestSequenceIdLength " ") ++ V.toList (V.slice currentWindowPosition 60  (V.fromList (T.unpack _conservationTrack))) ++ "\n"++showAlignmentLine :: Int -> Int -> ClustalAlignmentEntry -> String+showAlignmentLine longestSequenceIdLength currentWindowPosition _alignmentEntry = T.unpack (entrySequenceIdentifier _alignmentEntry) ++ concat (replicate (longestSequenceIdLength - T.length (entrySequenceIdentifier _alignmentEntry)) " ") ++ V.toList (V.slice currentWindowPosition 60  (V.fromList (T.unpack (entryAlignedSequence _alignmentEntry)))) ++ "\n"++data ClustalAlignmentEntry = ClustalAlignmentEntry+  {+    entrySequenceIdentifier :: T.Text,+    entryAlignedSequence :: T.Text+  }+  deriving (Show, Eq)++data ClustalAlignmentSlice = ClustalAlignmentSlice+  {+    entrySlices :: [ClustalAlignmentEntrySlice],+    conservationTrackSlice :: String+  }+  deriving (Show, Eq)++data ClustalAlignmentEntrySlice = ClustalAlignmentEntrySlice+   {+     entrySequenceSliceIdentifier :: String,+     entryAlignedSliceSequence :: String,+     spacerLength :: Int+   }+   deriving (Show, Eq)++-- | Data structure for structural Clustal alignment format+data StructuralClustalAlignment = StructuralClustalAlignment+  {+    structuralAlignmentEntries :: [ClustalAlignmentEntry],+    secondaryStructureTrack :: T.Text,+    energy :: Double+  }+  deriving (Eq)++instance Show StructuralClustalAlignment where+  show (StructuralClustalAlignment _alignmentEntries _secondaryStructureTrack _energy)+    | not (null _alignmentEntries) = header ++ alignmentString+    | otherwise = header+    where header = "CLUSTAL W \n\n"+          longestSequenceIdLength =  (maximum (map T.length (map entrySequenceIdentifier _alignmentEntries))) + 1+          totalSequenceLength = T.length (entryAlignedSequence (head _alignmentEntries))+          alignmentString = showAlignment totalSequenceLength longestSequenceIdLength 0 _alignmentEntries _secondaryStructureTrack++-- data StructuralClustalAlignmentSlice = StructuralClustalAlignmentSlice+--   {+--     structuralEntrySlices :: [StructuralClustalAlignmentEntrySlice]+--   }+--   deriving (Show, Eq)++data StructuralClustalAlignmentEntrySlice = StructuralClustalAlignmentEntrySlice+  {+    structuralEntrySequenceSliceIdentifier :: String,+    structuralEntryAlignedSliceSequence :: String+  }+  deriving (Show, Eq)

@@ -0,0 +1,57 @@+-*-change-log-*-++### 1.3.0 [Florian Eggenhofer](mailto:egg@cs.uni-freiburg.de) 14. November 2019++  * Fixed requested tick number for compilation with GHC 8.6.*+  * Changed to Biobase style++### 1.2.3 [Florian Eggenhofer](mailto:egg@cs.uni-freiburg.de) 12. March 2018++  * Fixed parsing of additional newline in Biopythons AlignIO output without conservation track++### 1.2.2 [Florian Eggenhofer](mailto:egg@cs.uni-freiburg.de) 07. March 2018++  * Clustal parser can now parse alignments with missing consensus annotation++### 1.2.1 [Florian Eggenhofer](mailto:egg@cs.uni-freiburg.de) 06. February 2017++  * Structural alignment parser now works with multiline consensus structures++### 1.2.0 [Florian Eggenhofer](mailto:egg@cs.uni-freiburg.de) 07. January 2017++  * Changed datastructures for sequence identifers and sequences to Data.Text++### 1.1.4 [Florian Eggenhofer](mailto:egg@cs.uni-freiburg.de) 30. May 2016++  * Fixed a bug in output of clustal alignments with sequence length of 60++### 1.1.3 [Florian Eggenhofer](mailto:florian.eggenhofer@univie.ac.at) 4. July 2015++  * Nucleotide sequences are now parsed by a unified function in line with IUPAC nucleotide code++### 1.1.2 [Florian Eggenhofer](mailto:florian.eggenhofer@univie.ac.at) 3. July 2015++  * Included parsing of optional field in mlocarna clustal output++### 1.1.1 [Florian Eggenhofer](mailto:florian.eggenhofer@univie.ac.at) 2. July 2015++  * Added support for cmalign clustal output .++### 1.1.0 [Florian Eggenhofer](mailto:florian.eggenhofer@univie.ac.at) 1. July 2015++  * Added Hspec test-suite for parsing functions+  * Added Show instances for ClustalAlignment and StructuralClustalAlignment++### 1.0.3 [Florian Eggenhofer](mailto:florian.eggenhofer@univie.ac.at) 19. April 2015++  * Added Y (pyrimidine) and R (purine) to sequence characters++### 1.0.2 [Florian Eggenhofer](mailto:florian.eggenhofer@univie.ac.at> 19. March 2015++	* Linebreaks are now filtered from structural alignment sequence identifiers++### 1.0.1 [Florian Eggenhofer](mailto:florian.eggenhofer@univie.ac.at> 27. October 2014++	* Fixed compiler warnings and updated documentation to mention structural clustal format+	* Added -Wall and -O2 compiler options+	* Added support for clustal alignments with secondary structure annotation

@@ -1,29 +1,28 @@ name:                ClustalParser-version:             1.2.3+version:             1.3.0 synopsis:            Libary for parsing Clustal tools output description:         Currently contains parsers and datatypes for: clustalw2, clustalo, mlocarna, cmalign                      .                      Clustal tools are multiple sequence alignment tools for biological sequence like DNA, RNA and Protein.                      For more information on clustal Tools refer to <http://www.clustal.org/>.                      .-                     Mlocarna is a multiple sequence alignment tool for RNA sequences with secondary structure output. +                     Mlocarna is a multiple sequence alignment tool for RNA sequences with secondary structure output.                      For more information on mlocarna refer to <http://www.bioinf.uni-freiburg.de/Software/LocARNA/>.                      .                      Cmalign is a multiple sequence alignment program based on RNA family models and produces                      ,among others, clustal output. It is part of infernal <http://infernal.janelia.org/>.-                     + license:             GPL-3 license-file:        LICENSE author:              Florian Eggenhofer maintainer:          egg@informatik.uni-freiburg.de--- copyright: category:            Bioinformatics build-type:          Simple-cabal-version:       >=1.8-Tested-With: GHC == 7.10.3, GHC == 8.0.2, GHC == 8.2.2+cabal-version:       >=1.10.0+Tested-With: GHC == 8.4.4, GHC == 8.6.5, GHC == 8.8.1  extra-source-files:-  README.md changelog+  README.md ChangeLog.md  source-repository head   type:     git@@ -31,31 +30,35 @@  source-repository this   type:     git-  location: https://github.com/eggzilla/ClustalParser/tree/1.2.3-  tag:      1.2.3+  location: https://github.com/eggzilla/ClustalParser/tree/1.3.0+  tag:      1.3.0  -library-  -- Modules exported by the library.-  exposed-modules:   Bio.ClustalParser-  other-modules:     Bio.ClustalData+Library+  Hs-Source-Dirs:      .+  ghc-options:         -Wall -fno-warn-unused-do-bind -fsimpl-tick-factor=500+  default-language:    Haskell2010+  build-depends:       base >=4.5 && <5,+                       parsec>=3.1.9,+                       vector,+                       text+  Exposed-Modules:     Biobase.Clustal+                       Biobase.Clustal.Import+                       Biobase.Clustal.Types -  -- Other library packages from which modules are imported.-  build-depends:       base >=4.5 && <5, parsec>=3.1.9, vector, text -  -- compiler options-  ghc-options:         -Wall -fno-warn-unused-do-bind-  -- Directories containing source files.-  hs-source-dirs:      src-   executable ClustalParserTest   main-is:          ClustalParserTest.hs-  build-depends:    base >= 4 && <= 5, cmdargs, ClustalParser, either-unwrap-  -- compiler options  -  ghc-options:         -Wall+  build-depends:    base >= 4 && <= 5, cmdargs, ClustalParser, either-unwrap, text, vector, parsec+  -- compiler options+  ghc-options:      -Wall -fno-warn-unused-do-bind  -fsimpl-tick-factor=500+  default-language: Haskell2010+  other-modules:    Biobase.Clustal.Import+                    Biobase.Clustal.Types  test-suite hspec     build-depends:    base, parsec, ClustalParser, hspec >= 2.0, text, hspec-discover     hs-source-dirs:   test-suite+    default-language: Haskell2010     main-is:          Spec.hs     type:             exitcode-stdio-1.0     other-modules:    ClustalParserSpec

@@ -1,16 +1,15 @@ --runghc -package-db --ghc-arg=.cabal-sandbox/x86_64-linux-ghc-8.0.1-packages.conf.d  ClustalParserTest.hs struct-multiline.mlocarna module Main where-    + import System.Environment (getArgs)-import Bio.ClustalParser+import Biobase.Clustal.Import --import Data.Either.Unwrap  main :: IO () main = do   args <- getArgs-  let input_file = (head args)                                     +  let input_file = (head args)   -- read Clustal outputfile   parsedinput <- readStructuralClustalAlignment input_file   print parsedinput   --print $ structuralAlignmentEntries (fromRight parsedinput)- 

@@ -1,30 +0,0 @@--*-change-log-*--1.2.3 Florian Eggenhofer <egg@cs.uni-freiburg.de> 12. March 2018-        * Fixed parsing of additional newline in Biopythons AlignIO output without conservation track-1.2.2 Florian Eggenhofer <egg@cs.uni-freiburg.de> 07. March 2018-        * Clustal parser can now parse alignments with missing consensus-	annotation-1.2.1 Florian Eggenhofer <egg@cs.uni-freiburg.de> 06. February 2017-        * Structural alignment parser now works with multiline consensus structures-1.2.0 Florian Eggenhofer <egg@cs.uni-freiburg.de> 07. January 2017-        * Changed datastructures for sequence identifers and sequences to Data.Text-1.1.4 Florian Eggenhofer <egg@cs.uni-freiburg.de> 30. May 2016-        * Fixed a bug in output of clustal alignments with sequence length of 60-1.1.3 Florian Eggenhofer <florian.eggenhofer@univie.ac.at> 4. July 2015-        * Nucleotide sequences are now parsed by a unified function in line-	with IUPAC nucleotide code-1.1.2 Florian Eggenhofer <florian.eggenhofer@univie.ac.at> 3. July 2015-        * Included parsing of optional field in mlocarna clustal output-1.1.1 Florian Eggenhofer <florian.eggenhofer@univie.ac.at> 2. July 2015-        * Added support for cmalign clustal output .-1.1.0 Florian Eggenhofer <florian.eggenhofer@univie.ac.at> 1. July 2015-        * Added Hspec test-suite for parsing functions-	* Added Show instances for ClustalAlignment and StructuralClustalAlignment-1.0.3 Florian Eggenhofer <florian.eggenhofer@univie.ac.at> 19. April 2015-	* Added Y (pyrimidine) and R (purine) to sequence characters-1.0.2 Florian Eggenhofer <florian.eggenhofer@univie.ac.at> 19. March 2015-	* Linebreaks are now filtered from structural alignment sequence identifiers-1.0.1 Florian Eggenhofer <florian.eggenhofer@univie.ac.at> 27. October 2014-	* Fixed compiler warnings and updated documentation to mention structural clustal format-	* Added -Wall and -O2 compiler options-	* Added support for clustal alignments with secondary structure annotation

@@ -1,133 +0,0 @@--- | This module contains data structures for the Clustal tools ---   For more information on Clustal tools consult: <http://www.clustal.org/>--module Bio.ClustalData where-import qualified Data.Vector as V-import qualified Data.Text as T-       --- | Data type for clustal summary, containing information about the alignment process, usually printed to STDOUT-data ClustalSummary = ClustalSummary-  {-    clustalw2version :: T.Text,-    sequenceFormat :: T.Text,-    parametersOfInputSequences :: [SequenceParameters],-    pairwiseAlignmentSummaries :: [PairwiseAlignmentSummary],-    guideTreeFileName :: T.Text,-    groupNumber :: Int,-    groupSummaries :: [GroupSummary],-    alignmentScore :: Int,-    alignmentFileName :: T.Text-  }-  deriving (Show, Eq)--data SequenceParameters = SequenceParameters-  {-     inputSequenceIndex :: Int,-     inputSequenceIdentifier :: T.Text,-     inputSequenceLength :: Int-  }-  deriving (Show, Eq)--data PairwiseAlignmentSummary = PairwiseAlignmentSummary-  {-     firstSequenceIndex :: Int,-     secondSequenceIndex :: Int,-     pairwiseAlignmentScore :: Int-  }-  deriving (Show, Eq)--data GroupSummary = GroupSummary-  {-     alignmentGroupIndex :: Int,-     numberOfAlignedSequences :: Maybe Int,-     groupScore :: Maybe Int-  }-  deriving (Show, Eq)---- | Data structure for Clustal alignment format-data ClustalAlignment = ClustalAlignment-  { -    alignmentEntries :: [ClustalAlignmentEntry],-    conservationTrack :: T.Text-  }-  deriving (Eq)--instance Show ClustalAlignment where-  show (ClustalAlignment _alignmentEntries _conservationTrack ) -    | not (null _alignmentEntries) = header ++ alignmentString-    | otherwise = header-    where header = "CLUSTAL W (1.8) multiple sequence alignment\n\n\n" -          longestSequenceIdLength =  (maximum (map T.length (map entrySequenceIdentifier _alignmentEntries))) + 1-          totalSequenceLength = T.length (entryAlignedSequence (head _alignmentEntries))-          alignmentString = showAlignment totalSequenceLength longestSequenceIdLength 0 _alignmentEntries _conservationTrack--showAlignment :: Int -> Int -> Int -> [ClustalAlignmentEntry] -> T.Text -> String-showAlignment totalSequenceLength longestSequenceIdLength currentWindowPosition _alignmentEntries _conservationTrack-  | totalSequenceLength == 0 = [] -  | currentWindowPosition < totalSequenceLength = showAlignmentBlock longestSequenceIdLength currentWindowPosition _alignmentEntries _conservationTrack ++ (showAlignment totalSequenceLength longestSequenceIdLength (currentWindowPosition + 60) _alignmentEntries _conservationTrack)-  | currentWindowPosition == totalSequenceLength = []                                               -  | otherwise = ""--showAlignmentBlock :: Int -> Int -> [ClustalAlignmentEntry] -> T.Text -> String-showAlignmentBlock longestSequenceIdLength currentWindowPosition _alignmentEntries _conservationTrack = blockString-  where blockString = entries ++ extraTrack ++ "\n"-        entries = concatMap (showAlignmentLine longestSequenceIdLength currentWindowPosition) _alignmentEntries-        extraTrack = concat (replicate longestSequenceIdLength " ") ++ V.toList (V.slice currentWindowPosition 60  (V.fromList (T.unpack _conservationTrack))) ++ "\n"--showAlignmentLine :: Int -> Int -> ClustalAlignmentEntry -> String-showAlignmentLine longestSequenceIdLength currentWindowPosition _alignmentEntry = T.unpack (entrySequenceIdentifier _alignmentEntry) ++ concat (replicate (longestSequenceIdLength - T.length (entrySequenceIdentifier _alignmentEntry)) " ") ++ V.toList (V.slice currentWindowPosition 60  (V.fromList (T.unpack (entryAlignedSequence _alignmentEntry)))) ++ "\n"--data ClustalAlignmentEntry = ClustalAlignmentEntry-  {-    entrySequenceIdentifier :: T.Text,-    entryAlignedSequence :: T.Text-  }-  deriving (Show, Eq)--data ClustalAlignmentSlice = ClustalAlignmentSlice-  {-    entrySlices :: [ClustalAlignmentEntrySlice],-    conservationTrackSlice :: String-  }-  deriving (Show, Eq)--data ClustalAlignmentEntrySlice = ClustalAlignmentEntrySlice-   {-     entrySequenceSliceIdentifier :: String,-     entryAlignedSliceSequence :: String,-     spacerLength :: Int-   }-   deriving (Show, Eq)---- | Data structure for structural Clustal alignment format-data StructuralClustalAlignment = StructuralClustalAlignment-  { -    structuralAlignmentEntries :: [ClustalAlignmentEntry],-    secondaryStructureTrack :: T.Text,-    energy :: Double-  }-  deriving (Eq)--instance Show StructuralClustalAlignment where-  show (StructuralClustalAlignment _alignmentEntries _secondaryStructureTrack _energy) -    | not (null _alignmentEntries) = header ++ alignmentString-    | otherwise = header-    where header = "CLUSTAL W \n\n" -          longestSequenceIdLength =  (maximum (map T.length (map entrySequenceIdentifier _alignmentEntries))) + 1-          totalSequenceLength = T.length (entryAlignedSequence (head _alignmentEntries))-          alignmentString = showAlignment totalSequenceLength longestSequenceIdLength 0 _alignmentEntries _secondaryStructureTrack---- data StructuralClustalAlignmentSlice = StructuralClustalAlignmentSlice---   {---     structuralEntrySlices :: [StructuralClustalAlignmentEntrySlice]---   }---   deriving (Show, Eq)--data StructuralClustalAlignmentEntrySlice = StructuralClustalAlignmentEntrySlice-  {-    structuralEntrySequenceSliceIdentifier :: String,-    structuralEntryAlignedSliceSequence :: String-  }-  deriving (Show, Eq)--

@@ -1,294 +0,0 @@--- | Parse Clustal output---   For more information on Clustal tools consult: <http://www.clustal.org/>-module Bio.ClustalParser (-                       parseClustalAlignment,-                       readClustalAlignment,-                       parseStructuralClustalAlignment,-                       readStructuralClustalAlignment,-                       parseClustalSummary,-                       readClustalSummary,-                       module Bio.ClustalData-                      ) where--import Bio.ClustalData-import Text.ParserCombinators.Parsec    -import Control.Monad-import Data.List-import qualified Data.Text as T-readDouble :: String -> Double-readDouble = read              --readInt :: String -> Int-readInt = read---- | Parse the input as ClustalSummary datatype-genParserClustalSummary :: GenParser Char st ClustalSummary-genParserClustalSummary = do-  newline-  newline-  newline-  space-  string "CLUSTAL "-  version <- many1 (noneOf " ")-  many1 (noneOf "\n")-  newline-  newline-  newline-  string "Sequence format is "-  sequenceFormat' <- many1 (noneOf "\n")-  newline-  sequenceParametersList <- many1 (try genParserSequenceParameters)-  string "Start of Pairwise alignments" -  newline-  string "Aligning..."-  newline-  newline-  pairwiseAlignmentSummaryList <- many1 genParserPairwiseAlignmentSummary-  string "Guide tree file created:   ["-  guideTreeFileName' <- many1 (noneOf "]")-  char ']'-  newline-  newline-  string "There are "-  numberOfGroups <- many1 digit-  string " groups"-  newline-  string "Start of Multiple Alignment"-  newline-  newline-  string "Aligning..."-  newline-  groupSummaryList <- many1 genParserGroupSummary-  string "Alignment Score "-  alignmentScore' <- many1 digit-  newline-  newline-  string "CLUSTAL-Alignment file created  ["-  alignmentFileName' <- many1 (noneOf "]")-  char ']'-  newline-  newline-  eof  -  return $ ClustalSummary (T.pack version) (T.pack sequenceFormat') sequenceParametersList pairwiseAlignmentSummaryList (T.pack guideTreeFileName') (readInt numberOfGroups) groupSummaryList (readInt alignmentScore') (T.pack alignmentFileName')--genParserGroupSummary :: GenParser Char st GroupSummary-genParserGroupSummary = do-  string "Group " -  groupIndex <- many1 digit-  string ":"-  optional space-  optional (string "Sequences:")-  many1 space-  sequenceNumber <- optionMaybe (many1 digit)-  optional (many1 space)-  string "Score:" <|>  string "Delayed"-  groupScore' <- optionMaybe (many1 digit) -  newline-  return $ GroupSummary (readInt groupIndex) (liftM readInt sequenceNumber) (liftM readInt groupScore')--genParserPairwiseAlignmentSummary :: GenParser Char st PairwiseAlignmentSummary-genParserPairwiseAlignmentSummary = do-  string "Sequences (" -  firstSeqIndex <- many1 digit-  string ":"-  secondSeqIndex <- many1 digit-  string ") Aligned. Score:"-  many1 space-  pairwiseScore <- many1 digit-  newline-  return $ PairwiseAlignmentSummary (readInt firstSeqIndex) (readInt secondSeqIndex) (readInt pairwiseScore)--genParserSequenceParameters :: GenParser Char st SequenceParameters-genParserSequenceParameters = do-  string "Sequence " -  sequenceIndexParam <- many1 digit-  string ": "-  sequenceIdentifierParam <- many1 (noneOf " ")-  spaces-  sequenceLengthParam <- many1 digit-  space-  string "bp"-  newline-  return $ SequenceParameters (readInt sequenceIndexParam) (T.pack sequenceIdentifierParam) (readInt sequenceLengthParam)---- | Parse the input as ClustalAlignment datatype-genParserClustalAlignment :: GenParser Char st ClustalAlignment-genParserClustalAlignment = do-  string "CLUSTAL"-  many1 (noneOf "\n")-  many1 (try newline)-  alignmentSlices <- many1 (try genParserClustalAlignmentSlice)-  optional newline-  eof  -  return (mergealignmentSlices alignmentSlices)--mergealignmentSlices :: [ClustalAlignmentSlice] -> ClustalAlignment-mergealignmentSlices slices = alignment-  where entrySlicesList = concatMap entrySlices slices -- list of lists of entry slices-        sequenceIdentifiers = nub (map entrySequenceSliceIdentifier entrySlicesList)-        mergedAlignmentEntries = map (constructAlignmentEntries entrySlicesList) sequenceIdentifiers-        mergedConservationTrack = concatMap conservationTrackSlice slices-        alignment = ClustalAlignment mergedAlignmentEntries (T.pack mergedConservationTrack)        --constructAlignmentEntries ::  [ClustalAlignmentEntrySlice] -> String -> ClustalAlignmentEntry-constructAlignmentEntries slices entryIdentifier= entry-  where currentSlices = filter (\a -> entrySequenceSliceIdentifier a == entryIdentifier) slices-        entrySequence = concatMap entryAlignedSliceSequence currentSlices-        entry = ClustalAlignmentEntry (T.pack entryIdentifier) (T.pack entrySequence)--genParserClustalAlignmentSlice :: GenParser Char st ClustalAlignmentSlice-genParserClustalAlignmentSlice = do-  entrySlices' <- many1 genParserClustalEntrySlice-  --extract length of identifier and spacer to determine offset of conservation track-  let offsetLenght = length (entrySequenceSliceIdentifier (head entrySlices')) + spacerLength (head entrySlices')-  conservationTrackSliceChoice  <- choice [(lookAhead (string "\n")), (try (genParserConservationTrackSlice offsetLenght))]-  --spacerAndConservationTrackSlice <- many1 (noneOf "\n")-  --let conservationTrackSlice' = drop offsetLenght spacerAndConservationTrackSlice-  --newline-  let conservationTrackSlice' = if (conservationTrackSliceChoice == "\n") then "" else conservationTrackSliceChoice-  optional newline-  return $ ClustalAlignmentSlice entrySlices' conservationTrackSlice'--genParserConservationTrackSlice :: Int -> GenParser Char st String-genParserConservationTrackSlice offsetLenght = do-  spacerAndConservationTrackSlice <- many1 (noneOf "\n")-  let conservationTrackSlice' = drop offsetLenght spacerAndConservationTrackSlice-  newline-  return $ conservationTrackSlice'--genParserClustalEntrySlice :: GenParser Char st ClustalAlignmentEntrySlice-genParserClustalEntrySlice = do-  sliceIdentifier <- many1 (noneOf " \n")-  spacer <- many1 (char ' ')-  sliceSequence <- parseNucleotideAlignmentEntry-  newline-  return $ ClustalAlignmentEntrySlice sliceIdentifier sliceSequence (length spacer)----Structural Clustal Parser functions---- | Parse the input as ClustalAlignment datatype as used in mlocarna-genParserStructuralClustalAlignment :: GenParser Char st StructuralClustalAlignment-genParserStructuralClustalAlignment = do-  genParseMlocarnaHeader-  alignmentSlices <- many1 (try genParserStructuralClustalAlignmentSlice)-  secondaryStructure <- genSecondaryStructure  -  energy' <- genParseEnergy-  eof  -  return (mergeStructuralAlignmentSlices (concat alignmentSlices) secondaryStructure energy')--genSecondaryStructure :: GenParser Char st String-genSecondaryStructure = do-  string "alifold"-  secondaryStructure <- many1 (try genSecondaryStructureSlice)-  return (concat secondaryStructure)--genSecondaryStructureSlice :: GenParser Char st String-genSecondaryStructureSlice = do-  many1 space -  secondaryStructureSlice <- many1 (try (oneOf ".()"))-  choice [try (string "\n"),try (string " ")]-  return secondaryStructureSlice-         -genParseEnergy :: GenParser Char st Double-genParseEnergy = do-  string "("-  many space -  energy' <- many1 (noneOf " ")-  optional space-  char ('=')-  many1 (noneOf "\n")-  newline  -  return (readDouble energy')--genParseMlocarnaHeader :: GenParser Char st String-genParseMlocarnaHeader = do-  string "mLocARNA"-  many1 (choice [alphaNum,oneOf "-: ()."])-  newline-  string "Copyright"-  many1 (choice [alphaNum,char ' '])-  newline-  newline  -  string "Compute pair probs ..."-  newline-  optional (try (string "Compute pairwise alignments ... "))-  optional (try newline)-  string "Perform progressive alignment ..."-  many1 newline-  return ""--mergeStructuralAlignmentSlices :: [StructuralClustalAlignmentEntrySlice] -> String -> Double -> StructuralClustalAlignment-mergeStructuralAlignmentSlices slices secondaryStructure energy' = alignment-  where sequenceIdentifiers = nub (map structuralEntrySequenceSliceIdentifier slices)-        mergedAlignmentEntries = map (constructStructuralAlignmentEntries slices) sequenceIdentifiers-        alignment = StructuralClustalAlignment mergedAlignmentEntries (T.pack secondaryStructure) energy'        --constructStructuralAlignmentEntries ::  [StructuralClustalAlignmentEntrySlice] -> String -> ClustalAlignmentEntry-constructStructuralAlignmentEntries slices entryIdentifier= entry-  where currentSlices = filter (\a -> structuralEntrySequenceSliceIdentifier a == entryIdentifier) slices-        entrySequence = concatMap structuralEntryAlignedSliceSequence currentSlices-        entry = ClustalAlignmentEntry (T.pack entryIdentifier) (T.pack entrySequence)--genParserStructuralClustalAlignmentSlice :: GenParser Char st [StructuralClustalAlignmentEntrySlice]-genParserStructuralClustalAlignmentSlice = do-  entrySlices' <- many1 (try genParserStructuralClustalEntrySlice)-  optional newline-  return entrySlices'--genParserStructuralClustalEntrySlice :: GenParser Char st StructuralClustalAlignmentEntrySlice-genParserStructuralClustalEntrySlice = do-  sliceIdentifier <- many1 (noneOf " ")-  many1 (char ' ')-  sliceSequence <- parseNucleotideAlignmentEntry-  newline-  return $ StructuralClustalAlignmentEntrySlice (filter (/='\n') sliceIdentifier) sliceSequence---- exported functions---- | Parse Clustal alignment (.aln) from String-parseClustalAlignment :: String -> Either ParseError ClustalAlignment -parseClustalAlignment = parse genParserClustalAlignment "genParserClustalAlignment"---- | Parse Clustal alignment (.aln) from filehandle                  -readClustalAlignment :: String ->  IO (Either ParseError ClustalAlignment)   -readClustalAlignment = parseFromFile genParserClustalAlignment---- | Parse Clustal alignment (.aln) with secondary structure in dot-bracket notation from String (as produced by mlocarna)-parseStructuralClustalAlignment :: String ->  Either ParseError StructuralClustalAlignment -parseStructuralClustalAlignment = parse genParserStructuralClustalAlignment "genParserStructuralClustalAlignment"---- | Parse Clustal alignment (.aln) with secondary structure in dot-bracket notation from filehandle (as produced by mlocarna)                  -readStructuralClustalAlignment :: String ->  IO (Either ParseError StructuralClustalAlignment)   -readStructuralClustalAlignment = parseFromFile genParserStructuralClustalAlignment---- |  Parse Clustal summary (printed to STDOUT) from String-parseClustalSummary :: String ->   Either ParseError ClustalSummary-parseClustalSummary = parse genParserClustalSummary "genParserClustalSummary"---- | Parse Clustal summary (printed to STDOUT) from file-readClustalSummary ::  String -> IO (Either ParseError ClustalSummary)       -readClustalSummary = parseFromFile genParserClustalSummary---- | Parse nucleotide sequence. Allowed letters according to IUPAC---parseNucleotideSequence :: GenParser Char st String---parseNucleotideSequence = do---  nucleotideSequence <- many1 (oneOf "RYSWKMBDHVNATUGCryswkmbdhvnatugc") ---  return $ nucleotideSequence---- | Parse nucleotide alignment entry. Allowed letters according to IUPAC and commonly used gap characters-parseNucleotideAlignmentEntry :: GenParser Char st String-parseNucleotideAlignmentEntry = do-  entry <- many1 (oneOf "~_-.RYSWKMBDHVNATUGCryswkmbdhvnatugc") -  return $ entry---- | Parse protein amino acid code sequence. Allowed letters according to IUPAC---parseProteinSequence :: GenParser Char st String---parseProteinSequence = do---  proteinSequence <- many1 (oneOf "ABCDEFGHIKLMNPQRSTVWXYZabcdefghiklmnpqrstvwxyz") ---  return $ proteinSequence---- | Parse protein amino acid code alignment entry. Allowed letters according to IUPAC and commonly used gap characters---parseProteinAlignmentEntry :: GenParser Char st String---parseProteinAlignmentEntry = do---  entry <- many1 (oneOf "~_-.ABCDEFGHIKLMNPQRSTVWXYZabcdefghiklmnpqrstvwxyz") ---  return $ entry

@@ -1,6 +1,6 @@ module ClustalParserSpec (spec) where -import Bio.ClustalParser +import Biobase.Clustal.Import  import Test.Hspec import Test.Hspec.QuickCheck import Text.Parsec.Error@@ -31,8 +31,8 @@     context "Parsing invalid input" $ do       it "Returns ParseError" $ do         (parseStructuralClustalAlignment "invalid input") `shouldBe` Left structuralClustalParseError-                                                       - ++ clustalParseError :: ParseError clustalParseError = (addErrorMessage (Expect "\"CLUSTAL\"") (newErrorMessage clustalErrorMessage clustalErrorSourcePosition)) @@ -59,7 +59,7 @@  structuralClustalExample :: String structuralClustalExample = "mLocARNA --- multiple Local (and global) Alignment of RNA --- LocARNA 1.8.0\nCopyright Sebastian Will\n\nCompute pair probs ...\nPerform progressive alignment ...\n\n\n\nAB001721.1/2735-2851  CCCGGUGACUAUAGAGAGAGGGCCACACCCGUUCCCAUCCCGAACACGGAAGUUAAGCCUCUCAUCGCUGAUGGUACUAUGUGGUUCGCUGCAUGGGAGAGUAGGACGUUGCCGGGU\ngi|451991584:1-117    CCCGGUGACUAUAGAGAGAGGGCCACACCCGUUCCCAUCCCGAACACGGAAGUUAAGCCUCUCAUCGCUGAUGGUACUAUGUGGUUCGCUGCAUGGGAGAGUAGGACGUUGCCGGGU\nalifold               (((((((((....(.(((.(((.....))).))).)...(((....)))..(((..(((((((((.((.(.(((.(((....))))))).))))))))).))..)))))))))))). (-38.30 = -38.30 +   0.00)\n"-                           + structuralClustalResult :: StructuralClustalAlignment structuralClustalResult = StructuralClustalAlignment [ClustalAlignmentEntry (T.pack "AB001721.1/2735-2851") (T.pack "CCCGGUGACUAUAGAGAGAGGGCCACACCCGUUCCCAUCCCGAACACGGAAGUUAAGCCUCUCAUCGCUGAUGGUACUAUGUGGUUCGCUGCAUGGGAGAGUAGGACGUUGCCGGGU"),ClustalAlignmentEntry (T.pack "gi|451991584:1-117") (T.pack "CCCGGUGACUAUAGAGAGAGGGCCACACCCGUUCCCAUCCCGAACACGGAAGUUAAGCCUCUCAUCGCUGAUGGUACUAUGUGGUUCGCUGCAUGGGAGAGUAGGACGUUGCCGGGU")] (T.pack  "(((((((((....(.(((.(((.....))).))).)...(((....)))..(((..(((((((((.((.(.(((.(((....))))))).))))))))).))..)))))))))))).") (-38.30)